Application of an in vitro Blood Brain Barrier model in the Selection of

Subscriber access provided by Bethel University

Article

Application of an in vitro Blood Brain Barrier model in the Selection of Experimental Drug Candidates for the Treatment of Huntington’s Disease Annalise Di Marco, Odalys Gonzalez Paz, Ivan Fini, Domenico Vignone, Antonella Cellucci, Maria R. Battista, Giulio Auciello, Laura Orsatti, Matteo Zini, Edith Monteagudo, Vinod Khetarpal, Mark Rose, Celia Dominguez, Todd Herbst, Leticia Toledo-Sherman, Vincenzo Summa, and Ignacio Muñoz-Sanjuan Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.9b00042 • Publication Date (Web): 27 Mar 2019 Downloaded from http://pubs.acs.org on March 28, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

Application of an in vitro Blood Brain Barrier model in the Selection of Experimental Drug Candidates for the Treatment of Huntington’s Disease Annalise Di Marco†, Odalys Gonzalez Paz†, Ivan Fini†, Domenico Vignone†, Antonella Cellucci†, Maria R. Battista†, Giulio Auciello†, Laura Orsatti‡, Matteo Zini‡, Edith Monteagudo‡, Vinod Khetarpal§, Mark Rose§, Celia Dominguez§, Todd Herbst§, Leticia Toledo-Sherman§, Vincenzo Summa‖, and Ignacio Muñoz-Sanjuán +§*. †

In vitro Pharmacology Unit; IRBM Science Park SpA, Pomezia (Rome), Italy

‡

Preclinical Research Unit; IRBM Science Park SpA, Pomezia (Rome), Italy

§

CHDI Management; CHDI Foundation, 6080 Center Drive Los Angeles, CA, USA

‖

Department Chemistry; IRBM Science Park SpA, Pomezia (Rome), Italy.

ACS Paragon Plus Environment

1

Molecular Pharmaceutics 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 52

ABSTRACT: Huntington's disease (HD) is a neurodegenerative disease caused by a polyglutamine expansion in the huntingtin (HTT) protein. For drug candidates targeting HD, the ability to cross the blood brain barrier (BBB) and reach the site of action in the central nervous system (CNS) is crucial for achieving pharmacological activity. To assess permeability of selected compounds across the BBB, we utilized a two-dimensional model composed of primary porcine brain endothelial cells and rat astrocytes. Our objective was to use this in vitro model to rank and prioritize compounds for in vivo pharmacokinetic and brain penetration studies. The model was first characterized using a set of validation markers chosen based on their functional importance at the BBB. It was shown to fulfill the major BBB characteristics, including functional tight junctions, high transendothelial electrical resistance (TEER), expression and activity of influx and efflux transporters. The in vitro permeability of fifty-four, structurally diverse, known compounds was determined and shown to have a good correlation with the in situ brain perfusion data in rodents. We used this model to investigate BBB permeability of a series of new HD compounds from different chemical classes and we found good correlation with in vivo brain permeation, demonstrating the usefulness of the in vitro model for optimizing CNS drug properties and for guiding the selection of lead compounds in a drug discovery setting.

KEYWORDS: blood-brain barrier, CNS, transport, Huntington’s disease, permeability, efflux transporters, brain penetration.


2

Page 3 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Huntington’s disease is a monogenic disorder encompassing a variable phenotype with progressive cognitive, psychiatric and movement disorders, caused by an expanded CAG trinucleotide repeat (of variable length) in HTT, the gene that encodes the protein huntingtin. The disease is associated with high morbidity and mortality rates and there are a number of pharmacological interventions that are being evaluated. Currently, HD therapeutics are limited to symptomatic treatments and there are no treatment options with proven safety and efficacy to slowdown disease progression or enhance survival rate. Due to lack of approved drugs, the medical need of HD is still very high1. One of the major challenges in developing therapeutic agents for neurological diseases is the difficulty in delivering them to the brain. The complexity of the brain and the requirement of the drug to cross the BBB are the main reasons for high attrition rates in development of CNS targeting medicines. Early assessment of the physiochemical properties required for drugs to cross the BBB is extremely important to reduce the time spent on unproductive or redundant development activities. In addition, understanding the nature of the permeability and transport mechanisms at the blood-brain barrier is a central part of CNS drug development. Due to the high complexity of the brain, in vivo screening and data analysis are challenging, thus initial BBB related studies are frequently performed using in vitro models. In vitro BBB systems provide a less resourceintensive alternative compared to dosing animals with subsequent measuring of the compound brain concentrations. In addition, when a decision is made to perform an in vivo pharmacokinetic study, in vitro BBB experiments can often help to interpret animal brain exposure at the cellular and molecular levels.


3


Page 4 of 52

Several in vitro model systems to assess BBB permeation have been developed using primary brain endothelial cells from different species2,3. The best in vitro BBB models are based on the co-culture of endothelial cells and glial cells, astrocytes, and/or brain pericytes, which participate in the acquisition of BBB characteristics4,5. Co-cultured models using porcine brain endothelial cells (PBECs) have been shown to be particular useful for characterizing CNS drugs since this cell model possesses a restrictive paracellular pathway, functional expression of transporters and ease of culture to support drug screening6. The two-dimensional BBB model described in this work was formed by primary porcine brain endothelial cells and rat astrocytes. This model was evaluated for a number of characteristics including endothelial cell organization and purity, TEER, paracellular marker permeability, qualitative and quantitative expression of tight junction proteins and functionality of efflux transporters such as P-glycoprotein. Our objective was to establish and validate an in vitro BBB model to be used for permeability evaluation of investigational compounds and to help prioritize compounds for in vivo studies. We assessed the in vitro permeability of therapeutic compounds from specific HD screening programs and compared our findings with in vivo brain partition data.


4

Page 5 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


EXPERIMENTAL SECTION Materials and Reagents Minimum Essential Medium (MEM), Dulbecco’s Modified Eagle’s Medium (DMEM), Medium 199 (M199), Ham’s F-12, L-15 Leibovitz Media and Lucifer Yellow were purchased from Life Technologies (Thermo Fisher Scientific, Monza Italy); Endothelial Growth Basal Medium EBM-2 with EGM-2 SingleQuot Kit Suppl. & Growth Factors were purchased from Lonza (Basel, Switzerland). Sterile Plasma Derived Bovine Serum (PDBS) was from First Link (Birmingham, UK); collagenase type II from Worthington (Worthington Biochemical Corp. NJ); Fetal Bovine Serum (FBS), penicillin/streptomycin, glutamine, HEPES, fungizone, deoxyribonuclease I and Hoechst 33342 were from Invitrogen (Thermo Fisher Scientific, Monza IT); bovine serum albumin (BSA) fraction V was from Roche (Basel, Switzerland); nylon meshes (60 µm and 150 µm pore size) were from Plastok Associates, UK. Rat tail collagen type I, human fibronectin, cell strainer (70 µm nylon), tissue culture plastic flasks T75 and 150 mm TC-treated cell culture dishes were all purchased from Corning (Sigma-Aldrich, Milan Italy). [14C]taurocholic acid, [14C]phenytoin, [14C]dopamine, [14C]phenylalanine, [3H]naloxone, [14C]sucrose, [3H]propranolol, [14C]caffeine, [14C]tryptophan, [14C]leucine, [14C]mannitol, [3H]kynurenine, [3H]digoxin, [14C]arginine, [3H]verapamil, [3H]vinblastine, [3H]daunomycin, [3H]testosterone, [14C]inulin, [3H]enkephalin (2-D-penicillamine, 5-D-penicillamine), [3H]methyl-glucose and Microscint 20 Scintillation liquid were purchased from Perkin Elmer (Milan, IT). [14C]theophylline, [3H]quinidine, [3H]methotrexate, [3H]gabapentin, [3H]metoprolol, [3H]amprenavir, [3H]ritonavir, [14C]taxol, [3H]estrone-3-sulfate, [3H]atenolol, [3H]L-DOPA (L3,4-dihydroxyphenylalanine) and [14C]-docosahexaenoic acid lysophosphatidylcholine


5


Page 6 of 52

(LPC[14C]-DHA) were purchased from BIOTREND Chemikalien GmbH (Köln, Germany); [3H]prazosin and imatinib from Amersham, Life Science (UK). Fibronectin solution from human fibroblasts, puromycin dihidrochloride, heparin sodium salt from porcine intestinal mucosa, hydrocortisone, fluorescein isothiocyanate labelled dextrans of various polymerization size (FITC-Dextran 4, FITC-Dextran 40 and FITC-Dextran 70), dimethyl sulfoxide (DMSO), endothelial cell growth supplement from bovine neural tissue, trypsin-EDTA solution 1X, poly-D-lysine hydrobromide, GF120918, KO-143, MK-571, altanserin hydrochloride hydrate, biotin, rodamine 123, 3-hydroxy-kynurenine, anthralinic acid, kynurenic acid, pantothenic acid, parthenolide, triton X100 and Wheaton Dounce tissue grinder were purchased from Sigma–Aldrich (Milan Italy). Alvespimycin (17-DMAG), masitinib, nilotinib and NVP-HSP990 were purchased from SelleckChem (Munich, Germany). Bafetinib from Cayman Chemical (Michigan, USA); dasatinib from AstaTech (Boston, USA); laquinimod from Akos (Steinen, Germany); 8% paraformaldehyde aqueous solution was from Electron Microscopy Sciences (Hatfield, PA). The rat-tail collagen used for insert coating was prepared according to Strom and Michalopoulos7. CHDI compounds, denoted cp, were synthesized as previously described8. Tissue culture treated multi-well plates and transwell filter inserts (1.1 cm2 growth area, 0.4 µm pore size; transparent polyester) were obtained from Corning Costar (Sigma-Aldrich, Milan Italy); transwell 24-well plate (0.7 cm2 growth area, 0.4 µm pore size, polycarbonate membrane) were obtained from Millipore (Merck S.p.A., Milan Italy). Optiplate-96 and white Opaque 96well microplate from Perkin Elmer (Milan Italy). Corning 96-well plates, polystyrene, from Corning Costar (Sigma-Aldrich, Milan Italy). The antibodies used for immunochemistry studies are listed in Table 1.


6

Page 7 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Antibodies used in this study for immunofluorescence. Target epitope Anti-occludin Anti-claudin-5 Anti-ZO-1 tight junction protein Anti-Von Willebrand factor Anti-P Glycoprotein [4E3] Anti-Mfsd2A Anti-rabbit IgG (H+L) Anti-rabbit IgG (H+L) cross-adsorbed Anti-mouse IgG (H+L) cross-adsorbed

Species

Type

Conjugation

RRID*

Vendor

Cat nb dilution

rabbit rabbit mouse rabbit mouse rabbit goat goat rabbit

polyclonal polyclonal monoclonal polyclonal monoclonal polyclonal polyclonal polyclonal polyclonal

Alexa Fluor 488 Alexa Fluor 568 Alexa Fluor 594

AB_2533977 AB_2533157 AB_2533147 AB_305689 AB_297069 AB_10711504 AB_2576217 AB_143157 AB_2534109

Thermo Fisher Thermo Fisher Thermo Fisher Abcam Abcam Abcam Thermo Fisher Thermo Fisher Thermo Fisher

71-1500 34-1600 33-9100 ab6994 ab10333 ab105399 A-11034 A-11011 A-11062

1:25 1:25 1:100 1:400 1:10 1:50 1:3000 1:3000 1:3000

*Research Resource IDentifier

Isolation of brain microvascular endothelial cells Brain microvascular endothelial cells were isolated from fresh porcine brains following the methods of Patabendige et al.3 and Skinner et al.9 with some modifications. Briefly, cells were isolated from porcine brains obtained from local slaughterhouses and transported on ice in L15 medium containing penicillin (100 U/ml) and streptomycin (100 μg/ml). Meninges and white matter were removed and the grey matter was collected in MEM containing 10% FBS, penicillin (100 U/ml), streptomycin (100 μg/ml), 2 mM glutamine and 25 mM Hepes (MEM-H). Then, the tissue suspension was homogenized in a glass-glass Wheaton Dounce tissue grinder and sequentially filtered, first through 150 μm nylon mesh and then through 60 μm nylon mesh. Microvessel fragments were digested with collagenase type II, for 1 hour at 37°C, in M199 medium containing 10% FBS. After centrifugation, for 5 min at 240 x g at 4°C, the mixture was resuspended in 20% bovine serum albumin in MEM-H and centrifuged at 1000 x g, at 4°C to remove the supernatant containing myelin. The pellet was resuspended in MEM-H and the suspension was filtered through 70 µm nylon cell strainer. After centrifugation at 240 x g at 4°C for 5 min, the pellet was resuspended in complete endothelial culture medium (ECM), composed of EBM-2 supplemented with 10% PDBS, 2 mM glutamine, 100 U/mL penicillin, 100 µg/mL


7


Page 8 of 52

streptomycin, 0.25 µg/ml fungizone, 4 μg/ml puromycin, 125 µg/ml heparin and the SingleQuots™ Kit (except heparin and serum). Capillary fragments were plated in T75 flasks coated with 100 µg/ml rat-tail collagen and 7.5 µg/ml fibronectin. We routinely obtain sufficient material for two T75 flask from one brain. Cultures were maintained for four days in ECM at 37°C and 5% CO2 with medium change every day.

Culture on Transwell inserts and TEER measurement Endothelial cells were detached using Trypsin-EDTA and resuspended in endothelial differentiation medium (EDM) consisting of DMEM/F12 1:1 containing 10% PDBS, 125 µg/ml heparin, 100 U/mL penicillin, 100 µg/mL streptomycin, 2 mM glutamine and 100 µg/ml of endothelial cell growth supplement. Cells were plated at 200,000/cm2 on rat-tail collagen (100 µg/ml) /fibronectin (7.5 µg/ml)-coated transwell filters. In parallel, rat astrocytes isolated from the cerebral cortex of newborn pups (1–2 days old, Sprague-Dawley (SD-CD) rats from Charles River) as described previously by Abbott et al.10, were plated on poly-D-lysine coated 12-or 24well plates at 150,000 cells/cm2 in Dulbecco’s modified Eagle’s medium (DMEM) (high glucose) supplemented with 10% FBS, 2 mM glutamine, 100 U/mL penicillin and 100 µg/mL streptomycin. Three days later, endothelial cells were put in co-culture with rat astrocytes in EDM containing 550 nM hydrocortisone. Co-cultures were monitored by measuring the TEER every day using STX2 chopstick electrodes connected to EVOM2 voltmeter (World Precision Instruments, USA). TEER of the cell monolayer was obtained by subtracting the resistance (Ω) of coated blank filter insert (without cells) from the resistance measured across the insert with cell monolayer. The resulting value was multiplied by the surface area of the filter insert to express result as Ω.cm2. Gaillard and De Boer11 recommended considering 200 Ω.cm2 as a


8

Page 9 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


threshold, but since TEER is a relative measurement, we set a quality control benchmark at 400 Ω.cm2 for permeability assays.

Immunocytochemistry Cells in transwell inserts (polyester membrane Transwell-Clear) were washed with phosphate buffered saline (PBS) and fixed in 4% paraformaldehyde for 20 min at room temperature. Cells were permeabilized by washing five times (2 min each) with PBS/0.1% Triton X-100 and blocked in PBS containing 1% bovine serum albumin (blocking buffer) for 2 h at room temperature. Primary antibodies, diluted as reported in Table 1 were added in blocking buffer for 2 h at room temperature. Cells were then washed four times and incubated in blocking buffer with the secondary antibody, diluted as recommended by the manufacturer, and the nuclear stain Hoechst 33342 (2 µM) for one hour at room temperature. Cell images were acquired with the INCell Analyzer 2000 (GE Healthcare).

mRNA extraction and quantification by real-time qRT-PCR (TaqMan) Total RNA was extracted after cell lysis in 96-well format from duplicate samples using an RNA extraction kit (Macherey-Nagel, Düren, Germany) on a Microlab STARlet (Hamilton, RENO, NV), according to the manufacturer’s protocol. Quantitative analysis of specific mRNA expression was performed by real-time qRT-PCR, by subjecting the resulting cDNA to PCR amplification using 384-well optical reaction plates in the QuantStudio 12k Flex Real-Time PCR (Applied Biosystem). The thermocycling conditions were initiated at 48°C for 15 min with an enzyme activation step of 95°C for 10 min, followed by forty PCR cycles of denaturation at 95°C for 15 s and anneal/extension at 60°C for 1 min. Single gene real-time PCR primers and


9


Page 10 of 52

probes were purchased from Applied Biosystem as “TaqMan Gene Expression assay” for the porcine genes listed in Table 2. The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization. Relative differences in mRNA expression were determined by the QuantStudio 12k Flex software (version v.1.2.3) based on threshold cycle (Ct) data of target gene versus endogenous control gene for each reaction. Table 2. Genes evaluated in this study and the TaqMan assays used for mRNA quantification. Symbol ABCB1 ABCC1 ABCC2 ABCG2 AGER BSG FABP5 FCGRT GAPDH IGF2R INSR LDLR SCARB1 SLC16A1 SLC22A5 SLC2A1 SLC7A5 SLC7A8 SLCO1A2 TFRC TNFRSF1A TNFRSF1B

Alias

Gene name

P-gp, MDR1

ATP-binding cassette, sub-family B, member 1

MRP1 for human MRP2 BCRP RAGE CD147 E-FABP FcRn GAPD M6P/IGF2R MCT1 OCTN2 GLUT1 LAT1, CD98 LAT2 OATP1A2 TrFr, CD71 TNFR1 TNFR2

ATP-binding cassette, sub-family C, member 1 ATP binding cassette, sub-family C, member 2 ATP-binding cassette, sub-family G, member 2 Advanced glycosylation end-product specific receptor Basigin Fatty acid binding protein 5 Fc fragment of IgG receptor and transporter alpha Glyceraldehyde-3-phosphate dehydrogenase Insulin-like growth factor receptor II Insulin receptor LDL receptor Scavenger receptor class B, member 1 Solute carrier family 16, member 1 Organic cation/carnitine transporter 2 Solute carrier family 2, member 1 Solute carrier family 7, member 5 Solute carrier family 7, member 8 Solute carrier organic anion transporter family, member 1A2 Transferrin receptor Tumor necrosis factor receptor superfamily, member 1A Tumor necrosis factor receptor superfamily, member 1B

ID (NCBI) 396910 733619 397535 397073 396591 100141312 574074 397399 396823 397214 396755 396801 397018 100127159 100520422 102164419 8140 23428 397534 397062 397020 100037306

Assay ID (ThermoFisher) Ss03373434_m1 Ss03376986_u1 customized* Ss03393456_u1 Ss03390850_g1 Ss03387611_u1 Ss03392151_m1 Ss03383313_u1 Hs02758991_g1 Ss03373426_m1 Ss03375405_u1 Ss03373254_u1 Ss03391101_m1 Ss03374095_m1 Ss03377456_u1 Ss03374747_s1 Hs01001189_m1 Hs00794796_m1 Ss03375623_u1 Ss03391237_m1 Ss03391126_g1 Ss03385518_u1

* Forward primer: CACTGTGGGCTTTGTTCTGT, reverse primer: TTTCTGACGTCATCCTCACC, 5’Fam-3’MGB labelled probe: CGCACTCAATATCACACAAACCCTGA.

Permeability assay Permeability studies were performed using cell monolayers with a TEER value greater than 400 Ω.cm2. All permeability studies were performed on Day 2-3 when the highest TEER values were achieved. The transport assays were usually performed during a short time frame (1 hour or less). In addition, kinetic experiments with selected compounds with a known transport


10

Page 11 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mechanism (influx, efflux) were also performed. The permeability values were maintained over time, indicating functionality of the transporters during the assay. Prior to the experiment, carried out at pH 7.4, 37°C and 5% CO2, culture medium was removed from the inserts and replaced by pre-warmed HBSS containing 20 mM Hepes, pH 7.4 and 0.1% BSA. The inserts were removed from the co-culture plates and placed in receiver plates, without astrocytes, containing the same buffer. The test compound was added together with the integrity marker (radiolabeled sucrose or FITC-Dextran 40) used as a second parameter to ascertain the quality of the cell monolayer. For each compound, inserts with endothelial cells were used in triplicates and cell-free, collagen /fibronectin-coated inserts were used in duplicates. The plates were placed in a cell incubator for sixty minutes, the inserts were then moved to another plate containing pre-warmed incubation buffer to minimize back diffusion of compound to the upper compartment. At the end of each experiment, samples were collected, the amounts of radiotracers and fluorescent tracers were determined by liquid scintillation (Top Count-NXT, Microplate Scintillation and Luminescence counter from Perkin Elmer) and fluorescence spectrophotometry (SAFIRE TECAN, Microplate Fluorescence reader), respectively, whereas for all other compounds the concentration was determined by LC-MS/MS. Mass balance was determined considering the amount of compound recovered in the donor and receiver chambers at the end of the assay relative to the amount added to the donor chamber at time 0. In efflux transport assays, before the addition of the compounds, filters were preincubated for 30 min at 37°C with or without 2 µM GF120918, 2 µM Ko143 or 10 µM MK571 which are inhibitors of Pgp, BCRP or various MRPs, respectively.


11


Page 12 of 52

The permeability coefficient (P) was calculated according to Pardridge et al.12, the PS (Permeability surface area product, in cm3/s) was divided by the filter surface area A (in cm2). Therefore, the permeability coefficient P is expressed in cm/s, following the equation (1) below Pcm / s  

Vd  Mr A  Md  t

where: Vd is the volume in the donor compartment in

cm3;

(1) ΔMr is the total amount of compound

in the receiver compartment after t seconds; Md is the donor amount (added at time 0); Δt is the incubation time measured in seconds and A is the filter area in cm2. The contribution of both filter and substrate is subtracted from the total permeability using the following equation (2):

1 1 1   Pe Pt Pf

(2) where: Pt is the permeability coefficient of the total system; Pf is the permeability coefficient of the cell-free coated filter and Pe is the permeability coefficient of the endothelial cell layer. In efflux transport assays, efflux ratio was calculated dividing the permeability value in the basal to apical (B-A) direction by the permeability value in the apical to basal (A-B) direction.

Bioanalysis For LC-MS/MS analysis, aliquots from the receiver and donor chambers were diluted with an equal volume of quenching solution for protein precipitation (0.1% formic acid (FA) in acetonitrile (ACN) containing an internal standard (IS)). Routinely used ISs include ketoconazole and dextromethorphan depending on the analytical conditions, or other ISs when appropriate. Samples were then vortexed and centrifuged at 4000 x g for 10 min at 4°C. 100 µl of the supernatant were evaporated under nitrogen at 30°C and reconstituted with an appropriate solution according to the developed LC method. In the reconstitution solvent 10 ng/ml warfarin and 50 ng/ml labetalol were included as volumetric IS for injection evaluation. In parallel a


12

Page 13 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


standard curve for each test compound was generated and finally, the samples were injected into the LC-MS/MS system for analysis. Single 12 points calibration curve for each test compound was prepared in HBSS-HEPES-BSA 0.1% buffer. The maximum percentage of final DMSO in each calibration standard (CS) was 0.1%. 100 µl of CS solution were added with an equal volume of quenching solution and processed as the samples. One set of each CS was included at the front-end of the run. Analyte response for the transition with the highest signal to noise ratio (S/N) was normalized to IS peak area and calibration was achieved by weighted linear least square regression (weight 1/x or 1/x2). CSs differing more than ± 30% of the nominal value were excluded. Carryover was assessed by injecting blank samples after samples and CS at the upper limit of quantification. Limit of quantitation (LOQ) was the lowest CS included in the linear range having S/N ≥ 5. The analysis was carried out on an Acquity I-Class UPLC System (Waters, Milford) coupled to an API-4000 or API-6500 (AB Sciex, Framingham, USA) mass spectrometer. The proper reverse phase or normal phase chromatographic column, mobile phases and gradient conditions were selected to obtain the best retention and separation of the test compound. In general, the total run time varied from 1.50 to 3.00 min for 2.1x30 mm or 50 mm columns. The best conditions for sample reconstitution varied from 0.1% FA in H2O or aqueous buffer/ACN or MeOH 90/10 to 0.1% FA in 100% ACN, depending on test compound solubility and MS response. Detection of test compound and IS was performed in multiple reaction monitoring (MRM). MRM transitions were optimized by direct infusion of pure standard solutions. The Turbo Ion Spray ESI source parameters were optimized for each compound tested and set as follows: source temperature 200-700°C, curtain gas 10-50 psi, gas1 10-45 psi, gas2 11-45 psi, ion spray


13


Page 14 of 52

voltage 4000-5500 V in positive ionization mode, declustering potential 20-100 V, entrance potential 5-15 V, collision energy 10-70 eV, cell exit potential 5-15 V. Data analysis was performed with Analyst 1.6.2.

Correlation with in vivo data For in vivo correlation, data from published values were used. The published cerebrovascular permeability-surface area products (PS) were converted into in vivo brain permeability values (P in vivo) by dividing PS by an estimated value of the surface area (S) of perfused capillaries equal to 150 cm2/g of brain13 and are reported in Table 3. In addition, information on in vivo brain penetration was obtained for compounds investigated as part of the discovery programs targeted for HD at CHDI Foundation. Following a single intravenous dosing of each compound to mice, plasma and brain ratio was determined at steady state. These series of compounds showed a bi-compartmental plasma pharmacokinetics, with fast uptake into the brain (within 0.5 h). Because of this, brain to plasma concentration ratio was calculated at each time point (six time points from 1 to 6h) and an average value was used for evaluation of correlation with the in vitro permeability data obtained in the PBEC model. Equivalent B/P ratio values were also obtained from AUC brain 1-6h divided by AUC plasma 1-6h. In addition to total brain-to-plasma concentration ratio (Kp), when plasma and brain homogenate free fractions were available, unbound brain-to-plasma concentration ratio (Kp,uu) was also calculated and used to further assess the correlation with in vitro permeability.


14

Page 15 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 3. Summary of the permeability values in the in vitro BBB model (Pin vitro) of the fiftyfour compounds with different transport mechanisms and their relative calculated in vivo permeability coefficients (Pin vivo).

Pin vitro Pin vivo (x10-6 cm/s) (x10-6 cm/s) Altanserin* Passive diffusion/active efflux (Pgp) 33.0 ± 6.2 Alvespimycin* Passive diffusion 3.1 ± 1.2 Amprenavir* Passive diffusion/active efflux (Pgp) 22.3 ± 4.3 Anthranilic acid Passive diffusion 19.3 ± 1.9 8.014 Arginine Active influx (y+L) 5.2 ± 3.8 23.315 Atenolol Passive diffusion 1.3 ± 0.6 0.216 Bafetinib* Passive diffusion/active efflux (Pgp) 16.8 ± 3.2 Biotin Active influx (SMVT) 3.6 ± 1.0 0.717 Caffeine Passive diffusion/active influx 40.8 ± 11.2 66.716 Dasatinib* Passive diffusion/active efflux (Pgp/BCRP) 7.0 ± 1.8 Daunomycin Passive diffusion/active efflux (Pgp/MRP) 4.1 ± 2.4 13.318 Digoxin Passive diffusion/active efflux (Pgp) 3.7 ± 2.2 0.318 Dopamine Passive diffusion/active uptake 29.8 ± 17.2 53.018 Bis Pen Enkephalin Multiple mechanisms 2.7 ± 0.8 0.319 Estrone-3-sulfate* Passive diffusion/active efflux (MRP/BCRP) 1.7 ± 0.6 FITC-Dextran 4* Passive diffusion 2.0 ± 1.3 FITC-Dextran 40* Passive diffusion 0.2 ± 0.2 FITC-Dextran 70* Passive diffusion 0.1 ± 0.1 Gabapentin Active influx (LAT) 8.4 ± 2.4 18.720 Glucose Active influx (GLUT-1) 7.0 ± 3.0 13.321 3-Hydroxykynurenine Active influx (LAT) 1.2 ± 1.02 0.214 Imatinib Passive diffusion/active efflux (Pgp/BCRP) 20.6 ± 1.0 9.322 Inulin Passive diffusion 1.9 ± 1.1 0.0323 Kynurenine Active influx (LAT) 3.0 ± 2.7 0.514 Kynurenic acid Passive diffusion 2.0 ± 1.1 0.714 Laquinimod* Passive diffusion 38.8 ± 4.2 L-DOPA* Passive diffusion/active influx (LAT) 5.9 ± 1.8 Leucine Active influx (LAT) 7.0 ± 3.0 1.324 LPC-DHA* MFSD2A mediated transport 4.3 ± 0.7 Lucifer Yellow* Passive diffusion 1.7 ± 0.8 Mannitol Passive diffusion 1.2 ± 0.8 0.125 Masitinib* Passive diffusion/active efflux (Pgp) 20.4 ± 10.6 Memantine* Passive diffusion/OCT mediated transport (influx/efflux) 50.5 ± 8.9 Methotrexate Passive diffusion/active efflux (MRP) 5.7 ± 1.8 0.818 Metoprolol Passive diffusion 23.6 ± 6.6 20.16 Naloxone Passive diffusion active efflux (MRP) 39.9 ± 9.2 33.326 Nilotinib* Passive diffusion/active efflux (Pgp) 7.4 ± 0.9 NVP-HSP990* Passive diffusion 33.9 ± 6.1 Pantothenic acid Active influx (SMVT) 4.2 ± 1.3 1.227 Parthenolide* Passive diffusion 39.0 ± 5.0 Phenylalanine Active influx (LAT) 13.0 ± 4.0 1.228 Phenytoin Passive diffusion/active efflux (MRP) 42.3 ± 8.3 42.118 Prazosin Passive diffusion/active efflux (BCRP) 13.4 ± 1.5 18.829 Propranolol Passive diffusion 41.1 ± 17.3 42118 Quinidine Passive diffusion/active efflux (Pgp) 16.7 ± 1.0 14.630 Ritonavir Passive diffusion/active efflux (Pgp) 28.8 ± 11.5 17.131 Rhodamine* Passive diffusion/active efflux (Pgp) 0.8 ± 0.3 Sucrose Passive diffusion 1.6 ± 0.9 0.0325 Taurocholic acid Active uptake/efflux 6.4 ± 3.7 0.518 Taxol Passive diffusion/active efflux (Pgp) 6.7 ± 2.8 0.232 Testosterone Passive diffusion 72.0 ± 24.1 53018 Theophylline Passive diffusion 5.1 ± 1.1 3.333 Tryptophan Active influx (LAT) 5.4 ± 2.0 13.334 Verapamil Passive diffusion/active efflux (Pgp) 35.7 ± 19.3 37.335 Vinblastine Passive diffusion/active efflux (Pgp/MRP) 1.9 ± 1.7 2.136 * Not considered for in vitro in vivo correlation. 14Fukui et al. 1991; 15Mahar et al. 2000; 16Avdeef. 2011; 17Park et al. 2005, 18Liu et al. 2004; 19Egleton et al. 1999; 20Summerfield et al. 2007; 21Pardridge. 1983; 22Bihorel et al. 2006; 23Abbruscato et al. 1997; 24Chikhale et al. 1995; 25Gratton et al. 1997; 6Zhang et al. 2006; 26Suzuki et al. 2010; 27Spector et al. 1986; 28Momma et al. 1987; 29Cisternino et al. 2004; 30Chen et al. 2002; 31Degenais et al. 2009; 32Rice et al. 2005; 33Youdim et al. 2004; 34Diksic et al. 2000; 35Zhao et al. 2009; 36Murakami et al. 2000. Compounds

BBB transport mechanism


15


Page 16 of 52

RESULTS Barrier characteristic, transcriptional profiling and protein expression Brain endothelial cells were obtained from digested porcine brain capillary fragments after four days in culture (Figure 1) and the generated monolayer was characterized by the expression of the endothelial marker Von Willebrand factor with the characteristic Weibel-Palade bodies staining (Figure 2).

Figure 1. Flow chart of the cell culture phases before the transport experiments in the BBB model. Capillaries from porcine brains are isolated and put in culture for four days. At subconfluence, the endothelial cells are plated onto coated Transwell filters. Three days later, they are put in co-culture with rat astrocytes to induce differentiation. Permeability assays are performed on day 9 and/or 10, corresponding to D2 and/or D3 of co-culture.

Figure 2. Phase-contrast micrographs of digested capillary fragments two hours after plating (A) and of endothelial monolayer four days after plating (B). Monolayer was formed of tightly packed, longitudinally aligned cells, typical for differentiated capillary endothelial cells. (C) Positive staining with the endothelial marker Von Willebrand Factor of endothelial cells (4-day monolayer) before culture in Transwell inserts. The granular green signal is characteristic of Weibel-Palade body staining of endothelial cells, nuclei are stained with Hoechst.


16

Page 17 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The endothelial cells were then grown on membrane inserts and put in co-culture with astrocytes to favor blood-brain-barrier differentiation. In order to create a barrier, the cells are stitched together through tight junctions. The immunofluorescence (Figure 3) showed the membrane localization of claudin-5, occludin and zonula occludens-1 (ZO-1), demonstrating the formation and the proper localization of the tight junctions.

Figure 3. Immunofluorescence micrographs for claudin-5 (A), occludin (B), and ZO-1(C) showed intense and delineated staining of all cell-cell contacts, indicating well organized and fully developed tight junctions (day 2 of co-culture) of PBECs. Intracellular immunostaining (D) of the endothelial marker Von Willebrand Factor. Nuclei were stained with Hoechst (scale bar = 20 µm).


17


Page 18 of 52

The endothelial barrier was also characterized by the TEER that increased from about 200 Ω.cm2, measured before co-culture (day 3 on the transwell filter, D0 co-culture) to typically 6001000 Ω.cm2 two days after co-culture (D2 co-culture) with rat astrocytes (Figure 4A). TEER values are indicative of the barrier tightness and thus permeability assays were usually performed on day 2. TEER and permeability values were compared and it appeared that above 400 Ω.cm2, the permeability coefficient of FITC-Dextran 40 became independent on TEER, remaining low (Figure 4B). Below this threshold, the lower the TEER, the higher the permeability, as observed in other studies3,11, supported us for using TEER values as first quality control. In fact, for permeability measurements only transwell filters with TEER equal of greater than 400 Ω.cm2 were utilized. TEER and permeability values of FITC-Dextran 40 were compared and the relationship observed in our model (Figure 4B) is similar to that reported in other studies3,11 using other paracellular markers (mannitol, sodium fluorescein and FITC-Dextran 4). The threshold of 200 Ω.cm2 is generally good for passive permeability but high TEER also ensures good transporter expression and polarity required for transcellular transport3. To increase reproducibility and because the cut-off of 400 Ω.cm2 was experimentally observed, we define it as quality control (QC) limit37.


18

Page 19 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Barrier function of PBEC/As model. A). TEER of endothelial cells on transwell increases during the first days of co-culture with astrocytes and decline after four days. Values are mean ± sem from at least six different experiments, each consisting in at least one 24-well plate. Value at seeding (D-3) was set at 0. B). Correlation between permeability of FITC-Dextran 40 and TEER, measured before permeability experiment performed at D2 or D3. Each point represents one transwell insert (n=1834).


19


Page 20 of 52

The co-culture of brain endothelial cells with astrocytes exhibited a good capacity in discriminating, among paracellular markers of different size, between large and small molecules (Table 4). Actually, permeability inversely correlated with both molecular weight and hydrodynamic radius, with mannitol, the smallest molecule being more permeable (1.2 ± 0.8 x10-6 cm/s) than FITC-Dextran 70 (0.1 ± 0.1 x10-6 cm/s), the largest marker.

Table 4. Permeability (P) in the BBB model of paracellular markers with different molecular weights (MW) and hydrodynamic radius (HR). Results are mean ± sd with n > 6 from at least two separated experiments. Paracellular marker

P

MW

HR

(x10-6 cm/s)

(kDa)

(nm)

Mannitol

1.2 ± 0.8

0.18

0.4

Sucrose

1.6 ± 0.9

0.34

0.5

Lucifer Yellow

1.7 ± 0.8

0.52

0.5

Inulin

1.9 ± 1.1

6

1.4

FITC-Dextran 4 kDa

2.0 ± 1.3

4

1.4

FITC-Dextran 40 kDa

0.2 ± 0.2

40

4.5

FITC-Dextran 70 kDa

0.1 ± 0.1

70

6.0

The blood-brain barrier is not only characterized by its tightness, but also by the expression of several transporter systems, responsible and essential for the import of nutrients, proteins and small molecules. Expression of transporters is subjected to variation upon in vitro culture of primary cells therefore, we analyzed expression levels at the same time in culture as the transport assays were performed. The mRNA levels of the major transporters and receptors were quantified by TaqMan to explore the expression profile of our PBEC/As model. The expression pattern was acquired at two days of co-culture, but similar results were obtained within a twoday variation (data not shown). The BBB membrane transporters include ATP-binding cassette


20

Page 21 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(ABC) transporters and solute carrier (SLC) transporters. These two classes of transporters are responsible for the uptake or efflux of nutrients and toxic agents. Among the ABC transporters, ABCB1 (Pgp) and ABCG2 (BCRP) were the most expressed (Figure 5). ABCG2 was more expressed than ABCB1, similar to what reported in human38.

Figure 5. Transporters and receptors gene expression profile in endothelial cells co-cultured for two days with astrocytes. mRNAs were analysed by TaqMan. Levels are relative to Glut1 (SLC2A1). Results (from a representative experiment) are mean ± sd from triplicate determination of biological duplicates. Genes are reported with their symbols (see Table 2 for full-length names).

The expression of the ABCB1 transporter was confirmed by immunofluorescence both in the capillary fragments and in endothelial cells after two days in co-culture with rat astrocytes where


21


Page 22 of 52

it showed predominantly membrane localization (Figure 6). ABCC1, formerly MRP1, which is expressed in the abluminal surface of the brain capillaries39 was more expressed (Figure 5) than ABCC2 (MRP2) which localize to the luminal side of the capillary. Within the Solute Carrier proteins examined, the major expression was found for SLC2A1 (GLUT1), which facilitates glucose uptake by the cells. Other transporters, for organic ions (SCL22A5 for organic cations, carnitine; SLCO1A2 for organic anions), for monocarboxylates such as lactate and pyruvate (SCL16A1), or for amino-acids (SLC7A5, SLC7A8), are less expressed than the Na+independent glucose transporter that helps D-glucose to cross the BBB to supply energy to the brain. Finally, selected surface receptors were examined, in particular the transferrin receptor and the Fc fragment of IgG receptors whose capacity to transport their natural ligands by transcytosis are studied to target therapeutics to the brain, thus crossing the BBB40. FCGRT was more expressed than TFRC but both were present in our model allowing transcytosis studies. Among the receptors important for lipid brain homeostasis, FABP5 was the most expressed in our system, with respect to the scavenger receptor class B type 1 (SRB1) and the low density lipoprotein receptor (LDLR), which is also studied to cargo drugs to the CNS. We also found a strong expression of CD147 (or Basigin) which has been shown to interact with SLC2A1 and SLC16A141, both expressed in our model at different levels. Another important fatty acid receptor, Mfsd2a,42 was highly expressed in capillary fragments containing cells that form the BBB as well as in the co-cultured endothelial cells as reported in Figure 6.


22

Page 23 of 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Immunofluorescence micrographs for Pgp (A,C) and Mfsd2a receptor (B, D) in capillary fragments (A: 48 h after platting, B: 24 h after plating) with endothelial cells spreading-out and in PBECs (C, D) after two days in co-culture. Nuclei were stained with Hoechst (scale bar = 50 µm).

Functional transport and in vivo correlation Once confirmed the expression of the principal efflux pumps, we investigated the functionality of the most important transporters in the BBB model. One of the main advantage of the culture insert system, is the possibility to measure the flux of molecules in the apical to basal direction, representing the luminal to abluminal passage i.e. blood to brain, and in the basal to apical direction, representing the brain to blood transit. The polarized distribution of the transporters is


23


Page 24 of 52

an element indicative of a differentiated cellular model, similar to what was shown in vivo. The luminal expression of Pgp and other drug-resistant proteins is responsible for the very low penetration of many anti-cancer drugs to brain tumors. We measured the permeability of some chemotherapeutics and other drugs in both apical to basal and basal to apical ways.

Table 5. Permeability (P) of compounds from apical to basal (A-B) and basal to apical (B-A) directions and relative efflux ratio. Results are mean ± sd with n > 3. Compound

Digoxin Quinidine Taxol Daunomycin Vinblastine Estrone-3-sulfate Prazosin Mannitol

Major efflux transporters

Pgp Pgp Pgp Pgp, MRP1 Pgp, MRP2 BCRP, MRPs BCRP -

Unpaired t-test

P (x10-6 cm/s)

A-B 3.7 ± 2.2 16.7 ± 1.0 6.7 ± 2.8 4.1 ± 2.4 1.9 ± 1.7 1.7 ± 0.6 13.4 ± 1.6 1.2 ± 0.8

B-A 6.9 ± 3.8 53.5 ± 15.9 27.8 ± 11.2 14.5 ± 5.9 6.3 ± 3.7 3.3 ± 1.6 22.2 ± 11.6 0.7 ± 0.3

Efflux ratio

P value

Application of an in vitro Blood Brain Barrier model in the Selection of

Recommend Documents