Article pubs.acs.org/JAFC
Anthocyanin Accumulation and Molecular Analysis of Anthocyanin Biosynthesis-Associated Genes in Eggplant (Solanum melongena L.) Yanjie Zhang,† Zongli Hu,† Guihua Chu,† Cheng Huang,† Shibing Tian,*,‡ Zhiping Zhao,† and Guoping Chen*,† †
Bioengineering College, Chongqing University, Campus A, 174 Shapingba Main Street, Chongqing 400044, People’s Republic of China ‡ The Institute of Vegetable Research, Chongqing Academy of Agricultural Sciences, Chongqing 401329, People’s Republic of China S Supporting Information *
ABSTRACT: Eggplant (Solanum melongena L.) is an edible fruit vegetable cultivated and consumed worldwide. The purple eggplant is more eye-catching and popular for the health-promoting anthocyanins contained in the fruit skin. Two kinds of anthocyanin were separated and identified from purple cultivar (Zi Chang) by high-performance liquid chromatography− electrospray ionization tandem mass spectrometry. To investigate the molecular mechanisms of anthocyanin accumulation in eggplant, the transcripts of anthocyanin biosynthetic and regulatory genes were analyzed in the fruit skin and the flesh of the purple cultivar and the white cultivar (Bai Xue). Compared with the other tissues, SmMYB1 and all anthocyanin biosynthetic genes except PAL were dramatically upregulated in the fruit skin of the purple cultivar. Overexpression of SmMYB1 activated abundant anthocyanin accumulation in the regenerating shoots of eggplant. These results prove that transcriptional activation of SmMYB1 accounts for constitutive upregulation of most anthocyanin biosynthetic genes and the onset of anthocyanin biosynthesis in the purple cultivar. KEYWORDS: anthocyanin, eggplant, Solanum melongena L., SmMYB1, HPLC-ESI-MS/MS
■
INTRODUCTION Anthocyanins, a group of pigments widely spread in many plants, are responsible for the colors of red, purple, and blue in different kinds of botanical organs. These kinds of flavonoid compounds are thought to fulfill important functions in protecting plant tissues from damaging coldness and UV irradiation and promoting pollination and seed distribution.1 There is growing evidence that shows that a healthy diet containing foods rich in anthocyanins can notably reduce the risk of suffering some chronic illnesses including cancer.2−6 Although the health-promoting effects are usually thought to be inseparable from the high antioxidant activities, recent articles suggest that anthocyanins have the ability to modulate signaling pathways in mammalian cells for the explanation of some beneficial biological effects.7,8 Due to the benefits anthocyanins bring to the human body, colored vegetable and fruits with high levels of anthocyanins are more eye-catching and commercially available than the colorless cultivars. As an agronomically important solanaceous crop, eggplant (Solanum melongena L.) is cultivated and consumed worldwide. Eggplant varieties differ in the fruit size, shape, and color, but the cultivars with dark purple skin receive more attention for high nutritional value. Owing to the capacity of oxygen radical scavenging brought by phenolic constituents included in fruit, eggplant is ranked as a member of the top ten vegetables.9 As a critical group of naturally occurring pigments, anthocyanins are the main phenolic compounds in eggplant peel. Composition analysis revealed that the major ingredients of anthocyanins are different in various kinds. Nasunin (delphinidin-3-(p-coumaroylrutinoside)-5-glucoside) was identified as the main compo© 2014 American Chemical Society
nent accounting for antioxidant activity and antiangiogenic activity of eggplant skin in Japan cultivars,10,11 while highperformance liquid chromatography−mass spectrometry (HPLC-MS) analysis of eggplant from the U.S. market showed that delphinidin 3-rutinoside is the predominant form of anthocyanins found in the fruit skin.12 However, the molecular mechanisms of anthocyanin biosynthesis in eggplant remain unclear. Hence, research about anthocyanin biosynthesis is of great significance to cultivate anthocyanin-rich foods for fulfilling the growing requirements for health-promoting ingredients in all diets. As a multienzymatic pathway, the flavonoid pathway is responsible for the production of anthocyanins. In addition, the pathway also leads to the products including proanthocynidins and flavonols. The enzyme evolved in anthocyanin biosynthesis in eggplant are as follows: phenylalanine ammonia lyase (PAL), cinnamate 4-hydroxylase (C4H), 4-coumarateCoA ligase (4CL), chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), flavonoid 3′-hydroxylase (F3′H), flavonoid 3′5′-hydroxylase (F3′5′H), dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS), and anthocyanidin 3-O-glucosyltransferase (3GT). Besides, PAL is the first enzyme that catalyzes phenylalanine to cinnamic acid, while 3GT is used to convert anthocyanidin to a stable status (anthocyanin) in the end.13 Received: Revised: Accepted: Published: 2906
October 11, 2013 February 20, 2014 March 4, 2014 March 4, 2014 dx.doi.org/10.1021/jf404574c | J. Agric. Food Chem. 2014, 62, 2906−2912
Journal of Agricultural and Food Chemistry
Article
Figure 1. Anthocyanin component analysis in the fruit of eggplant. (A) Photographs of the two eggplant cultivars (Zi Chang on the left and Bai Xue on the right) used in this study. (B) HPLC profiles of anthocyanins in Zi Chang skin. Peak numbers refer to the anthocyanins listed in Table 1. Structures and major cleavage of delphinidin-3-glucoside-5-(coumaryl)dirhamnoside in reference to peak 1 is framed in the red box. (C) LC-MS/MS ion graphs of the major anthocyanin delphinidin-3-glucoside-5-(coumaryl)dirhamnoside (m/z 919.2, 757.2, 465.1, 303.0 ([M + H]+)) from the Zi Chang cultivar.
On the basis of the extensive studies reported, it is obvious that the increased expression of some structural genes is directly associated with enhanced levels of anthocyanin accumulation.14,15 Moreover, transcriptional activation of anthocyanin biosynthesis-related transcription factors always accounts for tissue specific upregulation of structural genes in nature conditions.16,17 Numbers of regulatory genes including R2R3MYB transcription factors, basic helix−loop−helix (bHLH) transcription factors, MADS transcriptional factors, and WD40 proteins have been cloned from many plants, such as Arabidopsis, potato, petunia, and other species.18 In addition, the two major families of anthocyanin biosynthesis-related regulatory proteins, R2R3MYB and bHLH transcription factors, are found to form regulatory complexes with WD40 proteins in regulating the expression of structural genes.19,20 Therefore, expression analysis of anthocyanin structural genes and associated transcriptional factors should be helpful for the explanation of tissue specific pigment accumulation in eggplant fruit skin. In this article, the purple cultivar Zi Chang and the control cultivars Bai Xue that has no pigment accumulation in the fruit were used for this study (Figure1A). Anthocyanin production in eggplant was analyzed by high-performance liquid chromatography−electrospray ionization tandem mass spectrometry (HPLC-ESI-MS/MS). To investigate the molecular mechanism of anthocyanin biosynthesis, the dynamic transcriptional levels of anthocyanin structural genes and regulatory transcriptional factors were analyzed by quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) in the fruit skin and the flesh in these two cultivars. Then, the tissue specific expression gene SmMYB1 was transformed into wild eggplant under the drive of the 35s promoter. In the regenerating shoots with abundant anthocyanin accumulation, we examined the expression level of SmMYB1 and some vital structural genes of the anthocyanin biosynthetic pathway. This
work expanded our knowledge about anthocyanin accumulation and the underlying molecular mechanism in eggplant. It will be helpful for the breeding of high anthocyanin content eggplant cultivars in both traditional breeding and genetic engineering.
■
MATERIALS AND METHODS
Plant Materials. Eggplant (S. melongena L.) seeds of the white cultivar (Bai Xue) and the purple cultivar (Zi Chang) were obtained from Chongqing Academy of Agriculture Sciences. The seeds were sown directly into soil and grown in a greenhouse with a 16 h photoperiod at 28 °C. The fruits of eggplant were harvested at 12−15 days after anthesis. Both the skin and the flesh of Bai Xue are white. Zi Chang has purple pigment accumulated in the skin but not in the flesh (Figure 1A). The fruit skins of the two cultivars were manually peeled in the thickness of about 2 mm. The fruit flesh was cut into tiny cubes. All the samples were frozen in liquid nitrogen and stored at −80 °C for RNA extraction and other analyses. RNA Extraction and qRT-PCR Analysis. The skin and flesh samples of the two cultivars were grounded into powder in liquid nitrogen. Total RNA was isolated from various tissues for three biological repeats using RNAiso reagent according to the manufacturer’s instruction (Takara, Dalian, PRC). RNA samples (1 μg) were reverse transcripted into complementary DNA (cDNA) with an oligo(dT)20 primer and M-MLV reverse transcriptase (Promega, Madison, WI) following the manufacturer’s protocol. The synthesized cDNAs were diluted five times in H2O for qRT-PCR analysis. qRT-PCR was carried out using the CFX96 Real-Time System (C1000 thermal cycler). All reactions were performed using the GoTaq qPCR Master Mix according to the manufacturer’s instructions. Reactions were performed in triplicate using 5 μL of Master Mix, 0.25 μM each primer, 1 μL of diluted cDNA, and DNasefree water to a final volume of 10 μL. The PCR amplification was as follows: 1 cycle of 3 min at 95 °C, 40 cycles of denaturation for 15 s at 95 °C, annealing for 30 s at 60 °C, and elongation for 15 s at 72 °C. Amplification was followed by a melting curve analysis with continual fluorescence data acquisition during the 60−95 °C melt. Melt curve analysis of qPCR samples revealed that there was only one product for 2907
dx.doi.org/10.1021/jf404574c | J. Agric. Food Chem. 2014, 62, 2906−2912
Journal of Agricultural and Food Chemistry
Article
each gene primer reaction. The primers used for qPCR analysis were designed by Primer Premier 5 and are listed in Supplementary Table 1 (Supporting Information). The PCR products were sequenced to confirm the specific amplifications. The gene expression was normalized to SmGAPDH as a reference gene. Values reported here were calculated from three biological repeats for each sample. Gene Cloning and Sequence Analysis. The full-length coding sequence of anthocyanin biosynthesis-related transcription factors were cloned from eggplant by RT-PCR with degenerate primers and finally named SmMYB1, SmMYB2, SmAN11, SmbHLH1, and SmMADS1, respectively, referring to the corresponding genes from tomato and potato. Sequence similarities were calculated with DNAMAN version 5.2.2. The phylogenetic and molecular evolutionary analysis was used with MEGA (Molecular Evolutionary Genetics Analysis) version 3.1. Chemicals. Anthocyanin (delphinidin 3-rutinoside chloride) for external standards was purchased from Phytolab (Germany). HPLCgrade formic acid and methanol (MeOH) were bought from Sigma. All the other solvents were provided from Aldrich (St. Louis, MO). Anthocyanin Extraction and HPLC-ESI-MS/MS Analysis. Anthocyanin extraction of eggplant was carried out as the same way as for radish.21 The extract was filtered through a 0.2 μm PTFE syringe filter. The samples were then analyzed by an Agilent Technologies 1200 Series HPLC (Agilent Technologies, Palo Alto, CA), equipped with an Agilent 1200 HPLC variable wavelength detector. The results were analyzed by Agilent 1200 HPLC ChemStation software. The chromatographic separation was performed on a Zorbax Stablebond Analytical SB-C18 column (4.6 mm × 250 mm, 5 μm, Agilent Technologies, Rising Sun, MD). The injection sling was 10 μL. Elution was performed using mobile phase A (aqueous 5% formic acid solution) and mobile phase B (methanol). The detection was at 520 nm, and the column oven temperature was set at 40 °C. The flow rate was 1 mL/min. The gradient program is described as follows: 0−5 min, 10−20% B; 5−10 min, 20−30% B; 10−15 min, 30−40% B; 15− 25 min, 40% B; 25−30 min, 40−60% B; 31−32 min, 90% B; 32−35 min, 10% B. Quantification of the different anthocyanins was based on peak areas and calculated as equivalents of the standard compounds. All contents were expressed as milligrams per grams of dry weight. Low-resolution electrospray mass spectrometry was performed with a solariX ion trap mass spectrometer (Bruker Daltoniks, Billerica, MA). The experimental conditions were as follows: ESI interface, nebulizer, 50 psi; dry gas, 15.0 psi; dry temperature, 320 °C; MS/MS, scan from m/z 200 to 2000; ion trap, scan from m/z 200 to 2000; source accumulation, 50 ms; ion accumulation time, 300 ms; flight time to acq. cell, 1 ms; smart parameter setting (SPS), compound stability, 50%; trap drive level, 60%. Total Anthocyanin Analysis. Spectrophotometric differential pH method was used for the measurement of total anthocyanins. The protocols are described as follows. Frozen samples (100 mg) were crushed into powder in liquid nitrogen and then extracted separately with 2 mL of pH 1.0 buffer and 2 mL of pH 4.5 buffer. In addition, pH 1.0 buffer contains 50 mM KCl and 150 mM HCl, while pH 4.5 buffer contains 400 mM sodium acetate and 240 mM HCl. The mixtures were centrifuged at 14 000g for 10 min at 4 °C. The supernatants were gathered for measurement of absorbance at 510 nm. The amount of total anthocyanin was calculated according to the equation which follows:
for the replacement of GUS. Primers used for amplification of SmMYB1 are SmMYB1-con-F, GCGATCTAGAAATAAAATGAATAATCCTCC, and SmMYB1-con-R, GACTGAGCTCCGAAAACAGACAATATTACTA. The binary vector pBI121-SmMYB1 containing the SmMYB1 cDNA driven by the 35S promoter was transferred into Agrobacterium tumefaciens strain LBA4404 by the freeze−thaw method. Eggplant (S. melongena) ‘Bai Xue’ was used for the generation of transgenic callus by Agrobacterium-mediated transformation, using the protocol previously reported.22
■
RESULTS AND DISCUSSION Identification and Quantitative Analyses of Anthocyanins. By analyzing the extracts from the fruit of Zi Chang and Bai Xue cultivar with LC-MS/MS, two kinds of anthocyanins were separated and identified (Table 1 and Table 1. Anthocyanins Identified in the Eggplant Zi Chang Skin no.a
RTb (min)
[M + M]+ (m/z)
MS/MS (m/z)
1
17.56
919
757/465/303
2
18.86
757
a b
anthocyanin delphinidin-3-glucoside-5(coumaryl)dirhamnoside delphinidin-3-glucoside-5dirhamnoside
No. corresponds to the elution order by HPLC analysis in Figure 1B. RT is the retention time.
Figure1B,C). Then, the MS/MS (m/z) fragmentation pattern was applied to verify the identity of anthocyanins in purple fruit skin with the information provided by earlier reports.12 These results show that delphinidin may be the unique aglycone present in all eggplant fruits.10−12 However, the major component of anthocyanin in Zi Chang cultivar is delphinidin-3-glucoside-5-(coumaryl)dirhamnoside, which is apparently different from the anthocyanins identified in other cultivars. These results show that the purple eggplant cultivars reported up to now share the same pattern of anthocyanidin biosynthesis but with different modification patterns. The total anthocyanins content from Zi Chang skin was found to be 1.24 mg/g of dry weight. (Table 2). The content of major identity delphinidin-3Table 2. Anthocyanin Content (mg/g dry wt) in the Two Eggplant Cultivars (Zi Chang, Bai Xue) (n = 3) no.a 1 2
anthocyanin delphinidin-3-glucoside-5-(coumaryl) dirhamnoside delphinidin-3-glucoside-5dirhamnoside
ZCSb
ZC-F
1.10
nd
0.14
nd
c
BX-S
BX-F
nd
nd
nd
nd
a
No. corresponds to the elution order by HPLC analysis in Figure 1B. ZC-S, Zi Chang skin; ZC-F, Zi Chang flesh; BX-S, Bai Xue skin; and BX-F, Bai Xue flesh. cnd is not detected.
b
amount (mg g −1
glucoside-5-(coumaryl)dirhamnoside is 1.10 mg/g, while the minor identity is only 0.14 mg/g. So, eggplant should be classified in the food category containing simple anthocyanins in contrast with cabbage and radish.12,14,21 Consequently, it is the major anthocyanin delphinidin-3-glucoside-5-(coumaryl)dirhamnoside that contributes to the purple color in fruit skin principally. Isolation and Sequence Analysis of Anthocyanin Biosynthesis Regulatory Genes from S. melongena L. Given that the gene sequences encoding anthocyanin biosynthesis enzymes can be found partially in the database of the
FW) = (A1 − A2) × 484.8/24.825 × dilution factor A1 represents the absorbance of supernatants gathered from pH 1.0 buffer solution at 510 nm while A2 represents the other. The value 484.8 represents the molecular mass of cyaniding-3-glucoside chloride, while 24 825 reflects its molar absorptivity at 510 nm. The total anthocyanins of sample were analyzed in triplicate. Vector Construction and Transformation of Eggplant. The complement DNA was synthesized with total RNA with M-MLV (Promega, Madison, WI) as the recommendation of manufacturer. The full-length coding sequence of SmMYB1 was cloned into pBI121 2908
dx.doi.org/10.1021/jf404574c | J. Agric. Food Chem. 2014, 62, 2906−2912
Journal of Agricultural and Food Chemistry
Article
Figure 2. Expression analysis of anthocyanin biosynthesis genes in the skin and the flesh of two eggplant cultivars. ZC-S, Zi Chang skin; ZC-F, Zi Chang flesh; BX-S, Bai Xue skin; and BX-F, Bai Xue flesh. Error bars represent the standard error of the mean (n = 3). Statistical significance of the differences between samples was calculated with ANOVA by paired-group comparisons. Different letters indicate significance at P < 0.05.
Figure 3. Expression analysis of anthocyanin biosynthesis-associated transcriptional factors in the skin and the flesh of two eggplant cultivars. ZC-S, Zi Chang skin; ZC-F, Zi Chang flesh; BX-S, Bai Xue skin; and BX-F, Bai Xue flesh. Error bars represent the standard error of the mean (n = 3). Statistical significance of the differences between samples was calculated with ANOVA by paired-group comparisons. Different letters indicate significance at P < 0.05.
Institute for Genomic Research, our research focused on the cloning of regulatory gene sequences with primers designed according to conserved sequences from other species. Then, the full-length coding sequences of a bHLH transcriptional factor (SmbHLH1), a MADS transcriptional factor (SmMADS1), two R2R3MYB transcriptional factors (SmMYB1 and SmMYB2), and a WD40 protein (SmAN11) are obtained. The gene identities were further verified by
sequence alignment with orthologous sequences from other plants. The results of sequence alignment show that the orthologous genes from different eggplant cultivars share the same predicted protein sequence in spite of some inconsistencies in the nucleotide sequence. Then, it is reasonable to speculate that the accumulation of anthocyanins in purple eggplant may be the result of the alternation in expression level of some transcription factors. 2909
dx.doi.org/10.1021/jf404574c | J. Agric. Food Chem. 2014, 62, 2906−2912
Journal of Agricultural and Food Chemistry
Article
Figure 4. Overexpression of SmMYB1 in eggplant elevates the expression levels of structure genes and anthocyanin production. (A) Pigmented callus transformed with 35S-SmMYB1. (B) Three independent regenerating shoot lines transformed with 35S-SmMYB1 with one regenerating shoot transformed with empty vector. (C) Anthocyanin content in different lines of shoot. (D) transcriptional analysis of SmMYB1 in different regeneration shoots. (E, F) transcriptional analysis of anthocyanin biosynthesis genes SmANS (E) and SmDFR (F) in different regeneration shoots.
Expression Analysis of Anthocyanin Biosynthetic Genes in the Skin and Flesh of Different Eggplant Cultivars. For the purpose of investigating the molecular mechanisms underlying anthocyanin biosynthesis in eggplant, the transcriptional level of anthocyanin synthetic genes including SmPAL, SmCHS, SmCHI, SmF3H, SmF3′5′H, SmDFR, SmANS, and Sm3GT were examined in the skin and the flesh from two eggplant cultivars (Figure 2). The expression levels of all these genes except SmPAL are dramatically upregulated in the Zi Chang fruit skin compared with the other three tissues. Especially, the expression levels of SmF3′5′H, SmDFR, SmANS, and Sm3GT are upregulated to at least 1000 fold in the purple fruit skin. From the results reported previously,23,24 the phenomenon that small amounts of transcripts of all the structural genes were always detected in the green cultivars with no visible anthocyanin pigmentation was apparently observed. Here, we speculate that sufficient transcripts of some structural genes are essential for a large amount of anthocyanin production in the fruit skin of the Zi Chang cultivar. Expression Analysis of Anthocyanin BiosynthesisAssociated Regulatory Genes in the Skin and the Flesh of Different Eggplant Cultivars. According to recent research, anthocyanin structural genes are regulated by a complex composed of MYB, bHLH, and WD40 proteins from three different families of transcriptional factors.18 MYB and
bHLH transcription factors play essential roles in activating anthocyanin biosynthetic genes among various plant species, while WD40 proteins play a critical role in the process of complex formation. In addition, the transcriptional factor of MADS family is also found to be involved in anthocyanin accumulation in sweet potato.25 Therefore, expression analysis of anthocyanin biosynthesis-associated regulatory genes provides critical information to reveal the molecular mechanisms of pigment accumulation in eggplant fruit skin. The expression level analyses of SmMYB1, SmMYB2, SmbHLH1, SmAN11, and SmMADS1 are shown in Figure 3. The R2R3MYB gene SlANT1 was identified from tomato as a transcriptional regulator of anthocyanin biosynthesis, modification, and transport.26 Hence, two MYB genes were cloned and designated as SmMYB1 and SmMYB2 because of high similarity with SlANT1. Sequence analysis of SmMYB1 reveals that the predicted protein contains a R2R3 DNA binding domain that is involved in the interaction with bHLH cofactor (Supplementary Figure 1, Supporting Information). SmMYB1 was the only transcription factor that was significantly upregulated in the fruit skin of the Zi Chang cultivar. The enhanced expression of the MYB gene in certain tissue was in accordance with the anthocyanin distribution pattern of the two cultivars. These results indicate that SmMYB1 may play a major role in the anthocyanin biosynthesis regulation. It is worth mentioning that SmMYB2 is unlikely necessary for the anthocyanin 2910
dx.doi.org/10.1021/jf404574c | J. Agric. Food Chem. 2014, 62, 2906−2912
Journal of Agricultural and Food Chemistry
Article
in activating anthocyanin biosynthesis in Zi Chang fruit skin by transcriptional activation of anthocyanin structural genes. Owing to the great benefits anthocyanins bring to human health, foods rich in anthocyanins are attracting more and more attention from the public gradually. Since eggplant is an important food crop world widely cultivated, the consumption of high anthocyanin-containing fruit in the diet will raise the intake of health-promoting phytonutrients undoubtedly. Unfortunately, the existing cultivars of eggplant only have purple pigments accumulated in the skin but not in the flesh. Although we can elevate the anthocyanin content of eggplant fruit by overexpression of exogenous genes like tomato, the potential risks still exist.6 Hence, an intragenic approach that improves the agricultural traits of the crop by modifying the genome of the plant provides us a new method to elevate the anthocyanin content of eggplant fruit.31 However, the isolation of anthocyanin biosynthesis activator gene SmMYB1 made an important progress toward the breeding of high anthocyanincontaining eggplant with little potential risk.32 In summary, this work not only promotes our understanding of the molecular mechanisms underlying anthocyanin biosynthesis in eggplant but also provides a candidate gene for the development of eggplant cultivar that is rich of anthocyanins.
biosynthesis in purple eggplant for the reason that the transcripts of SmMYB2 are little to detect by qPCR. The expression analyses of SmbHLH1 and SmAN11 in the different cultivars show that these two genes are not accounted for the transcriptional activation of anthocyanin structural genes in purple eggplant. Furthermore, SlTDR4, which is the orthologous gene of SmMADS1, was proved to be an important switch that regulates the process of fruit ripening in an ethyleneindependent manner including the accumulation of pigments.27 However, the transcripts of SmMADS1 in fruit skin in contrast with flesh indicate that the pathway of anthocyanin biosynthesis is probably independent of SmMADS1. Overexpression of SmMYB1 in Transgenic Eggplant. Phylogenetic analysis shows that SmMYB1 lays in the same cluster with the anthocyanin synthesis activator SlANT1 and CaMYB1 (Supplementary Figure 1, Supporting Information). To further study the function of the SmMYB1 gene, the fulllength coding sequence of SmMYB1 driven by the 35S promoter was overexpressed in the callus of eggplant. Compared with the kanamycin resistant callus transformed by the empty vector, there were large amounts of anthocyanin accumulation on the surface of kanamycin resistant callus transformed by the vector containing the SmMYB1 gene (Figure 4A). Overexpression of the SmMYB1 gene resulted in the high level of anthocyanin accumulation in purple regeneration shoots (Figure 4B,C). Furthermore, the expression of SmMYB1 and two key anthocyanin biosynthesis genes in regenerating shoots was confirmed by qRT-PCR (Figure 4D−F). The enhanced expression of SmMYB1 was in accordance with a coordinated increase in transcript levels of SmANS and SmDFR. In addition, the enhanced expression of SmMYB1 was also in accordance with the total anthocyanin content in regenerative shoots. These results demonstrate that overexpression of SmMYB1 is able to activate anthocyanin biosynthesis by the way of significantly raising the expression level of anthocyanin structural genes. In this study, delphinidin-3-glucoside-5-(coumaryl)dirhamnoside was identified as the major anthocyanin in Chinese purple eggplant cultivar Zi Chang. In contrast to the control, SmF3′5′H that mainly catalyzes the hydroxylation at the 3′- and 5′-position of the B ring is dramatically upregulated at the transcript level.28 Therefore, delphinidin should be the unique aglycone in the purple eggplant skin despite a lack of MS/MS (m/z) data of peak 2. Furthermore, the substantially upregulation of most of anthocyanin structural genes provides a reasonable explanation for large amounts of pigmentation accumulation in Zi Chang fruit skin. By expression analysis of flavonoid biosynthetic regulatory genes, SmMYB1 is found to be significantly upregulated in the tissue where considerable pigments accumulate. Similarity and phylogenetic analysis of SmMYB1 with other MYBs from various species suggests that SmMYB1 might participate in the activating of anthocyanin biosynthesis in eggplant.29,30 Moreover, the pigments displayed in the kanamycin resistant callus and regenerating shoots confirmed the hypothesis proposed above. Besides, the total anthocyanins content of other tissues in Zi Chang cultivar was measured by the spectrophotometric differential pH method (Supplementary Figure 3, Supporting Information). The distribution pattern of anthocyanin content agrees well with the expression level of SmMYB1 in the tissues above (Supplementary Figure 4, Supporting Information). Therefore, all of these results prove that SmMYB1 plays an important role
■
ASSOCIATED CONTENT
S Supporting Information *
Table of primers used for RT-PCR; figures describing protein sequence alignment of SmMYB with MYBs from other plants, showing phylogenetic analysis of SmMYB1 and other MYBs, showing anthocyanin content in different tissues from Zi Chang cultivar, and depicting the expression level of SmMYB1 in different tissues of Zi Chang cultivar. This material is available free of charge via the Internet at http://pubs.acs.org.
■
AUTHOR INFORMATION
Corresponding Authors
*(S.T.) E-mail:
[email protected]. *(G.C.) Phone: 0086 23 65112674; fax: 0086 23 65112674; email:
[email protected]. Funding
This work was supported by National Natural Science Foundation of China (nos. 31100089 and 31171968) and Technology System of National Bulk Vegetable Industry-Eggplant Breeding Position (CARS-25-A-06). Notes
The authors declare no competing financial interest.
■
ABBREVIATIONS USED PAL, phenylalanine ammonia lyase; CHS, chalcone synthase; CHI, chalcone isomerase; F3H, flavone 3-hydroxylase; F3′5′H, flavonoid 3′,5′-hydroxylase; DFR, dihydroflavonol reductase; ANS, anthocyanidin synthase; HPLC, high-performance liquid chromatography; ESI-MS/MS, elctrospray ionization tandem mass spectrometry; qRT-PCR, quantitative real-time reverse transcription PCR
■
REFERENCES
(1) Harborne, J. B.; Williams, C. A. Advances in flavonoid research since 1992. Phytochemistry 2000, 55, 481−504. (2) Toufektsian, M. C.; de Lorgeril, M.; Nagy, N.; Salen, P.; Donati, M. B.; Giordano, L.; Mock, H. P.; Peterek, S.; Matros, A.; Petroni, K.; Pilu, R.; Rotilio, D.; Tonelli, C.; de Leiris, J.; Boucher, F.; Martin, C.
2911
dx.doi.org/10.1021/jf404574c | J. Agric. Food Chem. 2014, 62, 2906−2912
Journal of Agricultural and Food Chemistry
Article
of anthocyanin biosynthetic genes in radish (Raphanus sativus). J. Agric. Food Chem. 2011, 59, 6034−6039. (22) Filippone, E.; Lurquin, P. F. Stable transformation of eggplant (Solanum melongena L.) by cocultivation of tissues withAgrobacterium tumefaciens carrying a binary plasmid vector. Plant Cell Rep. 1989, 8, 370−373. (23) Feyissa, D. N.; Lovdal, T.; Olsen, K. M.; Slimestad, R.; Lillo, C. The endogenous GL3, but not EGL3, gene is necessary for anthocyanin accumulation as induced by nitrogen depletion in Arabidopsis rosette stage leaves. Planta 2009, 230, 747−754. (24) Palapol, Y.; Ketsa, S.; Lin-Wang, K.; Ferguson, I. B.; Allan, A. C. A MYB transcription factor regulates anthocyanin biosynthesis in mangosteen (Garcinia mangostana L.) fruit during ripening. Planta 2009, 229, 1323−1334. (25) Lalusin, A.; Nishita, K.; Kim, S.-H.; Ohta, M.; Fujimura, T. A new MADS-box gene (IbMADS10) from sweet potato (Ipomoea batatas (L.) Lam) is involved in the accumulation of anthocyanin. Mol. Genet. Genomics 2006, 275, 44−54. (26) Mathews, H.; Clendennen, S. K.; Caldwell, C. G.; Liu, X. L.; Connors, K.; Matheis, N.; Schuster, D. K.; Menasco, D. J.; Wagoner, W.; Lightner, J.; Wagner, D. R. Activation tagging in tomato identifies a transcriptional regulator of anthocyanin biosynthesis, modification, and transport. Plant Cell 2003, 15, 1689−1703. (27) Bemer, M.; Karlova, R.; Ballester, A. R.; Tikunov, Y. M.; Bovy, A. G.; Wolters-Arts, M.; Rossetto Pde, B.; Angenent, G. C.; de Maagd, R. A. The tomato FRUITFULL homologs TDR4/FUL1 and MBP7/ FUL2 regulate ethylene-independent aspects of fruit ripening. Plant Cell 2012, 24, 4437−4451. (28) Seitz, C.; Eder, C.; Deiml, B.; Kellner, S.; Martens, S.; Forkmann, G. Cloning, functional identification and sequence analysis of flavonoid 3′-hydroxylase and flavonoid 3′,5′-hydroxylase cDNAs reveals independent evolution of flavonoid 3′,5′-hydroxylase in the Asteraceae family. Plant Mol. Biol. 2006, 61, 365−381. (29) Feng, S.; Wang, Y.; Yang, S.; Xu, Y.; Chen, X. Anthocyanin biosynthesis in pears is regulated by a R2R3-MYB transcription factor PyMYB10. Planta 2010, 232, 245−255. (30) Lin-Wang, K.; Bolitho, K.; Grafton, K.; Kortstee, A.; Karunairetnam, S.; McGhie, T. K.; Espley, R. V.; Hellens, R. P.; Allan, A. C. An R2R3MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae. BMC Plant Biol. 2010, 10, 50. (31) Rommens, C. M. All-native DNA transformation: A new approach to plant genetic engineering. Trends Plant Sci. 2004, 9, 457− 64. (32) Rommens, C. M. Intragenic crop improvement: Combining the benefits of traditional breeding and genetic engineering. J. Agric. Food Chem. 2007, 55, 4281−4288.
Chronic dietary intake of plant-derived anthocyanins protects the rat heart against ischemia-reperfusion injury. J. Nutr. 2008, 138, 747−752. (3) Paredes-Lopez, O.; Cervantes-Ceja, M. L.; Vigna-Perez, M.; Hernandez-Perez, T. Berries: Improving human health and healthy aging, and promoting quality lifeA review. Plant Foods Hum. Nutr. 2010, 65, 299−308. (4) de Pascual-Teresa, S.; Moreno, D. A.; Garcia-Viguera, C. Flavanols and anthocyanins in cardiovascular health: A review of current evidence. Int. J. Mol. Sci. 2010, 11, 1679−703. (5) Guarnieri, S.; Riso, P.; Porrini, M. Orange juice vs vitamin C: Effect on hydrogen peroxide-induced DNA damage in mononuclear blood cells. Br. J. Nutr. 2007, 97, 639−643. (6) Butelli, E.; Titta, L.; Giorgio, M.; Mock, H. P.; Matros, A.; Peterek, S.; Schijlen, E. G.; Hall, R. D.; Bovy, A. G.; Luo, J.; Martin, C. Enrichment of tomato fruit with health-promoting anthocyanins by expression of select transcription factors. Nat. Biotechnol. 2008, 26, 1301−1308. (7) Meiers, S.; Kemeny, M.; Weyand, U.; Gastpar, R.; von Angerer, E.; Marko, D. The anthocyanidins cyanidin and delphinidin are potent inhibitors of the epidermal growth-factor receptor. J. Agric. Food Chem. 2001, 49, 958−962. (8) Williams, R. J.; Spencer, J. P.; Rice-Evans, C. Flavonoids: Antioxidants or signalling molecules? Free Radical Biol. Med. 2004, 36, 838−849. (9) Cao, G.; Sofic, E.; Prior, R. L. Antioxidant capacity of tea and common vegetables. J. Agric. Food Chem. 1996, 44, 3426−3431. (10) Noda, Y.; Kneyuki, T.; Igarashi, K.; Mori, A.; Packer, L. Antioxidant activity of nasunin, an anthocyanin in eggplant peels. Toxicology 2000, 148, 119−123. (11) Matsubara, K.; Kaneyuki, T.; Miyake, T.; Mori, M. Antiangiogenic activity of nasunin, an antioxidant anthocyanin, in eggplant peels. J. Agric. Food Chem. 2005, 53, 6272−6275. (12) Wu, X.; Prior, R. L. Identification and characterization of anthocyanins by high-performance liquid chromatography-electrospray ionization-tandem mass spectrometry in common foods in the United States: Vegetables, nuts, and grains. J. Agric. Food Chem. 2005, 53, 3101−3113. (13) Winkel-Shirley, B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001, 126, 485−493. (14) Yuan, Y.; Chiu, L. W.; Li, L. Transcriptional regulation of anthocyanin biosynthesis in red cabbage. Planta 2009, 230, 1141− 1153. (15) Crifò, T.; Petrone, G.; Lo Cicero, L.; Lo Piero, A. R. Short cold storage enhances the anthocyanin contents and level of transcripts related to their biosynthesis in blood oranges. J. Agric. Food Chem. 2011, 60, 476−481. (16) Butelli, E.; Licciardello, C.; Zhang, Y.; Liu, J.; Mackay, S.; Bailey, P.; Reforgiato-Recupero, G.; Martin, C. Retrotransposons control fruit-specific, cold-dependent accumulation of anthocyanins in blood oranges. Plant Cell 2012, 24, 1242−1255. (17) Chiu, L. W.; Zhou, X.; Burke, S.; Wu, X.; Prior, R. L.; Li, L. The purple cauliflower arises from activation of a MYB transcription factor. Plant Physiol. 2010, 154, 1470−1480. (18) Gonzalez, A.; Zhao, M.; Leavitt, J. M.; Lloyd, A. M. Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings. Plant J. Cell Mol. Biol. 2008, 53, 814−827. (19) Albert, N. W.; Lewis, D. H.; Zhang, H.; Schwinn, K. E.; Jameson, P. E.; Davies, K. M. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning. Plant J. Cell Mol. Biol. 2011, 65, 771−784. (20) Spelt, C.; Quattrocchio, F.; Mol, J. N.; Koes, R. Anthocyanin1 of petunia encodes a basic helix-loop-helix protein that directly activates transcription of structural anthocyanin genes. Plant Cell 2000, 12, 1619−1632. (21) Park, N. I.; Xu, H.; Li, X.; Jang, I. H.; Park, S.; Ahn, G. H.; Lim, Y. P.; Kim, S. J.; Park, S. U. Anthocyanin accumulation and expression 2912
dx.doi.org/10.1021/jf404574c | J. Agric. Food Chem. 2014, 62, 2906−2912
