Catalytic Organic Reactions in Water toward Sustainable Society

Review pubs.acs.org/CR

Cite This: Chem. Rev. 2018, 118, 679−746

Catalytic Organic Reactions in Water toward Sustainable Society Taku Kitanosono, Koichiro Masuda, Pengyu Xu, and Shu̅ Kobayashi* Department of Chemistry, School of Science, The University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113-0033, Japan ABSTRACT: Traditional organic synthesis relies heavily on organic solvents for a multitude of tasks, including dissolving the components and facilitating chemical reactions, because many reagents and reactive species are incompatible or immiscible with water. Given that they are used in vast quantities as compared to reactants, solvents have been the focus of environmental concerns. Along with reducing the environmental impact of organic synthesis, the use of water as a reaction medium also benefits chemical processes by simplifying operations, allowing mild reaction conditions, and sometimes delivering unforeseen reactivities and selectivities. After the “watershed” in organic synthesis revealed the importance of water, the development of water-compatible catalysts has flourished, triggering a quantum leap in water-centered organic synthesis. Given that organic compounds are typically practically insoluble in water, simple extractive workup can readily separate a water-soluble homogeneous catalyst as an aqueous solution from a product that is soluble in organic solvents. In contrast, the use of heterogeneous catalysts facilitates catalyst recycling by allowing simple centrifugation and filtration methods to be used. This Review addresses advances over the past decade in catalytic reactions using water as a reaction medium.

CONTENTS 1. Introduction 2. Nonmetal Catalysts 2.1. Nonmetal Base Catalysts 2.2. Nonmetal Acid Catalysts 2.3. Other Nonmetal Catalysts 3. Metal-Based Catalysts 3.1. Metal Complexes 3.1.1. Rare-Earth-Metal Catalysts and FirstRow Transition-Metal Catalysts 3.1.2. Precious-Metal Catalysts 3.1.3. Other Metals 3.2. Supported Metal Catalysts 3.2.1. Immobilized Catalysts on Inorganic Supports 3.2.2. Immobilized Catalysts on Organic Supports 3.2.3. Metal−Organic Frameworks/Cages (MOFs/MOCs) 3.2.4. Artificial Supramolecular Catalysts Based on the Chirality of Biomolecules 3.3. Bulk Metal(0) and Metal Oxides/Hydroxides 3.3.1. Oxidative Reactions 3.3.2. Heteroatomic Oxometalates 3.3.3. Conversion of Alkynes and Aryl Bromides 3.3.4. Reactions on Acid or Base Sites 3.3.5. Reactions of Organometallic Species on Surface 3.3.6. Chirally Modified Metal(0)/Metal Oxide or Hydroxide 3.4. Metal Nanoparticle Catalysts © 2017 American Chemical Society

3.4.1. 3.4.2. 3.4.3. 3.4.4.

Palladium NPs Gold NPs Silver NPs Ruthenium, Rhodium, Iridium, and Platinum NPs 3.4.5. Iron and Nickel NPs 3.4.6. Copper NPs 3.4.7. Metal Oxide NPs 3.4.8. Bimetallic NPs 3.4.9. Chiral Metal NPs 4. Surfactant-Based Catalysts 4.1. Surfactant-Aided Catalysts 4.1.1. Anionic Surfactants 4.1.2. Cationic Surfactants 4.1.3. Nonionic Surfactants 4.2. Surfactant-Combined Catalysts 4.2.1. Lewis Acid−Surfactant Combined Catalysts 4.2.2. Brønsted Acid−Surfactant Combined Catalysts (BASCs) 4.2.3. Surfactant-Integrated Ligands for Metal Catalysts 4.2.4. Surfactant-Combined Nonmetal Catalysts 5. Summary and Outlook Author Information Corresponding Author ORCID

680 680 680 683 683 684 684 684 691 698 700 700 702 704 705 708 708 708 709 709

712 714 715 715 716 716 716 717 718 718 718 718 720 720 723 723 725 725 726 728 728 728 728

710 Special Issue: Sustainable Chemistry

710 712

Received: July 12, 2017 Published: December 8, 2017 679

DOI: 10.1021/acs.chemrev.7b00417 Chem. Rev. 2018, 118, 679−746

Chemical Reviews Notes Biographies Acknowledgments References

Review

solvent isotope effect.16 Infrared (IR)-visible sum frequency generation (SFG) spectroscopy revealed that the “oil−water” interface extended into the hydrophobic phase, with 25% of the water molecules protruding as free hydrogen atoms that were not involved in hydrogen bonding.17 The observation of a solvent isotope effect can be interpreted as a consequence of recognizing water-immiscible substrates through hydrogen bonding.18 Meanwhile, a recent report disputes the “on water” conditions on the basis of a conclusion that dissolution of the reactants in water is required for the Sharpless reaction.19,20 Indeed, the reaction mixture can be either homo- or heterogeneous in most examples of “on water” reactions reported so far. The definitions of “on water” have thus become an area of contention, with ever-evolving progress in chemistry using water as a reaction medium; this is especially the case for catalytic reactions. Needless to say, catalysis contributes greatly to sustainable chemistry nowadays, allowing the implementation of diverse chemical transformations and streamlining antiquated “stoichiometric” technologies in fine chemical and pharmaceutical manufacturing as well as in laboratory synthesis. The catalytic activation of small molecules to yield high-value-added products should underlie the up-to-date organic synthesis. In this context, catalysis in water should be of great benefit for the design of sustainable organic syntheses. In addition to reduced costs and environmental impact as compared to organic solvents, high heat capacity of water is well suited to exothermic reactions performed on a large scale. However, no consideration was given to catalysts in the “on water” criteria. Furthermore, water may disrupt subtle interactions between catalyst and transition states, leading to reduced activity and stereoselectivity. The unexpectedly high performance of many catalysts in water is, therefore, noteworthy, as is the noncatalytic unique reactivity observed in boiling water,21,23 in frozen water (ice),22 in supercritical water,24,25 and at the water−air interface.26 Because many organic compounds are practically insoluble in water, simple extractive workup can readily separate a catalyst as an aqueous solution from a product that is soluble in organic solvents when a catalyst is water-soluble. In contrast, the use of heterogeneous catalysts simplifies catalyst recycling by enabling the use of straightforward centrifugation and filtration techniques. Catalytic reactions in water also contribute to the field of sustainable organic synthesis. A review on this subject is presented herein, with particular emphasis on the distinguished role of water as a reaction medium in catalytic reactions that have been advanced over the past decade.

728 728 728 728

1. INTRODUCTION Water is widely recognized as a substance of vital importance for organic synthesis, due to its abundance, cost-efficiency, environmental compatibility, nontoxicity, and nonflammability. Growing awareness of the need for sustainable technologies has stimulated the chemical community to streamline synthetic methodologies across academic and industrial fields.1 Organic solvents favored by chemists, such as chlorinated hydrocarbons, have been blacklisted because of their responsibility for environmental pollution; indeed, the bulk of chemical waste is produced in the form of organic solvents. Alternative solvents developed so far include 2-methyltetrahydrofuran (2-MeTHF), cyclopentyl methyl ether (CPME), polyethylene glycol (PEG), supercritical fluids, ionic liquids, and biosolvents such as bioethanol, glycerol, and lignocellulosic biomass.2−6 Water holds an unassailable position among them as an ideal solvent. Although solvent-free processes seem to be the best, solvents play an immense role in bringing the equilibrium and reaction rates under control in most reactions.5 Distillative workup to isolate a product from an aqueous mixture sometimes seems a more cumbersome and energy-consuming process than techniques for isolation from organic solvents. However, the unique properties of water, such as its polarity, viscosity, and immiscibility, enable the facile extractive workup and purification of products.7 Furthermore, a number of techniques have been developed to remove dangerous contaminants from wastewater, such as biodegradation using fungi, microorganisms, or plants; chemical oxidation, such as the Fenton reaction or disinfection; photocatalytic degradation; and adsorption on activated carbon, alumina, and zeolites.8−10 Water has been, however, less extensively used as a solvent for practical syntheses such as named reactions in the laboratory or in industry because of the inherently low solubility of organic materials and the facile decomposition of active species in water. Traditional organic reactions typically require anhydrous and anaerobic conditions; when we conduct traditional reactions from a textbook, we usually ensure that all glassware, apparatus, and reagents are free from water and use anhydrous solvents. Significant effort is often made to construct strictly anhydrous conditions. Breslow’s seminal “rediscovery” of the acceleration of Diels−Alder reactions in water11,12 was a watershed in the historical role of water in organic chemistry. Water has been shown to improve the rate and endo−exo selectivity of Diels−Alder reactions when lithium chloride is added. Breslow illustrated that the acceleration resulting from the addition of “antichaotropic” salts such as lithium chloride, in contrast to the retardation induced by “chaotropic” salts such as guanidium chloride, supported his assumption that the influence of water was attributable to a hydrophobic effect.13,14 Among other points of interest, the solubility of the substrates is not always correlated with their reactivity. In 2005, Sharpless noted the remarkable acceleration of the reaction rate when using water as the reaction medium, and coined the term “on water” to describe the experimental conditions.15 He stipulated that “on water” reactions had to involve a stirred aqueous suspension possessing an oil−water interface. In addition to rate acceleration, “on water” reactions tend to show a significant

2. NONMETAL CATALYSTS Nonmetal catalysts have emerged as the third major approach to catalyzing a wide variety of reactions, besides metal catalysts and biocatalysts. They have gained tremendous importance because of their advantages for green chemistry. In general, nonmetal catalysts can be classified into one of two kinds on the basis of their acidity or basicity. Here, we will briefly introduce recent developments in nonmetal catalysis in water. 2.1. Nonmetal Base Catalysts

The development of nonmetal base catalysts in water has seen the most activity over the past 20 years. Typically, amine catalysts, such as proline, condense with carbonyl groups to afford an iminium ion or enamine intermediates, which can be captured by nucleophiles or electrophiles with excellent control 680


Chemical Reviews

Review

of enantioselectivity. Nonmetal base catalysis involving amino acids or their derivatives has been widely applied to various reactions, such as direct aldol reactions and Michael addition reactions. The development of nonmetal catalysis until 2014 has been well summarized elsewhere.27 Efforts to develop asymmetric nonmetal catalysts in water have also been reviewed.28 Broadly speaking, amino acids and their derivatives dominate a large portion of the reported nonmetal base catalysts used in water. Indeed, since the initial discovery of Lproline as a catalyst for the Hajos−Parrish−Eder−Sauer− Wiechert reaction, amino acids have proven to be simple yet effectual small molecular catalysts for organic reactions both in organic solvents and in water. Besides these numerous efforts to develop amino acidderived nonmetal base catalysts that function in water, several exceptions have also been reported. For example, in 2015, Liu, Li and co-workers reported the first example of an acid−base bifunctional squaramide nonmetal catalyst for the enantioselective conjugate addition of tritylthiol to in situ-generated ortho-quinone methides (o-QMs) (Scheme 1).29 The reactions

acids was realized through the Michael addition of β,βdisubstituted nitroalkenes with malonate derivatives. Recently, there has been more focus on water-compatible heterogeneous nonmetal catalysts, which possess many advantages, including easy recyclability and simple handling. Initially, heterogeneous nonmetal catalysts typically involved the use of simple polymers as a support. Pericàs’s group helped pioneer the development of a series of polymer-supported nonmetal catalysts and successfully applied them to asymmetric reactions in water, including the enantioselective α-aminoxylation of aldehydes and ketones,31 Michael addition reactions,32 and direct aldol reactions.33 The utilization of polymer-supported nonmetal catalysts enabled significantly simplified workup conditions, with easy catalyst recycling through the filtration of catalysts and elimination of solvents after the reactions. By simply integrating proline and polystyrene through a 1,2,3-triazole linker, Pericàs and coworkers further revealed that an aqueous microenvironment could be constructed through the swelling of the resin in water (Scheme 3).34 The authors assumed that the formation of a

Scheme 1. Enantioselective Conjugate Addition of Tritylthiol in Water

Scheme 3. Asymmetric Direct Cross-Aldol Reactions in Water with a Polystyrene-Supported Nonmetal Catalyst

proceeded with high yield (up to 99%) and good stereoselectivity (up to 94% ee) in the presence of water as the reaction medium. Control experiments suggested that o-QMs were generated by the tertiary amine moiety of the squaramide nonmetal catalyst, and that employing water as a solvent played a key role in achieving high reactivity and stereoselectivity. Very recently, Song’s group developed a chiral squaramide catalyst for Michael addition reactions with dithiomalonates, affording the desired enantiomeric Michael adducts with allcarbon-substituted quaternary centers (Scheme 2).30 This

hydrogen-bonding network connected the proline and 1,2,3triazole fragments, and thereby led to the high catalytic activity and enantioselectivity observed for the direct aldol reactions of aldehydes and cyclic ketones in water. Similarly, Gruttadauria and co-workers developed a recyclable proliamide-supported polystyrene for asymmetric direct aldol reactions in water.35 The catalyst was applicable for both cyclic and acyclic ketones. Recently, the group further extended the polystyrene-supported triazolyl proline nonmetal catalyst for the asymmetric crossand self-aldol reactions of aldehydes in water.36 The resin was obtained through a simple copolymerization strategy and possessed a completely regiodefined structure. In contrast, Meijer, Palmans and co-workers developed a folded but catalytically active polymer that behaved in a manner comparable to that of an enzyme.37 The newly developed copolymer consisted of L-proline as the catalytic unit, chiral N,N′,N″-trialkylbenzene-1,3,5-tricarboxamides (BTAs) as structuring elements, and oligo(ethylene glycol) (OEG) units to ensure water-compatibility (Scheme 4). The obtained copolymer was fully characterized, and its folding−unfolding behavior was studied. The catalytic activity of the copolymer was also evaluated in direct aldol reactions of p-nitrobenzaldehyde and cyclohexanone. Just 0.8 mol % catalyst loading was sufficient to afford the desired product in 88% yield with 91% de (antimajor) and 74% ee (anti). Interestingly, the copolymer’s catalytic activity could only be expressed in its folded

Scheme 2. Asymmetric Michael Addition of β,βDisubstituted Nitroalkenes with Malonate Derivatives

newly developed method enabled the scalable one-pot synthesis of chiral γ-aminobutyric acid (GABA) analogues. Water is considered to play a crucial role in activating the substrates. Thereby, the first example of the creation of all-carbon quaternary stereogenic centers at the β-position of γ-amino 681


Chemical Reviews

Review

to give the anti-selective product in excellent yield with good enantioselectivity. Interestingly, a much higher reaction rate was observed when these hollow-nanosphere catalysts were employed as compared to those based on mesoporous materials with bulk particle sizes. The authors mentioned that these properties may arise from the unique morphology of the hollow nanospheres, which gives reactants facile access to the active sites and yields an increased diffusion rate. Chitosan is another popular support that is used to construct heterogeneous nonmetal catalysts applicable in organic reactions in water. For example, in 2015, Cui and co-workers reported the synthesis of chitosan-supported succinic anhydride-cinchonine (CTS-SA-CN) (Scheme 6).45 The CTS-SA-

Scheme 4. Aldol Reaction Catalyzed by an L-ProlineContaining Polymer

Scheme 6. Direct Asymmetric Aldol Reaction Catalyzed by Chitosan-Supported Cinchonine in Water

conformation. Indeed, when organic solvents such as CHCl3 were employed, the aldol reaction did not proceed at all. Traditional supports, such as silica and magnetic Fe3O4, have also been identified as suitable supports for nonmetal catalysts in water. Ma, Wang and co-workers reported the preparation of a paramagnetic Fe3O4@SiO2 nanoparticle (NP)-supported Jørgensen−Hayashi catalyst and its application in the asymmetric Michael addition of aldehydes to nitroalkenes in water (Scheme 5).38 The catalyst could be used to afford the Scheme 5. Fe3O4@SiO2-Supported Jørgensen−Hayashi Catalyst for Michael Additions in Water

CN catalyst could be used to catalyze direct asymmetric aldol reactions in water in excellent yield with good enantioselectivity. Furthermore, the catalyst could be recycled up to five times through simple filtration after the reactions. Interestingly, the chitosan aerogel bead itself was identified as a heterogeneous nonmetal catalyst for asymmetric aldol reactions in water.46 Recently, ionic liquids have emerged as promising support materials for nonmetal catalysts in water. The presence of ionic liquid linkers in the supported catalysts was found to be important for achieving a smooth reaction in water. Ionic liquid moieties are thought to facilitate the access of hydrophobic reactants to active sites in water, and to stabilize the reaction intermediates in water. Indeed, Tan, Yin and co-workers demonstrated that ionic liquid-modified magnetic NP-supported L-proline could catalyze direct aldol reactions in water in good yield with high diastereo- and enantioselectivity (Scheme 7).47 Under identical reaction conditions, the ionic liquid moiety-free catalyst was far less reactive and delivered only 10% yield of the desired product. L-Proline alone as the catalyst did not afford any product in water.

desired products in moderate to good yields with good diastereo- and enantioselectivity. The superparamagnetic nature of the catalyst enabled very facile collection by an external magnet. The catalyst could be reused four times without significant loss of selectivity, although the yield decreased from 80% to 42% in the fourth cycle. Similarly, Nezhad, Panahi and co-workers reported that magnetic NPs could support an L-proline catalyst for bis(indol3-yl)methanes synthesis39 and an L-cysteine catalyst for 2amino-4H-chromene-3-carbonitriles synthesis in water.40 In both cases, the heterogeneous catalysts promoted the corresponding reaction in good yield and could be recovered and reused easily without any loss of catalytic activity. Several silica-supported nonmetal catalysts have also been presented. For example, Pleixats and co-workers reported the use of recyclable silica-supported proliamide nonmetal catalysts for direct asymmetric aldol reactions.41 In 2013, Nezhad, Panahi and co-workers also developed an L-proline-based silicasupported nonmetal catalyst.42 The utilization of silica and/or magnetic Fe3O4 can simplify the workup procedures, and their reusability holds great promise for green, sustainable chemistry. Pursuing another approach, Yang and co-workers developed chirally functionalized hollow nanospheres containing chiral amine43 or amide,44 which could catalyze direct aldol reactions

Scheme 7. Direct Asymmetric Aldol Reaction Catalyzed by Ionic Liquid-Modified Magnetic NP-Supported L-Proline

682


Chemical Reviews

Review

2.2. Nonmetal Acid Catalysts

Scheme 9. Synthesis of 2,3-Dihydroquinazolin-4(1H)-ones by p-Sulfonic Acid Calix[4]arene in Water

Nonmetal base catalysis is currently the dominant approach to nonmetal catalysis in water. However, nonmetal acid catalysis has also been a focus for a long time because of the excellent reactivity it can offer. Xu and co-workers developed SO3Hfunctionalized ionic liquids bearing two alkyl sulfonic acid groups in the imidazolium cations. The catalyst was successfully applied for one-pot Fischer indole synthesis in water with good yield.48 In 2010, Rueping and co-worker developed the first example of highly enantioselective Brønsted acid-catalyzed reactions in water, based on the principle of hydrophobic hydration (Scheme 8).49 Proton transfer from the catalyst to Scheme 8. Chiral Phosphoric Acid-Catalyzed Transfer Hydrogenation of Quinoline in Water

Very recently, Lu, Yi and co-workers showed that an aqueous H2SO4/phosphide system could be used for the in situ generation of arylsulfenyl radicals from their corresponding sodium aryl sulfinates, which could further react with alkynes, alkenes, and H-phosphine oxides to afford alkyl and alkenyl sulfide and phosphorothioate compounds.54 Mechanistic studies, such as radical-trapping experiments and EPR results, indicated radical processes for these reactions in water. Quantum calculations were also utilized to investigate the mechanism behind the generation of aryl sulfenyl radicals. Nowadays, several traditional reagents with simple structures have also been shown to possess catalytic activities for organic reactions in water. For example, Chaskar and co-workers found that iodoxy benzoic acid (IBX) could mediate the synthesis of 3,4-dihydropyrimidine-2(1H)-ones (DHPMs) from an aldehyde, urea/thiourea, and β-keto esters (Scheme 10).55 IBX was

the solvent was assumed to occur in water, resulting in nonspecific activation of the substrate and leading to greatly reduced enantioselectivity. However, the authors successfully achieved the transfer hydrogenation of quinoline by Hantzsch ester derivatives in the presence of catalytic chiral phosphoric acid in water. Ishihara and co-workers in 2012 demonstrated the use of N,N-diarylammonium pyrosulfates as nonsurfactant-type catalysts for dehydrative ester condensation in water.50 The preheat treatment of dibasic sulfuric acid with bulky N,N-diarylamines was found to be imperative for the generation of water-tolerant aggregated complexes of pyrosulfuric acid as active catalyst species. In water, these catalysts possessed a wide substrate scope, including unusual selective esterifications and dehydrative glycosylation. Zinck and co-workers demonstrated that (1R)-(−)-10camphorsulfonic (CSA) or p-toluenesulfonic (TSA) acids could be utilized for the polymerization of ε-caprolactone in water.51 Zhang, Gao and co-workers demonstrated that a watersoluble Brønsted acid, 5-sulfosalicylic acid, was an efficient catalyst for direct three-component Mannich reactions in water.52 This acid catalyst not only possessed wide substrate generality, but could also be recycled at least six times with yield of the Mannich product remaining over 90%. In 2015, Hashim, Hajra and co-workers found that p-sulfonic acid calix[4]arene could promote the direct cyclocondensation of anthranilamide with aldehydes to afford 2,3-dihydroquinazolin4(1H)-ones as the desired products in good yield in water (Scheme 9).53 Other Brønsted acids, such as TSA or dodecylbenzene sulfuric acid (DBSA), only afforded the products in moderate yield. Low yield was observed when phenol was employed as the catalyst. This protocol was also applicable to gram-scale synthesis.

Scheme 10. IBX-Catalyzed Synthesis of 3,4Dihydropyrimidine-2-(1H)-one

thought to activate the carbonyl group of aldehydes and ketones and to accelerate the formation of the iminium. Other base catalysts, such as 1,4-diazabicyclo[2,2,2]octane (DABCO), afforded inferior results. H2O was identified as the most effective solvent. Furthermore, approximately 60% of the IBX could be recovered and reused without loss of activity for the next few reaction cycles. 2.3. Other Nonmetal Catalysts

Macromolecular nonmetal catalysts are an emerging category that has attracted enormous attention recently. Macromolecular peptide-type catalysts have been revealed to possess unique catalytic activities and properties in water. Recently, a reusable homo-oligopeptide, poly-L-leucine, was identified as an efficient catalyst for asymmetric epoxidation reactions in water, affording the desired chiral epoxyketones in good conversions and with good enantioselectivity.56 On the basis of the consideration that cavitands are open-ended molecular hosts capable of binding guests with high selectivity and affinity, Rebek’s group has focused on introducing host−guest chemistry to organic reactions in water. One of their earliest studies was in 1999, when they investigated and reported kinetically stable caviplexes in water.57 The excellent stability of cavitands and their strong affinity toward small molecular substrates have further inspired the group to apply cavitands as reaction vessels 683


Chemical Reviews

Review

derivatives. UV irradiation was identified as increasing the ability of C60 to accept the electron in the bonding orbital of the azo dyes and thereby activate the NN bond of the azo compounds. Recently, N-doped graphenes were also revealed to possess catalytic activity for the reduction of nitroarenes to give amines by NaBH4 in water.65 The reaction intermediate was detected by gas chromatography−mass spectrometry (GC−MS) analysis, and the catalytic mechanism was explored through density functional theory (DFT) calculations. Very recently, Blackmond’s group demonstrated the viability of prebiotically important chiral aldopentose sugars as catalysts for the synthesis of enantioenriched amino acid precursors in water (Scheme 13).66 Several D-sugars, such as D-ribose, D-

and sensors for biologically relevant guests in water. In 2006, by using a H2O−CH2Cl2 cosolvent system, the application of water-soluble tetracarboxylate as a catalyst for addition reactions between maleimides and thiols was achieved.58 The structures and properties of water-soluble cavitands and capsules have been reviewed elsewhere,59 and their chemistry and catalytic activity in water have also been well summarized.60 Recently, Rebek and co-workers also applied cavitands to the formation of medium- to large-sized cyclic ureas from longchain diisocyanates (Scheme 11).61 Water (D2O) played a Scheme 11. Cavitand-Mediated Cyclization of Diisocyanates in Water

Scheme 13. Chiral Sugar-Mediated Enantioselective Synthesis of Amino Acid Precursors

lyxose, D-xylose, D-arabinose, and D-deoxyribose, exhibited moderate to high catalytic activity and enantioselectivity in the enantiorichment of amino acid precursors. It is remarkable that D-ribose and D-xylose could afford alanine, phenylalanine, and tryptophan precursors and deliver the stereochemistry inversely. Computational calculations were utilized to explain the observed opposite enantioselectivities. Important discoveries in nonmetal catalysis have been reported over the past 10 years. Most of the recent reports on asymmetric catalysis in water have still focused on the derivatives of amino acids and their further extensions. Many supported nonmetal catalysts have also been investigated, as heterogeneous catalysts can be recycled and reused, and thus are more environmentally friendly. On the other hand, several interesting reports on the simple application of small molecules, natural sugars, and peptides have also emerged. Even carbon materials have cut a conspicuous figure as catalysts for several reactions in water. The field of nonmetal catalysis in water is bound to continue to flourish in the future.

crucial role in achieving smooth reactions by (1) acting as a supramolecular solubilizing agent, and (2) providing strong hydrophobic interactions to drive the reactants into the cavitands in folded conformations. Specifically, the aminoisocyanates were folded into the holes of the cavitands, affording hook-like intermediates that were not readily observed in bulk solution, thereby leading to the formation of cyclic ureas. Interestingly, even carbon materials have been found to be suitable catalysts for some reactions. Carbon nitride was found to be a useful catalyst for the selective oxidation of aromatic alcohols in water under visible light irradiation.62 Luong and coworkers tested graphene, graphene oxide, sulfonated graphene, and sulfonated graphene oxide (SGO) for the dehydration of xylose to furfural in water.63 In particular, SGO was shown to be an efficient and water-tolerant solid acid catalyst even at very low catalyst loadings, down to 0.5 wt % versus xylose. In 2012, Khashab and co-workers reported the fullerene-catalyzed reduction of azo compounds by NaBH4 in water under ultraviolet (UV) irradiation (Scheme 12).64 NaBH4 alone could not mediate the reaction to afford the product efficiently. Mechanistic studies and M062X calculations indicated that C60 acts as an electron acceptor to catalyze the reduction of azo

3. METAL-BASED CATALYSTS 3.1. Metal Complexes

3.1.1. Rare-Earth-Metal Catalysts and First-Row Transition-Metal Catalysts. Under aqueous conditions, the Lewis acidity of metal chlorides, perchlorates, triflates, and other species is dependent on their hydrolysis constants (pKh) and water exchange rate constants (WERCs).67 Metal salts with small pKh values are easily hydrolyzed into their corresponding metal hydroxides, whereas water-stable metal salts with large pKh values exhibit lower levels of interaction with electrophilic organic molecules, and show less catalytic activity. The WERC is known to be an important factor when considering the catalytic activity of Lewis acids in aqueous environments. A larger WERC value suggests the more facile exchange of water molecules around both the Lewis acid and the nucleophilic reactants, and can indicate higher catalytic activity. Some rareearth metals and first-row transition-metal cations, such as nickel, iron, copper, and zinc, show such good catalytic

Scheme 12. Fullerene-Catalyzed Reduction of Azo Compounds under UV Irradiation

684


Chemical Reviews

Review

acceleration as well as enhanced enantioselectivity was observed by integration of the functional groups, with approximately 16 times higher activity than that of an independently functioning system. A chiral 2,2′-bipyridine scandium complex was found to show high efficiency in the enantioselective Michael addition of thiols to α,β-unsaturated ketones in water, even at 1 mol % catalyst loading.72 Although active both in water and in organic solvents, the chiral catalyst is much more selective in water. One successful application is enantioselective proton transfer in proton-rich environments. Proton transfer in water is the most fundamental phenomenon in redox reactions, and it plays an essential role in biological processes such as muscle contraction and the electron transport chain in the mitochondrial matrix. Tandem 1,4-addition/enantioselective protonation was achieved by a Sc(OTf)3-chiral 2,2′-bipyridine complex in water (Scheme 16).73 In contrast, the reaction in organic solvents showed a sharp decrease in both yields and enantioselectivities.

activities. Furthermore, some multidentate ligands that exhibit strong binding affinities, such as salen-type ligands, aza-crown type ligands, or porphyrin type ligands, have been shown to be effective for protecting metal centers from hydrolysis during reactions. Vanadium, manganese, and some iron complexes are known to be water-stable metal catalysts bearing such types of ligands. 3.1.1.1. Scandium. The scandium(III) cation is a watercompatible Lewis acid that has been utilized for various reactions in aqueous media, in micellar systems, and in pure water. Hara and co-workers reported mechanistic studies on the behavior of Lewis acids in water using 31P NMR spectroscopy.68,69 Extensive studies have been undertaken over many decades using Mukaiyama aldol reactions as examples. One recent example of a scandium-catalyzed Mukaiyama aldol reaction in water was the condensation of silylketene pyridylthioacetals and oxalylimines (Scheme 14).70 In nonScheme 14. Scandium(III)-Promoted Condensation of Silylketene Pyridylthioacetal and Imines

Scheme 16. Enantioselective Protonation in Water

aqueous media, the reaction yields β-lactam as a product through cyclization−elimination of the pyridylthio group. On the other hand, the substitution reaction of aniline liberated from an excess amount of oxalylimine is more facile in water, and the linear product is afforded instead. The compaction of the independent factors crucial for catalysis into one structure could be an attractive way to realize the simplest enzyme-like catalysis. A new scandium-based system was found to offer efficient catalysis in water for enantioselective direct-type aldol reactions using formaldehyde (Scheme 15).71 It should be noted that significant rate

Most peptides are easily soluble in water, and therefore peptide modification in water is a particularly desirable reaction. Kanai and co-workers showed that Sc(OTf)3 could be used as a catalyst to cleave the peptide bond on a serine or threonine Nterminus selectively. The hydroxyl group at a Ser/Thr residue undergoes N,O-acyl rearrangement in the presence of a Lewis acid catalyst, and subsequent hydrolysis of the formed ester results in bond cleavage (Scheme 17).74 Scheme 17. Sc(OTf)3-Promoted Serine/Threonine Selective Peptide Bond Cleavage

Scheme 15. Design of a Highly Integrated Catalytic System for Asymmetric Direct-Type Aldol Reactions

3.1.1.2. Lanthanides. Lanthanide cations (mostly M3+) exhibit strong and hard Lewis acidity, oxophilicity, and good stability in water. Some of them also have redox-active properties that promote single electron transfer in a catalytic manner. Given their large ionic radii and high coordination numbers, lanthanide cations can create highly functional catalytic centers with various types of ligands. Since the discovery of the catalytic activity of Yb(OTf)3 in aqueous media,75 a number of reactions have been reported that proceed with a catalytic amount of lanthanide in water. Among recent examples, Firouzabadi, Iranpoor, and coworkers reported oxidative iodination/bromination reactions 685


Chemical Reviews

Review

using CeCl3 as a catalyst with hydrogen peroxide as a terminal oxidant. Various aromatic compounds were halogenated, and alkenes with pendant carboxylic acid or alcohol underwent iodocyclization reactions. The reactions proceeded under mild conditions with high yield and selectivity (Scheme 18).76

Scheme 21. Amino Acid-Induced Rate Acceleration of Yb(OTf)3-Catalyzed Reactions in Water

Scheme 18. Cerium(III)-Catalyzed Oxidative Iodination of Arenes 3.1.1.3. Titanium. A covalently bridging dinuclear chiral salen titanium(IV) complex was synthesized with PEG-based dicationic ionic liquid (IL) linkers for the asymmetric sulfoxidation of methyl phenyl sulfide and its derivatives in water (Scheme 22).80 The amphiphilic bridging spacer could enforce the intramolecular cooperation favored in the catalysis.

Procopio and co-workers described the use of Er(OTf)3 for epoxide ring-opening reactions using amines in water. The reaction proceeded efficiently under mild conditions with good to high stereoselectivity. Primary and secondary amines and unsubstituted anilines with various substituents on aromatic rings were suitable for this system (Scheme 19).77

Scheme 22. Chiral Salen Titanium(IV) Complex in Water

Scheme 19. Er(OTf)3-Catalyzed Epoxide Ring-Opening Reactions

Zhong and co-workers focused on a 2,2′-bipyridine scaffold as a chiral ligand in Yb(OTf)3-catalyzed direct-type aldol reactions at 0 °C in water (Scheme 20).78 The complex worked

3.1.1.4. Vanadium. Vanadium is known to be an efficient catalyst for oxidation reactions in organic solvents. Given that reaction systems often employ molecular oxygen as a terminal oxidant, vanadium-based catalysts allow environmentally benign aerobic oxidation to be performed in water. Good examples include the vanadium(V)-catalyzed aerobic oxidation of benzylic alcohols81and dehydrogenative coupling reactions.82,83 Prabhu and co-workers employed vanadium(V) oxide to oxidize the α position of tetrahydroisoquinoline to promote a C−C coupling reaction with indole (section 3.3.1).82 Another example of a vanadium-catalyzed C−H oxidative coupling reaction is the asymmetric version developed by Takizawa, Sasai, and co-workers, in which the binaphthol and amino acidderived chiral dinuclear vanadium complex showed excellent catalytic activity for 2-naphthol enantioselective dimerization reactions (Scheme 23).83 Vanadium complexes are also known to be good catalysts for epoxidation reactions. The enantioselective epoxidation of allylic alcohol has been reported using vanadyl sulfate and chiral hydroxamic acid as a ligand. The reaction proceeded in water to

Scheme 20. 2,2′-Bipyridyl-Based Chiral Catalyst for Lewis Acid−Base Cooperative Catalysis in Direct Aldol Reactions

as a bifunctional catalyst to activate both aldehydes and ketones cooperatively. Control studies revealed the essential role of water for the reactivity and selectivity of the reactions. Lindström, Wennerberg, and co-workers reported a remarkable rate acceleration in Yb(OTf)3-catalyzed 1,4-addition reactions through the use of an amino acid ligand in water. The ytterbium−amino acid complex formed in situ enhanced the rate of addition reactions up to 138 times. The authors also conducted recovery and reuse tests of the aqueous-phase catalyst by simple extraction. After the removal of organic materials, the aqueous catalyst mixture was submitted to the next reaction, and the process was repeated at least five times, with the catalyst solution showing excellent reactivity (Scheme 21).79

Scheme 23. Enantioselective and Aerobic Oxidative Coupling of 2-Naphthol Derivatives by Using a Chiral Dinuclear Vanadium(V) Complex in Water

686


Chemical Reviews

Review

give the product in high yield with good selectivity, and the results were slightly improved by the addition of organic solvent to the system (Scheme 24).84

Scheme 27. Manganese-Catalyzed Cross-Coupling Reactions of Nitrogen Nucleophiles with Aryl Halides in Water

Scheme 24. Vanadium-Catalyzed Asymmetric Epoxidation of Allylic Alcohols in Water Scheme 28. Manganese(I)-Catalyzed Decarboxylative C−H/ C−O Activation in Water

Vanadium(III) species have been employed for the reductive homocoupling of aromatic aldehydes to yield vicinal diol derivatives in water using metallic aluminum as a coreductant. In contrast to the conventional examples in organic solvent, which require chlorosilane as an essential additive, the reaction proceeded very smoothly in water without any additives other than the catalyst and the reductant (Scheme 25).85

prepared indolyl manganese(I) complex proved to be competent in catalytic C−H/C−O functionalization. 3.1.1.6. Iron. Iron(II) or (III) compounds have been regarded as good Lewis acids in classical organic synthesis. Because of iron’s abundance and low toxicity, researchers are becoming more interested in the use of this metal species, especially focusing on its redox-active properties. Furthermore, iron species have relatively large pKh values, indicating the suitability of iron for catalysis in water.67 With respect to redox catalysis, the iron-catalyzed asymmetric oxidation of sulfides to give chiral sulfones was reported by Katsuki and Egami in 2007 (Scheme 29).89 The ONNO

Scheme 25. Vanadium-Catalyzed Pinacol Coupling Reaction in Water

3.1.1.5. Manganese. Manganese also shows excellent redox activity, based on its capacity to adopt various oxidation states. Salen-type ligands or porphyrins are often employed for conventional reactions in organic solvents or aqueous media. Gao and co-workers reported the direct oxidation of a CH2 group adjacent to a pyridine moiety by using Mn(II) as a catalyst in water. tert-Butyl hydroperoxide radicals were generated by a single-electron redox process with manganese to cleave the benzylic C−H bond. Cycloalkylpyridines were efficiently oxidized in water, whereas acyclic substrates were treated in tBuOH as a solvent (Scheme 26).86

Scheme 29. Fe(salan)-Catalyzed Asymmetric Oxidation of Sulfides with Hydrogen Peroxide in Water

atoms of salan were strongly bound to iron(III) species in a tetradentate manner to stabilize the catalyst in aqueous conditions. The reaction was conducted under mild conditions using hydrogen peroxide as an oxidant. Iron−porphyrin or −phthalocyanine type complexes are efficient catalysts for various types of oxidation reactions. In 2011, Rezaeifard and Jafarpour reported that iron(III)− tetraphenylporphyrin complex could be used to catalyze the epoxidation of olefins or benzylic oxidations using tetrabutylammonium peroxomonosulfate as an oxidant (Scheme 30).90 The oxidant was derived by simply mixing tetrabutylammo-

Scheme 26. Manganese-Catalyzed Oxidation of the CH2 Adjacent to a Pyridine Moiety in Water

Teo and co-workers demonstrated Buchwald−Hartwig-type C−N bond formation catalyzed by manganese(II) chloride. In the presence of trans-1,2-diaminocyclohexane as a ligand, the coupling reaction proceeded between diazole and aryl iodide in water. High catalytic turnover was observed only when water was used as the reaction medium. Several manganese(II) salts and MnO2 showed comparable catalytic activity in this reaction (Scheme 27).87 The first report on decarboxylative C−H/C−O functionalization in water emerged in 2017 (Scheme 28).88 Air- and water-tolerant manganese(I) catalyst allowed for effective C(sp2)−H functionalizations at the C2 position of 1pyrimidin-2-ylindole with dioxolanones with ample scope, including synthetically useful aryl imines. The independently

Scheme 30. Selective Oxygenation of Hydrocarbons with n Bu4NHSO5 in Water Catalyzed by Water-Insoluble Iron(III) Tetraphenylporphyrins (Fe(TPP)Cl)

687


Chemical Reviews

Review

nium hydrogen sulfate (TBAHSO4) and Oxone in an equimolar manner. In the reaction, the catalyst remained solid, so the authors succeeded in separating it by simple filtration; furthermore, the catalyst could be reused at least five times without loss of activity. Carreira and co-workers employed the same Fe(TPP)Cl complex for cyclopropanation reactions using glycine ethyl ester hydrochloride as a carbene precursor. The reaction proceeded with good trans selectivity (Scheme 31).91

Scheme 34. Iron-Catalyzed Conversion of Unactivated Aryl Halides into Phenols in Water

catalytic cycle is thought to take part in oxidative addition, transmetalation, and reductive elimination steps. Lewis acid catalysis involving iron is also summarized in this section. Liu and co-workers reported the iron-catalyzed substitution−cyclization of 2-halobenzoic acids and amidines under microwave irradiation for quinazolinone synthesis (Scheme 35).96 Even using less-reactive 2-chlorobenzoic acid, the reaction proceeded with moderate yield.

Scheme 31. Iron-Catalyzed Cyclopropanation with Glycine Ethyl Ester Hydrochloride in Water

Scheme 35. Microwave-Assisted Synthesis of Quinazolinone Derivatives by Iron-Catalyzed Cyclization in Water

Methane oxidation remains a critical challenge. Active sites of methane monooxigenase enzymes contain two iron centers; by mimicking this structure, Sorokin and co-workers developed a μ-nitrido bridged di-iron phthalocyanine complex (Scheme 32). In the presence of the complex and under pressurized conditions, methane gas was converted into formic acid and formaldehyde using H2O2 as an oxidant.92

Mohan and co-workers reported that aromatic acetals, both of aldehydes of and ketones, or α,β-unsaturated acetals were deprotected in the presence of a catalytic amount of iron(III) tosylate under mild conditions (Scheme 36).97 A wide variety

Scheme 32. N-Bridged Di-iron Phthalocyanine Complex for the Bio-inspired Catalytic Oxidation of Methane

Scheme 36. Iron(III) Tosylate-Catalyzed Deprotection of Aromatic Acetals in Water

With respect to the role of water molecules in the oxidation of methane C−H bonds catalyzed by iron−porphyrin complexes, computational studies were presented by Li and co-workers in 2008.93 The role of the water molecules surrounding the complexes was discussed in detail, and this revealed their importance in the proton transfer steps in the reaction. Single-electron redox catalysis by iron is applicable to the oxidation of aldehydes to thioesters. Iron(II) reductively generates a tert-butyl peroxy radical, and this radical species removes hydrogen from an aldehyde. The generated acyl radical reacts with iron(III) thiolate to yield thioester in high yield (Scheme 33).94 Wang and co-workers reported that a catalytic amount of iron(III) chloride promoted the conversion of aryl bromide or iodide into the corresponding phenols (Scheme 34).95 The authors suggested that the real active species may not be iron(III), but rather some lower-oxidation-state species. This

of acetal-protecting groups, including dimethyl or diethyl acetals and five-membered or six-membered cyclic acetals, were applicable. The authors noted the possibility that TSA might function as the true catalyst. In the presence of Lewis acidic species, aziridines can work as 1,3-dipoles for various reactions. In 2013, Punniyamurthy and co-workers reported that iron(III) nitrate worked as an efficient catalyst for the cycloaddition of aziridines with heterocumulenes, such as carbodiimide, isocyanate, isothiocyanate, or isoselenocyanate (Scheme 37).98 The authors proposed that Scheme 37. Efficient Iron-Catalyzed Cycloaddition of Aziridines with Heterocumulenes

Scheme 33. Iron-Catalyzed Synthesis of Thioesters from Thiols and Aldehydes in Water

the reaction proceeded in a sequential manner without forming a carbocation intermediate on the surface of water, because the optically active aziridine furnished the product with retention of chirality. Allylic substitution is an important method of functionalization for the construction of complex molecules. These reactions have been achieved by redox catalysis with transition metals via 688


Chemical Reviews

Review

π-allyl species, or by acid catalysis via carbocation intermediates. Iron(III) has also been reported to be an efficient catalyst for the latter type of reactions in organic solvents. On the basis of these studies, Baeza and Nájera investigated FeCl3 and found that it efficiently promoted allylic substitution reactions with nitrogen or carbon nucleophiles (Scheme 38).99 To investigate

Wu and co-workers described the cobalt-catalyzed crossdehydrogenative coupling (CDC) of indoles and tetrahydroisoquinolines in water under blue LED irradiation (Scheme 41).104 CoCl2 and dimethylglyoxime (dmgH) formed a Scheme 41. Cobalt-Catalyzed Cross-Dehydrogenative Coupling of Indoles and Tetrahydroisoquinolines

Scheme 38. Direct Nucleophilic Substitution of Free Allylic Alcohols in Water Catalyzed by FeCl3·6H2O

cobalt(III)−dmgH complex under air, which had an absorption band up to 450 nm and was suitable for activation under blue LED irradiation. 3.1.1.8. Nickel. Tang, Zhu, and co-workers reported the nickel-catalyzed reductive coupling of aryl halides with diphenylphosphine oxide in water (Scheme 42).105 In the

the real active species, the authors conducted the reaction using Fe(NO3)3, which easily forms iron(III) hexaaquo complex in water, to obtain almost the same results as those observed for the FeCl3-catalyzed reaction. The authors assumed that, under heating conditions, the iron(III) hexaaquo species ([Fe(H2O)6]3+) partially hydrolyzed to form iron hydroxide species ([Fe(H2O)6−n(OH)n]+3−n, n = 0−3) as the true active species. 3.1.1.7. Cobalt. Cobalt(II) species are water-tolerant metal species that can function as Lewis acid catalysts. Teo and coworkers reported the direct alkenylation of 2-methylquinolines with aldehydes (Scheme 39).100 Under heating conditions, Lewis acidic activation on quinolines facilitated C(sp3)−H bond activation and subsequent aldol-type condensation reactions.

Scheme 42. Nickel-Catalyzed Reductive Coupling of Aryl Halides and Diphenylphosphine Oxide

presence of 2,2′-bipyridyl as a ligand and zinc as a reductant, C−P coupling reactions were efficiently promoted for aryl iodides and bromides with moderate to high yield. Diastereoselective coupling reactions were also performed with optically pure (−)-mentoxy phenylphosphinate to afford the enantiopure P-chiral product. A Cp2Ni/Xantphos catalytic system was reported for azide− alkyne cycloadditions in water at room temperature.106 3.1.1.9. Copper. Recently, copper has become one of the most commonly used metal species for catalysis in aqueous media. Its characteristic features are its mild and soft Lewis acidity and the relatively narrow redox potentials of several of its oxidation states, which enables oxidative addition/reductive elimination reactions in the catalytic cycle. Water-stable copper(II) and some stabilized copper(I) species are often employed as Lewis acid catalysts under aqueous conditions. In general, copper(II) shows good Lewis acidity in coordination to heteroatoms such as oxygen or nitrogen, and it is often used as an activator for carbonyl or imine moieties in catalytic reactions. Liskamp and co-workers developed a triazacyclophane (TAC) scaffold with three histidine amino acid residues as a tridentate ligand for copper(II)-catalyzed Diels−Alder reactions (Scheme 43).107 The enantioselectivity was very sensitive to the structure of the macrocycles. Extensions at the N-termini of the histidine residues other than the acetyl group, or the insertion of amino acid residues between the histidine residues and the TAC scaffold, resulted in a significant drop in enantioselectivity. Asymmetric Henry reactions were achieved by using a copper(II) salt with a chiral tertiary amine−diol complex in the presence of a phase-transfer catalyst in water (Scheme 44).108 The enantioselectivity of the reactions was sensitive to the nature of the counteranion of the copper(II) species, and bromide showed the best selectivity. Notably, Ma and co-

Scheme 39. Cobalt-Catalyzed Direct Alkenylation of 2Methylquinolines

Teo and co-workers also reported C−N coupling reactions using CoCl2 with a diamine ligand.101 Aryl iodides were successfully coupled with N-heterocycles. Amides were not efficient coupling partners under the established conditions; later, the authors found that the use of cobalt(II) oxalate was critical to address this issue.102 The redox-active nature of cobalt species is also important for the development of reactions in water. Tsai and co-workers reported the cobalt(II)/cationic 2,2′-bipyridyl-catalyzed reductive C−S coupling of aryl halides and thiols in water (Scheme 40).103 In the presence of a base, the reactions were promoted by the cobalt complex with the assistance of a stoichiometric amount of zinc as a reductant under aerobic conditions. The scope of the reaction was relatively wide, including aryl iodides, bromides, and even chlorides. Aliphatic thiols were applicable, albeit giving low yield. Scheme 40. Co-Catalyzed Direct S-Arylation under Aerobic Conditions

689


Chemical Reviews

Review

Scheme 43. Triazacyclophane Scaffold with His Tag for Copper(II)-Catalyzed Asymmetric Diels−Alder Cycloaddition Reactions

Scheme 46. Ligands for Ullmann-Type Reactions in Water

Scheme 44. Copper-Catalyzed Enantioselective Henry Reactions in Water

bipyridyl as a catalyst in water in the presence of molecular iodine as an oxidant.130 Sonogashira coupling reactions using CuI as a catalyst in water without the use of palladium have been reported. In 2009, Liu and co-workers demonstrated that the CuI/PPh3 catalytic system was compatible with water (Scheme 47).131 Later, Fu, Hu, and co-workers investigated the copper(I)phenanthroline system and demonstrated the possibility of achieving palladium-free catalysis in water.132

workers achieved Henry reactions with neutral copper(II) arylhydrazone complexes in water without any base, albeit in an achiral manner.109 Liu, Feng, and co-workers reported asymmetric Kinugasa reactions in water by using copper(II) and diamine ligands (Scheme 45).110 In contrast to the poor selectivities in organic solvents, trans-β-lactams were obtained as the major products in water with high diastereo- and enantioselectivities.

Scheme 47. Palladium-Free Sonogashira Coupling Reactions

Scheme 45. Asymmetric Kinugasa Reactions in Water

1,3-Dipolar cycloaddition reactions of alkynes and azides, Huisgen-click reactions, have been one of the most important bond-forming methodologies in many fields of chemistry since the discovery of copper catalysis.133,134 One of the original examples was conducted in a water/tBuOH mixture using CuSO4 as a catalyst precursor. The actual catalytic species was copper(I) species; in contrast to copper(II), copper(I) exhibits milder Lewis acidity and has a π-philic nature, forming an acetylide complex with terminal alkynes. A number of contributions have helped to develop water-stable copper(I) species as more efficient catalysts. In recent days, CuBr−methyl phenyl sulfide,135,136 copper(II)−pyridinedicarboxyamide complex,137 CuI−(DHQD)2PHAL,138 copper(II)−pyrrolide imine Schiff base complex,139 and tris(triazoyl)methanol-copper(I)140 have been reported as efficient and selective catalysts in pure water (Scheme 48). The oxidation ability of copper(II) species has often been used in classical organic reactions. One of the best examples is the oxidation of aldehydes; the reaction is well-known as Fehling’s reaction. Li and co-workers found that the combination of copper(II) and carbine ligand enabled the regeneration of copper species by aerobic oxidation to achieve a catalytic process in water (Scheme 49).141

Over the course of this decade, a number of coupling reactions have been reported in water using copper as a catalyst. Ullmann-type condensations employing aryl halides with nitrogen,111−122 sulfur,123−126 selenium,127 and oxygen128,129 nucleophiles have been reported in water with copper(I) halide species and ligands such as bipyridine-derived ligands,115,125 aliphatic diamines,111,124,126,127 diimines,113,117 diketones,122 salen-type ligands,114,116 or other nitrogen-containing molecules.120,121 In most cases, the ligands were designed to be hydrophilic, to assist the solubility of the catalyst in water (Scheme 46). Chan−Lam−Evans-type reactions using Nnucleophiles with boronic acids112,119 or aryl iodonium salts118 have also been performed in pure water under oxidative conditions. Coupling reactions employing terminal alkynes have also been reported. For example, the oxidative homocoupling of terminal alkynes was promoted with CuSO4/cationic 2,2′690


Chemical Reviews

Review

Scheme 48. Copper-Catalyzed Huisgen Cycloaddition Reactions in Water

Scheme 50. Zinc−Proline-Catalyzed Direct Aldol Reactions

glycolaldehyde to achieve the formation of a mixture of sugars in water.158 Further studies on this catalytic system by Reymond and co-workers supported the dual role of the components to promote an enamine-type mechanism in proline with Lewis acid activation by zinc.159 Demir and Emrullahoglu reported the use of Zn(ClO4)2 as a Lewis acid in water for one-pot amination−annulation reactions.154 3.1.2. Precious-Metal Catalysts. Precious metals, including ruthenium, rhodium, palladium, silver, rhenium, osmium, iridium, platinum, and gold, have been employed as powerful catalysts for transformations of organic molecules in modern organic chemistry. Partially occupied d- or f-orbitals allow these elements to exhibit various oxidation states, which facilitates their unique catalytic activity. Large ionic radii and high coordination numbers allow a wide variety of ligand coordinations. Some precious metals are quite stable in water when at specific oxidation states, despite their high catalytic activity. In this section, well-defined precious-metal organometallic catalysts are summarized. 3.1.2.1. Ruthenium. Ruthenium complexes are used extensively in organic chemistry as catalysts. Asymmetric hydrogenation reactions or olefin metathesis reactions are well-known and widely used in the chemical industry nowadays. Ruthenium can exhibit multiple oxidation states ranging from −4 to +8, but most of the catalytic reactions in water have employed ruthenium(II) because of the high stability of this state in water. One exceptional study was conducted by Herrmann, Kühn, and co-workers using a ruthenium(IIII)− carbene complex (Scheme 51).160 The sulfonate-tethered

Scheme 49. Catalytic Fehling’s Reaction

Selective oxidations of alcohols to aldehydes have also been reported in water, achieved by employing water-soluble ligands connected to calixarenes or cyclodextrins (CDs).142,143 A calculation study suggested that a pentacoordinated copper intermediate was responsible for the activation of alcohols as copper alkoxides.144 The combination of copper(II) perchlorate with 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO) enabled the specific oxidation of 5-hydroxymethylcytosine in genomic deoxyribonucleic acid (DNA) to 5-formylcytosine because of its allyl alcohol specificity.145 During the naturally occurring demethylation process of 5-methylcytosine, 5hydroxymethylcytosine is the most informative nucleoside as an index of demethylation because it is found in a much higher level than other nucleosides. Since the discovery of copper(I)-catalyzed conjugate borylation reactions by Hosomi and co-workers146 and by Miyaura and co-workers,147,148 copper has been regarded as an efficient catalyst for borylation and silylation reactions. Kobayashi and co-workers reported catalytic enantioselective borylation reactions on α,β-unsaturated enones by using a water-insoluble copper(II) complex and diboron reagent.149 The catalytic systems employing the same chiral 2,2′-bipyridine ligand showed different reactivities and selectivities between soluble and insoluble copper salts.150,151 Catalytic silylation reactions have also been reported by Santos and co-workers152 and by Kobayashi and co-workers153 by using copper catalysts and silylboron reagents. 3.1.1.10. Zinc. Zinc(II) also has a relatively large hydrolysis constant and exhibits good stability in water. In recent years, the catalytic use of zinc(II) as a Lewis acid has been demonstrated in the amination−cyclization of α-cyanomethylβ-ketoesters154 and carbohydrate conversions into 5-hydroxymethylfurfural.155 An important example was described by Darbre and co-workers, who established that the combination of zinc(II) and proline is an efficient catalyst for direct aldol reactions in aqueous media or in water (Scheme 50).156,157 Only the combination of zinc and proline efficiently promoted the reactions of simple aliphatic ketones with aldehydes, whereas zinc or proline alone resulted in poor yield and selectivity. The authors also described the reactions of

Scheme 51. Ruthenium-Catalyzed Hydrogenation of Oxygen-Functionalized Aromatic Compounds

water-soluble carbene ligand enabled the hydrogenation of arenes with oxygen functionalities, such as phenols or acetophenones. The authors confirmed ruthenium(0) as the active species by conducting a mercury drop test. Cadierno, Francos, and Gimeno reported the use of ruthenium(IV) species for the alkylation of indoles with terminal alkynes in water.161 The authors proposed a mechanism involving (1) hydration of alkynes to ketones, (2) Friedel−Crafts-type addition of indoles to ketones, (3) dehydration of alcohols to form olefins, and (4) reduction of olefins. The authors assumed that the excess alkyne functioned as a hydride source in the final step. Ruthenium catalysis has been extensively investigated in asymmetric-transfer hydrogenation reactions. Since Noyori’s discovery, various types of ligands have been developed to 691


Chemical Reviews

Review

aldehydes were generated as intermediates, which underwent enolization to produce deuterium on the β-position. The hydration of nitriles has also been reported using ruthenium(II) catalysts in water. Cadierno and co-workers investigated the rearrangement of aldoximes, and established a catalytic dehydration reaction that could be used to form nitriles, followed by hydrolysis to yield the desired amides.176 On the basis of this finding, they developed a method for the one-pot conversion of aldehydes into primary amides177 and the efficient hydrolysis of nitriles.178 3.1.2.2. Rhodium. C−H activation reactions catalyzed by rhodium(I) species have been another interesting area of research this decade. Li and co-workers reported the CDC of carboxylic acids in water with a stoichiometric amount of MnO2 as an oxidant. The ortho-position relative to the carboxylic acids was activated by the [Rh(nbd)Cl]2 complex to afford biaryls in both a symmetric (Scheme 55)179 and an asymmetric manner.180

improve these catalysts’ activity and durability in water (see the review).162 In recent years, further extensive computational studies have been performed, for example, by Lledós, Joó, and co-workers163 and by Meijer and co-workers,164 on the estimation of bulk water around the catalyst. Another important ruthenium-catalyzed reaction is olefin metathesis. The recent development of ruthenium complexes with an N-heterocyclic carbene (NHC) ligand significantly improved their stability in air and moisture. Thanks to this stability, chemists have developed a number of water-soluble ruthenium complexes with a PEG tether165,166 or a tertiary ammonium pendant167−169 to conduct metathesis reactions in water. This field of chemistry has become well established and has been summarized thoroughly up to 2013 elsewhere.170 Recently, C−H activation reactions have become a rapidly expanding area of research. In 2010, Dixneuf and co-workers reported the use of a [RuCl2(p-cymene)]2 complex to achieve the pyridine-directed C−H functionalization of arenes in pure water as the first example of ruthenium-catalyzed C−H activation (Scheme 52).171 Examples up to 2013 have been summarized in a book chapter.172

Scheme 55. Dehydrogenative Coupling of Arylcarboxylic Acids

Scheme 52. Ruthenium-Catalyzed C(sp2)−H Bond Activation Reactions

The activation of alkynes has also been reported in water. Shinokubo and co-workers reported a carbometalation−Hecktype domino process in water.181 Transmetalated phenylrhodium species were carbometalated to internal alkynes, and a Heck-type process subsequently occurred to yield an α,β,γ,δunsaturated dienoate structure. Tsai and co-workers reported the polymerization of phenylacetylenes in water by employing a water-soluble cationic bipyridine ligand.182 The solubility of the complex was crucial for the improvement of the degree of polymerization up to Mw = 250 000. The same catalyst system was also applicable for the [2+2+2] cyclization of alkynes to afford aromatic rings in water (Scheme 56).183

Beller and co-workers reported carbonylative coupling reactions via C(sp2)−H oxidation with [RuCl2(cod)]2 as a catalyst (Scheme 53).173 The reaction was highly selective for Scheme 53. Ruthenium-Catalyzed Carbonylative C−C Coupling Reactions through the C(sp2)−H Bond Activation of 2-Phenylpyridine

Scheme 56. Water-Soluble Rhodium-Cationic 2,2′-Bipyridyl Complexes for the Cyclotrimerization of Alkynes

monoarylation, although a second C−H activation could proceed. The catalytic system was also applicable to carbonylative coupling reactions with styrenes.174 Dumeignil, Gauvin, and co-workers reported the C(sp3)−H bond activation of alcohols to achieve deuterium labeling in D2O (Scheme 54).175 A ruthenium(II)−PNP pincer complex activated alcohols to promote reversible oxidation/reduction reactions under a hydrogen-borrowing mechanism to introduce deuterium on the α-position. During the reaction, ketones or

The redox isomerization of allylic alcohols has also been reported using rhodium(I) species in water. Martin-Matute and co-workers reported the redox isomerization of codeine and morphine to hydrocodone and hydromorphone, respectively, in water with very high yield and selectivity (Scheme 57).184 The combination of [Rh(cod)(MeCN)2]BF4 and 1,3,5-triaza-7phosphaadamantane produced a very efficient catalyst, and the catalyst loading could be reduced to 0.05 mol %. Afonso and co-workers reported the use of rhodium(II) dimer species for carbene chemistry using α-diazocarbonyl compounds in water. Dirhodium carbenoid species were easily

Scheme 54. Deuterium Labeling of Alcohols in D2O

692


Chemical Reviews

Review

transmetalation of boronic acid reacted with aldehydes to yield diaryl carbinol, and subsequent dehydrogenation proceeded to yield diaryl ketones. The method is very efficient for the synthesis of various asymmetric diaryl ketones. Hydroformylation reactions are one of the most important and successful examples of rhodium(III) catalysis. These reactions can be conducted under neat conditions, and the use of aqueous-phase and water-soluble catalysts enables the easy separation of products and catalysts.192 For example, the Ruhrchemie/Rhôneô−Poulenc process employs a rhodium catalyst with a water-soluble tetraphenylporphine tetrasulfonic acid (TPPTS) ligand to achieve the reaction under water−gas biphasic conditions.193 Recently, researchers have been focusing on the development of more efficient catalysts194 and on mechanistic investigations of “on water” effects.195 Jones and co-workers found that the cationic rhodium− bipyridine complex underwent C−H activation at the bipyridine C3 position to afford the “rollover” cyclometalated bipyridine complex (Scheme 60).196

Scheme 57. Rhodium-Catalyzed Redox Isomerization of Allylic Alcohols to Ketones

formed, and intramolecular C−H insertion occurred subsequently. A detailed investigation showed that the reactivity of the C−H bond insertion step was dependent on the catalyst structure and the hydrophobic nature of the amide substituents. Competitive hydrolysis was suppressed by controlling the hydrophobic nature of the carbenoid center (Scheme 58).185 Scheme 58. Suppression of Carbene Hydrolysis by Increasing the Hydrophobicity of the Catalyst Center

Scheme 60. C−H Activation of Bipyridyl Ligand on the Rhodium Methyl Aquo Complex

Carbene insertion reactions catalyzed by a dirhodium catalyst have also been reported, with the aromatic C−H bond of anilines forming indole derivatives,186 aldehydes forming epoxides or dioxolanes,187 and olefins forming cyclopropanes.188 Doyle and co-workers reported that a dirhodium caprolactamate complex could catalyze the oxidation of the propargylic position in water (Scheme 59).189 Both terminal and internal

Inspired by this work, Lu and co-workers discovered that the [RhCp*Cl2]2 species could activate the C(sp2)−H bond of 2phenylpyridine (ppy) in water (Scheme 61).197,198 Control Scheme 61. Water-Specific Rhodium-Catalyzed Direct C(sp2)−H Activation Reactions

Scheme 59. Dirhodium Caprolactamate-Catalyzed Propargylic Oxidation Reactions

alkynes were tolerant of the conditions, and the reaction gave ynones in moderate to high yield. The rapid oxidation of 4octyne in water (89% conversion within 1 h) clearly indicated the advantage of using water over organic solvents (for example, DCE delivered 86% conversion after 10 h). The dehydrogenative oxidation of alcohols with dirhodium catalysts has also been reported, by Wang and co-workers.190 Benzylic and allylic alcohols were efficiently oxidized under inert conditions to form hydrogen gas, or under aerobic conditions to form a water molecule. The same mechanism appeared to operate in the dirhodium-catalyzed cross-coupling of aldehydes and arylboronic acids in water reported by Wang and coworkers.191 The aryl dirhodium complex formed through the

studies of rhodacycle formation (99% in water vs 0% in DCE) suggested the vital role of water in the C−H activation step. The authors assumed that rhodium hydroxide formed in situ was the key to activating the C(sp2)−H bond via a sixmembered cyclic transition state. Wang and co-workers also employed [RhCp*Cl2]2 as a catalyst for C−H activation reactions at the C2 position of indole/pyrrole.199 Pyridine-directed C−H activation occurred to form a rhodacycle intermediate on the C2 position, and the intermediate reacted with isooxazole, followed by N−O 693


Chemical Reviews

Review

cleavage on an isooxazole ring and Friedel−Crafts-type annulation on the C3 position. Large-scale synthesis was shown to proceed up to gram scale in water. Kim and coworkers found that sp3 C−H activation reactions were also available at the 8-methyl position on quinoline in water with [RhCp*Cl2]2 as a catalyst (Scheme 62).200 Rhodacycle intermediates reacted with allylic alcohols under oxidative conditions to afford γ-quinoline-substituted carbonyl compounds.

Scheme 64. Photocatalytic Cleavage of an Unactivated Si−C Bond in Water with the TSPP−Rh(III) Complex

irradiation by visible light, and the catalytic cycle was accomplished in acidic water. 3.1.2.3. Palladium. Palladium is one of the most important and frequently used transition metals for catalysis in the history of synthetic organic chemistry. Palladium enables simple and practical catalytic systems to be used to construct new carbon− carbon and carbon−heteroatom bonds for the synthesis of complex organic molecules. Given the remarkable stability of organopalladium species in water, a wide variety of reactions have been demonstrated under aqueous conditions or in water. Palladium-catalyzed coupling reactions, such as Suzuki− Miyaura, Stille, Hiyama, Heck, Buchwald−Hartwig, and Sonogashira reactions, are efficient methods for the formation of new C−C bonds to construct complex molecules. Examples of coupling reactions in water up to 2015 are well summarized in previous review papers.207−211 The main focus of research on the development of palladium-catalyzed coupling reactions has been the structure of the ligands. Most of the ligands developed can be roughly classified into P-donor, N-donor, and carbenetype ligands. As pointed out by Chattarjee and Ward,207 P-donor ligands are less commonly used than the other types because of the instability of the phosphine−palladium complex in aqueous media. Most previous efforts focused on solubilizing the complex by attaching ionic or nonionic hydrophilic pendant groups on the ligand (Scheme 65). The water-soluble

Scheme 62. C(sp3)−H Activation of 8-Methylquinolines

Wayland and co-workers investigated the properties and catalytic activity of the water-soluble rhodium(III)−tetra(psulfonato phenyl) porphyrin complex (TSPP−Rh(III)) (Scheme 63).201−203 In aqueous environments, the rhodium Scheme 63. Formal Catalytic Oxidations of Olefins by an Anionic Rhodium−Porphyrin Complex

Scheme 65. Water-Soluble P-Donor Ligands for Coupling Reactions

bisaquo complex forms mono- and bishydroxo complexes under equilibrium, and this Rh−OH bond on the apical position reacts with terminal olefins to afford the βhydroxyalkyl rhodium complex.203,204 The “formal” catalytic process was achieved by aerobic oxidation of the TSPP−Rh(I) complex after separation from the product. The ketone products reacted with the TSPP−Rh(III) complex to inhibit the catalytic oxidation of olefins. On the other hand, the catalytic oxidation of alcohols was efficiently promoted by the TSPP−Rh(III) complex.205 The rhodium hydroxo complex exchanged with alcohols to generate rhodium alkoxides and, following β-hydride elimination from alkoxides, furnished the desired ketones as products. The scope of the reactions includes aliphatic, allylic, and benzylic alcohols. Later, Fu and co-workers followed up on Wayland’s work to achieve the catalytic activation of Si−C(sp3) bonds in water under visible light irradiation (Scheme 64).206 The TSPP− Rh(III) complex could activate the C−Si bond of water-soluble trimethylsilyl alkylsulfonate to form a Rh−CH3 complex. This complex underwent photolysis to generate methane under

Pd(TPPMS)3 complex was first isolated by Casalnuovo and co-worker in 1990. The sulfonated phosphine ligand or various arylphosphine ligands with anionic pendant groups have been utilized for Suzuki−Miyaura212,213 and Heck213 reactions. Phosphine ligands with a cationic pendant group have also been reported. Shaughnessy and Calabrese applied tBu-Amphos for Suzuki−Miyaura coupling reactions in pure water.214 The use of sugars as neutral and hydrophilic pendants on phosphine ligands was demonstrated by Miyaura and co-workers (GLCAphos).215 Wolf and co-workers found that the palladium−phosphonous acid complex could promote the reaction of arylsiloxanes with sodium hydroxide as an inexpensive and less toxic Lewis base to replace the fluoride anion (Scheme 66).228 Similar strategies were followed for the development of Ndonor or carbene-type ligands. Various N-donor ligands have been reported, including pyridines, imines, imidates, pyrimi694


Chemical Reviews

Review

been attached to develop water-soluble palladium−NHC complexes, such as polyether, sulfonate, and carboxylic acid (Scheme 69).223−225

Scheme 66. Hiyama Coupling Reactions Catalyzed by the Palladium−Phosphonous Acid Complex (POPd)

Scheme 69. Water-Soluble NHC Ligands for Suzuki− Miyaura Coupling Reactions

dines, amines, palladacycles, amides, and others (Scheme 67).216−222 Scheme 67. Water-Soluble N-Donor Ligands for Coupling Reactions

The use of S-donor ligands in water has been explored less extensively than that of ligands with P- or N-donors or carbenes. Lang and co-workers synthesized ammonium-tagged sulfides as a water-soluble ligand for Suzuki−Miyaura coupling reactions with Pd(OAc)2 (Scheme 70).226 The catalyst was applicable for aryl iodides and bromides and promoted the reaction with moderate to high yield. Scheme 70. Water-Soluble S-Donor Ligand for Suzuki− Miyaura Coupling Reactions

Further examples of the fluoride-free Hiyama coupling process were demonstrated by using arylsiloxanes with a crown ether-tagged phosphine−palladium catalyst229 and by using vinylsiloxanes with a palladacycle catalyst (Scheme 68).230 Later, Jesús and co-workers published a detailed Scheme 68. Vinylation Reaction Using Vinylsiloxanes in Water

Kaboudin and co-workers directly employed β-cyclodextrin as a ligand for palladium(II) species.227 The palladium inclusion complex with β-cyclodextrin was successfully synthesized by treating palladium acetate under basic conditions. Low catalyst loading was achieved, down to ppm level, without significant loss of activity. A mercury poisoning test suggested that palladium(0) was not formed during the reactions. Given that the palladium(II)−cyclodextrin complexes are soluble in water, the catalyst was easily separated from the reaction products by simple extraction. Catalyst recycling experiments established the robustness of the system for at least four cycles. Palladium-catalyzed C−H activation involving reactions in water has been less well explored, because the conventional examples in organic solvents are sensitive to moisture. One of the earliest examples of palladium catalysis in water was the C(sp2)−H bond activation of thiazoles, described by Greaney and co-workers.233 Relatively active aromatic compounds, such as oxazoles,234,235 indazoles,236 indoles,237−239 benzofurans,240 pyrroles,241 pyrimidines,242 and polyfluoroarenes,243 have been

mechanistic study of the vinylation reactions and revealed that the actual reaction pathway in water is a Heck-type mechanism followed by desilylation, whereas a Hiyama-type pathway is preferred in tetrahydrofuran (THF).231,232 The most frequently used carbene ligand structure in palladium chemistry is the imidazole core, which consists of two nitrogen atoms on an unsaturated five-membered ring. It is synthetically very easy to modify the functional group on the nitrogen tether part. Various hydrophilic functional groups have 695


Chemical Reviews

Review

reported to undergo coupling reactions through C(sp2)−H bond cleavage; a brief summary of earlier examples is given in a review article.244 More recently, Zhang and co-workers reported allylic C−H amination reactions (Scheme 71).245 They initially conducted

co-workers showed the transfer hydrogenative dehalogenation of aryl halides using tetramethyldisiloxane (TMDS) as a hydride source.255 They found that while some transition metals, such as palladium, iridium, rhodium, ruthenium, and platinum, could generate hydrogen from TMDS, only palladium could transfer the hydrogen to the other substrate in water. Zeng and co-workers reported that transfer hydrogenation reactions from formic acid were also promoted by molecular palladium(II)−Xantphos catalyst in pure water.256 The reduction of various olefins was performed with high yields and excellent selectivities. Prabhu reported that the combination of diboron reagent and palladium catalyst reduced a water molecule to achieve transfer hydrogenation reactions.257 3.1.2.4. Silver. Kobayashi and co-workers reported the 1,4addition of β-ketoesters to nitroalkenes in water catalyzed by silver(I) triflate and triphenylphosphine complex (Scheme 73).258 The reactions were efficiently promoted only in water;

Scheme 71. Allylic C−H Amination of Allylbenzene Derivatives with N-Tosylcarbamates in Water

the reaction with N-fluorodibenzenesulfonimide (NFSI) in organic solvents. They assumed that palladium hydroxide species played a key role in the C−H activation step, which was generated by hydrolysis of the palladium complex after oxidative insertion into the N−F bond of NFSI. On the basis of this consideration, they conducted the reaction in pure water with Selectfluor as an electrophilic F+ reagent to achieve allylic C−H amination reactions in water with moderate to high yield. Hikawa, Yokoyama, and co-workers employed TPPMS as a water-soluble ligand for benzylic C−H amidation reactions in water to construct the quinazolinone core structure (Scheme 72).246 In their earlier study on the formation of η3-

Scheme 73. Silver-Catalyzed 1,4-Addition Reactions

the use of other organic solvents such as THF or dichloromethane (DCM) resulted in poor yield. The finding that no reaction occurred under neat conditions indicates the importance of water for the catalytic system. Li and co-workers found that the activation of molecular hydrogen by silver could be applied to the reduction of organic molecules in water (Scheme 74).259 Cationic silver(I)

Scheme 72. Benzylic C−H Activation of Benzylamines in Water

Scheme 74. Cationic Silver(I) Salt as a Catalyst for the Hydrogenation of Aldehydes and Olefins

benzylpalladium species from benzylic alcohols and πallylpalladium from allylic alcohols in water,247−249 they observed C(sp3)−H activation on the benzylamine intermediate.247 On the basis of these works, they extended the concept of the activation of benzylic and allylic alcohols to reactions with indoles250 and benzylamines.251 Palladium-catalyzed oxidation or reduction reactions, such as Wacker oxidation, are industrially important processes. In the early report, Sheldon and cowokers focused on the oxidation of alcohols in pure water by employing a water-soluble palladium(II) bathophenanthroline complex.252 Following this pioneering work, several oxidation reactions have been reported. Hou and co-workers reported a PEG-tethered bipyridyl palladium complex for the selective aerobic oxidation of styrenes in water.253 Unlike the previous examples in aqueous conditions, in this case the PEG-tethered catalyst cleaved the carbon− carbon double bond to afford aldehydes as products. Buffin and co-workers reported the use of biquinoline dicarboxylate as a water-soluble ligand of palladium catalyst in the aerobic oxidation of benzylic alcohols.254 Molecular palladium catalysts for hydrogenation in water have been less extensively explored, because palladium easily forms palladium(0) species under reductive conditions to form palladium black, which is still active toward hydrogenation reactions. One interesting example reported by Lipshutz and

hexafluorophosphate worked as an efficient catalyst for molecular hydrogen activation under high pressure, and it was discovered that XPhos was a suitable ligand for the efficient hydrogenation of aldehydes and olefins. Aromatic, heteroaromatic, and aliphatic aldehydes were reduced in high yield, and electron-deficient olefins were also reduced in moderate yield. The authors proposed that hydrogen underwent heterolysis to form silver hydride, which worked as a reducing reagent for the carbonyl moiety. Yang, Wang, and co-workers demonstrated the silvercatalyzed double decarboxylative coupling of α-keto acid with cinnamic acids to form chalcone in water using persulfate as an oxidant (Scheme 75).260 The authors assumed the following reaction mechanism. Silver(I) was initially oxidized to silver(II) by persulfate, and silver(II) reacted with keto acid to form an acyl radical. The latter was attacked by the olefinic moiety of cinnamic acid, and the subsequent CO2 release yielded the desired product. Such a radical mechanism is preferred in water because of the inertness of water toward radical species. 696


Chemical Reviews

Review

Scheme 75. Double Decarboxylative Cross-Coupling Reactions

Scheme 78. Iridium-Catalyzed Asymmetric Hydrogenation of Ketones

3.1.2.5. Iridium. Among the various oxidation states of iridium species, iridium(I) and iridium(III) have been extensively used in organic synthesis. Vaska’s complex or Crabtree catalyst are well-known iridium(I) complexes for catalytic organic reactions. Vaska’s complex can be applied for reactions in water, whereas the Crabtree catalyst is highly sensitive to protic conditions. Joó, Darensbourg, and coworkers employed the water-soluble phosphine ligand TPPMS for Vaska’s complex to achieve the catalytic hydrogenation or isomerization of olefins.261 Similar strategies were applied to the iridium−NHC complex, using water-soluble neutral phosphine PTA (1,3,5-triaza-7-phosphaadamantane) to achieve hydrogenation reactions in pure water under mild conditions (Scheme 76).262

to the dehydrogenation of alcohols to form aldehydes under aqueous conditions.268 Iridium hydride species reacted with protons under acidic conditions to generate molecular hydrogen. This hydride species also reacted with nicotinamide adenine dinucleotide (NAD+) in a certain pH range. The catalytic system could be regarded as a functional mimic of alcohol dehydrogenase (Scheme 79). Scheme 79. 1,4-Selective Hydrogenation of NAD+ by a Soluble Iridium Complex as a Functional Mimic of Alcohol Dehydrogenase

Scheme 76. Iridium−Carbene Complex with PTA as a Water-Soluble Ligand

Sivasankar and co-workers employed noncationic [Ir(cod)Cl]2 to achieve the carbene insertion of less-reactive acceptor/ acceptor precursors into N−H bonds in water (Scheme 77).263 Scheme 77. Iridium-Catalyzed Carbene Insertion into N−H Bonds

Yamaguchi and co-workers conducted dehydrogenation reactions using diols to form lactones with a Cp*Ir catalyst bearing 6,6′-dihydroxy-2,2′-bipyridyl as a ligand (Scheme 80).269 The catalyst dehydrogenated one of the hydroxide Scheme 80. Dehydrogenative Lactonization of Diols

The authors screened a range of catalysts and found that the iridium complex delivered the best results, although copper and rhodium also showed some reactivity (these are known as good catalysts for carbene reactions in organic solvents). Iridium(III) has been used more frequently than iridium(I) under aqueous conditions. One important use is in transfer hydrogenation reactions with formate as a hydride donor. Xiao and co-workers discovered that chiral iridium and rhodium species with a tosyl diphenylethylenediamine (Ts-DPEN) ligand efficiently catalyzed the asymmetric hydrogenation of ketones (Scheme 78).264 Further water-soluble ligands for iridium(III)-catalyzed hydrogenation have been designed by Zhou and co-workers with an ammonium tag,265 Ni and co-workers with an imidazolium tag,266 and Friedrich and co-workers with a halfsandwich structure.267 Dehydrogenation of alcohols has also been reported using iridium(III) catalysts. Fukuzumi and co-workers prepared a water-soluble Cp*Ir complex with a carboxylate group to apply

groups to generate aldehydes, which underwent cyclization to yield hemiacetal intermediates. Further oxidation furnished esters as the final product in good to excellent yield. The reaction proceeded in an intramolecular manner selectively even under condensed conditions in water. Dehydrogenation of alcohols yields the corresponding aldehydes, which show good reactivity toward various carbon or nitrogen nucleophiles to form C−C or C−N double bonds. Under transfer-hydrogenation conditions, H2 molecules taken from alcohol can reduce these newly formed double bonds to achieve the formal nucleophilic substitution of alcohols. This type of reaction was reported by Yamaguchi and co-workers 697


Chemical Reviews

Review

with primary amines,270 and by Li and co-workers with sulfonamides271 or o-aminobenzylalcohols to form quinolones (Scheme 81).272

Scheme 83. Gold-Catalyzed Tandem Cycloisomerization/ Functionalization via α-Oxocarbenes in Water

Scheme 81. Functionalization of Benzylic Alcohols under Transfer Hydrogenation Conditions with N- or CNucleophiles catalytic cycloisomerization of alkynyl amides in water (Scheme 84).276 Scheme 84. Gold(I)-Catalyzed Cycloisomerization of Alkynyl Amides in Water

In contrast to the gold(I) species, gold(III) shows stronger Lewis acidity and is often used for the activation of alcohols. Hikawa, Azumaya, and co-workers employed the water-soluble phosphine ligand TPPMS with a gold(III) salt to achieve catalytic Friedel−Crafts-type alkylation reactions with benzyl alcohols (Scheme 85).277 The reaction only proceeded in water

3.1.2.6. Gold. Gold(I) salts have unique properties, such as soft, carbophilic Lewis acidity, which can be used to activate C−C multiple bonds toward nucleophilic attack. Krause and co-workers reported the synthesis of a water-soluble gold(I)− carbene complex as a catalyst for the transformation of allenols into dihydrofurans (Scheme 82).273 The ammonium-tagged

Scheme 85. Gold(III)/TPPMS-Catalyzed Benzylation of Indoles in Water

Scheme 82. Ammonium-Salt-Tagged IMesAuCl Complexes for Cycloisomerization Reactions in Water

or ethanol and some organic solvents, such as dichloromethane, 1,4-dioxane, and toluene; no reaction was observed in biphasic systems such as toluene/water or 1,4-dioxane/water. The authors later reported that aromatic thiols with carboxylate tether were also applicable as nucleophiles for the gold-catalyzed substitution of benzylic alcohols (Scheme 86).278 The reaction was promoted without a ligand through the formation of a gold thiolate intermediate. 3.1.3. Other Metals. 3.1.3.1. Zirconium. Khalili and coworkers described the [3+2] cycloaddition of aryl cyanamides

carbene complex was readily soluble in water, and the catalyst solution could be reused after simple extraction of the desired products. The addition of lithium chloride enhanced the stability of the gold complex, allowing the catalyst to be reused for more than five cycles. α-Oxo metal carbene species are reactive and versatile intermediates for organic synthesis. They have classically been generated from the decomposition of diazo compounds under transition-metal-catalyzed conditions in organic solvents. Ye and co-workers found that alkynes could form α-oxo gold(I) carbene complexes with 2-bromopyridine N-oxide and showed that the formed carbene species could react with indole C−H bonds.274 This process avoids the use of hazardous, poorly accessible, and potentially explosive diazo compounds as precursors. Importantly, water was revealed to suppress the overoxidation of gold carbene species. A more integrated system for this gold carbene catalysis and the gold-catalyzed cyclization of alkynylaniline to indoles was also achieved in water (Scheme 83).275 Iminophosphorane-phosphine gold(I) complexes proved to be highly efficient and recyclable (up to four times) in the

Scheme 86. Gold(III)-Catalyzed S-Benzylation Reactions Using Benzylic Alcohols

698


Chemical Reviews

Review

authors noted this “cesium effect” with respect to the remarkable reactivity of CsOH. 3.1.3.4.2. Aluminum. Although aluminum(III) is known to be an easily hydrolyzed metal species because of its strong Lewis acidity, some reports have indicated its catalytic activity in acid-catalyzed conversions of carbohydrates under aqueous conditions.297−301 Zhu, Hu, and co-workers investigated in detail the mechanism of the reactions, and identified the hydrated aluminum(III) aquo ion as the catalytic species.302 Aluminum NMR spectroscopy and mass spectrometry indicated that the hexacoordinated aluminum species played an important role throughout the whole catalytic cycle (Scheme 90).

and sodium azide in water catalyzed by oxozirconium chloride (Scheme 87).279 Zirconium(IV) worked as a Lewis acid to Scheme 87. Zirconium-Catalyzed [3+2] Cycloaddition of Cyanamides and Sodium Azide

activate cyanamides to function as dipolarophiles. The reactions furnished 1-aryl tetrazoles as products in high yields with excellent selectivity. 3.1.3.2. Niobium. Islam and co-workers reported the use of peroxoniobium with arginine or nicotine as a catalyst for the selective oxidation of sulfides to sulfoxides.280 The reactions were efficiently catalyzed by only 0.03 mol % of the complex to afford the product in 95% yield. 3.1.3.3. Molybdenum. Sakuraba and co-workers employed cyclodextrins with dihydroxybenzoate tags as ligands for molybdenum(V) and copper(II) for the asymmetric oxidation of sulfides to chiral sulfoxides (Scheme 88).281 Phenolic

Scheme 90. Hexacoordinated Aluminum Species Mediating a Hydride Shift in the Polyol Structure

Scheme 88. Cyclodextrin-Induced Chirality on Molybdenum for the Enantioselective Oxidation of Sulfides 3.1.3.4.3. Indium. The activation of simple benzylic alcohols was reported by Wang, Ji, and co-workers. They employed indium triflate as a water-stable Lewis acid to activate the hydroxyl group to promote SN2 reactions by using indoles as Cnucleophiles or anilines as N-nucleophiles (Scheme 91).287,303 Scheme 91. Indium-Catalyzed Nucleophilic Substitution of Benzylic Alcohols

Although the utilization of alcohols as alkylation donors has been investigated under hydrogen autotransfer (HAT) conditions, HAT requires expensive transition-metal catalysts and is sensitive toward redox-active functionalities. In this context, the Lewis-acid-promoted nucleophilic substitution of hydroxyl groups is a desirable method of transforming alcohols. Ranu and co-workers employed indium chloride as a Lewis acid catalyst for the oxidation of olefins in water (Scheme 92).289 Ozonolysis-like C−C multiple-bond cleavage was

hydroxyl groups on benzoate were assumed to capture the metal center and cap the cyclodextrin-containing substrates, to promote oxidation reactions in an enantioselective manner. 3.1.3.4. Main Group Elements. Some of the main group elements show water-stable Lewis acidity and can catalyze organic reactions in water, such as indium,282−289 bismuth,290−292 and tin.293,294 3.1.3.4.1. Alkali Metals. Liu, Xu, and co-workers demonstrated the aminolysis of nitriles in water with a catalytic amount of CsOH (Scheme 89).295 Other alkali metal bases, such as KOH and NaOH, also showed activity for the reaction, but with inferior performance. Unlike other alkali metals, cesium is known to exhibit specific catalytic activity for nucleophilic substitution reactions in organic solvents.296 The

Scheme 92. Indium-Catalyzed Oxidative Cleavage of C−C Multiple Bonds

promoted by using tert-butyl hydroperoxide (TBHP) as a terminal oxidant to furnish the corresponding carboxylic acids or ketones in moderate to high yield. 3.1.3.4.4. Tin. Dimethyltin(IV) dichloride shows unique selectivity for 1,2- or 1,3-diols in nucleophilic reactions. Muramatsu and co-workers investigated the monobenzoylation

Scheme 89. CsOH-Catalyzed Aminolysis of Nitriles

699


Chemical Reviews

Review

of diols in water (Scheme 93).293 Diols produce stannylene acetal intermediates in the presence of tin(IV) species, which

water with a catalytic amount of Bi3+. Coca and co-workers reported the cycloaddition of aryl nitriles and sodium azide to form 1H-tetrazole derivatives in water under microwave heating conditions.313

Scheme 93. Selective Monobenzoylation of Diols Catalyzed by Dimethyltin(IV) Chloride

3.2. Supported Metal Catalysts

Because of the high cost and limited reserves of some metal species, it is highly desirable to develop catalysts that can be easily recovered and recycled. In this context, heterogeneous catalysts are attracting great interest, especially for large-scale chemical production in industry. However, heterogeneous catalysts usually suffer from lower reactivity and selectivity as compared to their homogeneous counterparts. To date, much effort has been exerted to develop heterogeneous catalysis in water; some review articles have already been written in this field.207,314,315 This section summarizes recent progress in the development of heterogeneous catalysts that are highly reactive and selective and have excellent durability, and which thus represent progress toward sustainable organic synthesis in water. 3.2.1. Immobilized Catalysts on Inorganic Supports. 3.2.1.1. Silica and Metallosilicates. Silica and some metallosilicates, such as aluminosilicates, are rigid and stable materials with high levels of surface functionalities. In particular, materials with highly porous structures are highly suitable as catalyst supports because their large surface areas can achieve high catalytic activities. Significant effort has been devoted to research in this field; Minakata and Komatsu have presented an excellent review summarizing the work to 2009.314 Siloxanetethered organic materials are easily attached on a silica surface covalently. Ligand immobilization has been achieved using this technique. Kobayashi and co-workers immobilized the waterstable Lewis acid Sc(OTf)3 on silica gel by using trimethoxysilylethylbenzenesulfonate as a linker (Scheme 96a).316 The

undergo benzoylation reactions. After the first benzoylation, the substrate can no longer coordinate to tin(IV) catalyst to proceed to a second benzoylation. Onomura and co-workers built on Muramatsu’s work to employ the same dimethyltin(IV) diol intermediate for monoselective oxidation reactions in water (Scheme 94).304 Scheme 94. Monoselective Oxidation of 1,2-Diols Catalyzed by Me2SnCl2

Molecular bromine or dibromoisocyanuric acid was found to be a suitable oxidant to afford the reaction in a selective manner. The nucleophilic attack of an alcohol oxygen on the bromonium cation only proceeded from the bidentate tin-diol intermediate, allowing control of the selectivity. 3.1.3.4.5. Bismuth. Given their stability, low toxicity, and availability, bismuth salts have received much attention as catalysts in organic chemistry. Cationic bismuth species are known to be easily hydrated to form the aquo complex Bi(H2O)83+ or polynuclear species such as [Bi6O4(OH)4]6+.305 Their Lewis acidity and associated catalytic activity in water is, however, maintained by basic ligands. Amine ligands or heteroatom-containing substrates are responsible for the stability of bismuth-based catalysts in the reported examples of Bi3+ catalysis in water.306 Ollevier and co-workers reported that Bi(OTf)3 catalyzed three-component Mannich reactions (Scheme 95).307 Cyclo-

Scheme 96. Immobilization of Metal Complexes on Silica Materials through a Siloxane Tether

Scheme 95. Direct Mannich Reactions of Cyclohexanone Catalyzed by Bi(OTf)3

hexanone was directly applied to the reaction without preformation of the enolate species. Shao and co-workers also showed the direct Mannich reactions of acetophenone in water during their condition optimizations.308 The use of Bi3+ has been reported extensively for several Lewis-acid-catalyzed reactions. Banik and co-workers described the 1,4-addition of indoles to enones using Bi(NO3)3.309 Mohan and co-workers reported acetal cleavage catalyzed by BiI3.310 The condensation of 1,2-diamines with 1,2-diketones311 or aldehydes with malononitrile312 was efficiently promoted in

catalyst showed excellent reactivities for Mukaiyama aldol reactions, 1,4-addition reactions, Mannich reactions, and allylation reactions in the presence of catalytic amounts of imidazole-based ionic liquids. Efficient hydrophobic environments were created around the silica surface by the interaction of ionic liquid to enhance the catalytic reactions. Bhaumik and 700


Chemical Reviews

Review

co-workers connected 2-iminofurane by a siloxane tether onto mesoporous silica SBA-15 to immobilize copper(II) species (Scheme 96b).317 The catalyst was applied for the thioetherification of aryl bromides and benzyl bromide using thiourea as a sulfur source. Similar catalyst immobilization was achieved by Ma and co-workers by employing salicylaldehyde-derived imines as ligands to immobilize copper(II) species on SBA15, for the oxidation of benzylic alcohols to give the corresponding aldehydes using hydrogen peroxide as an oxidant (Scheme 96c).318 Xie and co-workers reported that copper(II) catalysts with Schiff base ligands immobilized on SBA-15 or MCM-41 through a siloxane tether are effective for the oxidation of aldehydes into carboxylic acids (Scheme 96d).319 Sugiyama and co-workers used silica-immobilized DNA as a reusable chiral source for copper(II)-catalyzed asymmetric Diels−Alder reactions in water (Scheme 97).320 Ammonium

Scheme 98. Metal Complex Catalysts on Metal Oxide Supports

Scheme 97. Silica-Supported DNA for Copper-Catalyzed Asymmetric Diels−Alder Reactions

showed a higher reaction rate than that of the unsupported counterpart, ruthenium(IV) oxide, ruthenium(III) chloride, and other ruthenium complexes. Riisager and co-workers also employed immobilized ruthenium hydroxide to catalyze the aerobic oxidation of 5-hydroxymethylfurfural (HMF) in water (Scheme 98b).325,326 Various inorganic materials were investigated, and it was found that the use of basic supports such as MgO, MgO·La2O3, or hydrotalcite provided excellent results. Immobilization on magnetic particles, such as γ-Fe2O3, is also an interesting method for more practical applications. Sobhani and co-workers immobilized 2-iminopyridine ligand on γ-Fe2O3 by using a siloxane tether (Scheme 98c).327 Palladium acetate could be employed on this immobilized ligand for C(sp2)−P coupling reactions in water. The catalyst could be easily recovered and reused at least eight times without loss of activity. 3.2.1.3. Hydroxyapatite. Hydroxyapatite (HAP), a natural mineral of calcium phosphate hydroxide that is insoluble in water, possesses good chemical stability and mechanical stiffness. Human bone is composed of more than 50% HAP, which indicates the utility of this material. It is possible to immobilize transition metals on HAP by adsorption, incorporation, ion exchange with calcium, or through the formation of NPs. As an early example, Kaneda and co-workers investigated the use of ruthenium−HAP as a Lewis acidic catalyst to promote aldol condensation reactions in pure water using nitriles with aldehydes or ketones (Scheme 99).328

cations were installed on the silica surface, which interacted with phosphate anions on the nucleic acid to bind DNA strongly. The immobilized DNA worked as a reaction environment similar to that in solution phase,321 to bind a copper−dimethylbipyridine complex. Because of the multiple ionic interactions between the silica surface and the DNA, the catalyst was sufficiently stable to be recovered and washed for reuse without significant loss of DNA. Metal-doped silica often exhibits the characteristics of the dopant, such as Lewis acidity. Hara and co-workers reported that titanium-doped mesoporous silica could catalyze Mukaiyama aldol reactions in water.322 Some of the titanium species in silica form an unsaturated tetrahedral TiO4 structure, which works as an active Lewis-acidic site for the catalysis. To conduct the reaction smoothly in water, the authors also introduced a hydrophobic group on the mesoporous silica, to disperse organic material in water effectively. Zeolites, which are porous aluminosilicate materials, are also an important class of solid materials used as a catalyst bed. Davis and co-workers reported the Lewis-acidic activities of zeolites containing Ti4+ or Sn4+, so-called Ti-beta and Sn-beta, which were used to isomerize glucose to fructose in water.323 Computational studies supported their hypothesis that the open sites of tin or titanium centers worked as Lewis-acidic points to activate hemiacetals or carbonyl groups on the substrates. 3.2.1.2. Metal Oxides. Other water-insoluble metal oxides are also applicable as catalyst supports. Alumina and magnesia have been used as supports for ruthenium hydroxide species. Mizuno and co-workers reported the hydrolysis of nitriles in water (Scheme 98a).324 Immobilized ruthenium hydroxide

Scheme 99. Cationic Ru−HAP Catalysts for Diels−Alder Reactions and Aldol Condensation Reactions

701


Chemical Reviews

Review

Zhang, Fu, and co-workers employed ruthenium−HAP for the hydrodeoxygenation of various fatty acids into their corresponding alkanes.329 Thanks to the robustness of HAP, the catalyst could be applied to various “dirty” substrates to achieve high conversion. Masuyama and co-workers reported the immobilization of palladium(II) and copper(II) on HAP for allylic alkylation reactions in water330 and azide−alkyne [3+2] cycloaddition reactions,331 respectively. In both catalysts, metal centers are coordinated by phosphate oxygen and show reactivity similar to that of their phosphate analogues. 3.2.1.4. Other Materials. Avnir, Driess, and co-workers demonstrated the immobilization of a water-soluble metal complex in metallic silver matrixes.332 Oxorhenium trichloride phosphine complex was added to a slowly reducing solution of AgNO3 to form rhenium complex@silver catalyst. The catalyst efficiently promoted the epoxidation of various alkenes in water using Na2S2O8 as an oxidant (Scheme 100). The poor results

Scheme 101. Polymer-Immobilized Scandium as a Heterogeneous Water-Compatible Lewis Acid Catalyst

Scheme 102. Periodic Mesoporous Organosilica as a Support for a Sc3+ Catalyst

Scheme 100. Oxorhenium Complex Immobilized in Metallic Silver Matrixes as a Catalyst for Epoxidation Reactions displayed excellent catalytic activity toward both Barbier− Grignard-type reactions and Mukaiyama aldol reactions. Kantam and co-workers developed an immobilized Mn− salen complex for the oxidative kinetic resolution of racemic secondary alcohols (Scheme 103).346 The salen ligand with Scheme 103. Oxidative Kinetic Resolution of Racemic Secondary Alcohols Catalyzed by Resin-Supported Sulfonato-manganese(salen) Complex in Water

with each component, or with rhenium complex that had simply been adsorbed on silver metal, indicated the importance of immobilization in metal matrixes and demonstrated the synergistic effect of rhenium and silver. 3.2.2. Immobilized Catalysts on Organic Supports. 3.2.2.1. Resin-Supported Catalysts. The immobilization of metal complexes on polymer materials is one of the best and most frequently used strategies for the heterogenization of homogeneous molecular catalysts. It is conventionally performed in organic solvents. A number of authoritative reviews on this approach have been published already.333−341 Lu and Toy,336 and Kann338 also noted reactions in water with polymer-supported catalysts in their review papers. Uozumi focused on polymer-supported palladium catalysis in water in two reviews covering the research up to 2008.342,343 Paul and Islam summarized the research on Suzuki−Miyaura coupling reactions using supported palladium catalysts in water up to 2015.341 In this section, recent progress on reactions using polymer-supported metal catalysts is summarized. 3.2.2.2. Immobilized First-Row Transition-Metal Catalysts. Kobayashi and co-workers demonstrated the immobilization of Sc3+ on tetraalkoxy borate or aluminate-rich copolymers using a microencapsulation/cross-linking strategy (Scheme 101).344 Random copolymers of styrene, epoxy-substituted styrene, and tetraethylene glycol-substituted styrene were treated with a borate/aluminate source to form an anion-bridged structure. The catalyst efficiently captured scandium cations and was reusable up to six times in water for the catalytic 1,4-addition of 1,3-dicarbonyls to enones. Zhang, Li, and co-workers immobilized Sc(OTf)3 on periodic mesoporous organosilica by introducing a benzenesulfonate moiety into the organosilica framework (Scheme 102).345 The ordered microstructure of the organosilica framework exhibited good hydrophobicity and capture of organic materials, and

sulfonate substituent could be immobilized on polystyrenebased quaternary ammonium resin by ionic interactions. The authors initially conducted the oxidation reactions with the sulfonate-substituted catalyst (R,R)-1 in various solvent systems, and found that, whereas organic solvents showed almost no selectivity, water showed moderate to good enantioselectivity with salt additives. The polymer-immobilized catalyst resin−(R,R)-1 also showed good selectivity in water with a catalytic amount of KBr as an additive. Islam and co-workers developed a Merrifield resin-immobilized Schiff base-type ligand for the immobilization of an iron(III) catalyst (Scheme 104).347 The catalyst was applicable to the oxidation of styrenes, ethylbenzene, benzyl alcohol, and sulfide, and the bromination of phenols with hydrogen peroxide as an oxidant. The catalyst could be recycled at least six times for all types of reactions. The ability to use water-soluble oxidants such as hydrogen peroxide is one of the advantages of promoting reactions in aqueous media. Maheswaran and co-workers demonstrated the 702


Chemical Reviews

Review

Scheme 104. Reusable Polymer-Anchored Iron(III) Complex in Water

Scheme 106. Cross-Linked Polymeric Ionic Liquid for the Immobilization of a Copper(I) Catalyst

using the precipitation gel method. Cu-CPSIL showed the best reactivity for the azide−alkyne cycloaddition reactions in water, with 1 mol % catalyst loading achieving full conversion; in contrast, CuO/SiO2 required 10 mol % loading. 3.2.2.3. Immobilized Precious-Metal Catalysts. The use of polymer-immobilized palladium in water has already been summarized in previous reviews,342,343 especially for Suzuki− Miyaura coupling reactions up to 2015.341 For instance, Wang, Liu, and Xia developed palladium-immobilized imidazoliumcontaining cross-linked polystyrene (P(DVB-IL)-Pd) (Scheme 107a),351 and He and Cai developed a salen-type Schiff base

immobilization of VO(acac)2 on sulfonic acid resin to promote the oxidation of sulfides to sulfones in a selective manner.348 Hsiao and Liu developed dipropylene triamine-bridged poly(acrylic acid) for the immobilization of V as a catalyst for the oxidation of alkenes (Scheme 105).349 The degree of Scheme 105. Supported Vanadium Catalysts on a Methacrylate-Based Highly Functionalized Polymer for the Selective Oxidation of Alkenes

Scheme 107. Polymer-Supported Palladium Catalysts for Coupling Reactions

ligand attached to polystyrene for the immobilization of palladium(II) acetate (Scheme 107b).352 Wang, Liu, and Xia achieved carbonylative Sonogashira coupling reactions under 3.0 MPa CO atmosphere without copper(I) as a cocatalyst. Cai and co-workers conducted Sonogashira coupling reactions without the aid of copper(I) species. Lau and co-workers immobilized a ruthenium(II)-2,9dimethylphenanthroline complex on cation-exchange resins for application in the degradation of bisphenol A in water.353 The sulfonate moiety on the resins efficiently adsorbed the ruthenium complex. The catalysts efficiently decomposed bisphenol A in water with hydrogen peroxide as an oxidant. The catalyst was highly robust and could be reused at least three times without loss of ruthenium loading or decomposition of the polymer. Itsuno and co-workers developed a chiral N-benzenesulfonyl diphenylethylenediamine ligand (its homogeneous counterpart is known as Ts-DPEN, the ligand for Noyori−Ikariya catalysts) connected to functionalized polystyrenes to immobilize ruthenium(II) chloride for asymmetric transfer hydrogenation reactions in water (Scheme 108).354,355 The reactivities and selectivities of catalysts were dependent on the degree of cross-

polymerization and the molecular weight distribution were precisely controlled by atom-transfer radical polymerization (ATRP). The polymer with 28 methyl acrylate units was crosslinked with dipropylene triamine and was then hydrolyzed to furnish the acid form. Vanadyl sulfate (VOSO4 ) was immobilized on the polymer to give a water-insoluble catalyst. The oxidation reactions with this catalyst using TBHP as an oxidant yielded dicarboxylic acid quantitatively in most cases. The reaction system was also applicable to epoxidation reactions by tuning the conditions. Wang, Liu, and Xia reported a solid-supported catalyst for copper-catalyzed azide−alkyne cycloaddition reactions in water (Scheme 106).350 Cross-linked polystyrene with imidazolium salt, Merrifield resin substituted with an imidazolium salt moiety, or silica were employed as support materials to immobilize copper species. On a cross-linked polystyrene or Merrifield resin, copper(I) iodide was immobilized under basic conditions using potassium tert-butoxide as a base (Cu-CPSIL for cross-linked polystyrene, Cu-PSIL for Merrifield resin). Silica-dispersed copper(II) oxide (CuO/SiO2) was prepared 703


Chemical Reviews

Review

Scheme 108. Immobilized Ruthenium-Ts-DPEN Catalyst for Asymmetric Transfer Hydrogenation Reactions

Scheme 109. Knoevenagel Condensation Reactions Catalyzed by a Metal−Organic Cage under Neutral Conditions

linking and hydrophilicity of the polymer backbone. In water, the hydrophobic polymer (polystyrene without functionality) showed catalytic activity inferior to that of the monomer, whereas the sodium salt of the sulfonate-functionalized polymer showed higher reactivity. Cation exchange to a quaternary ammonium further enhanced the reactivity. Schomäcker and co-workers immobilized rhodium(III) catalyst356,357 with an integrated Ts-DPEN ligand developed by Wills and co-workers.358 The catalyst was connected through an adipic amide linker to hyper-branched polyglycerol, amine-functionalized polypropylene membranes, and an aminefunctionalized polyethylene sinter chip. The authors conducted mechanistic studies to compare the reactions under heterogeneous conditions in water with a monomeric ruthenium catalyst, and found good agreement with the observed catalytic behavior.359 3.2.3. Metal−Organic Frameworks/Cages (MOFs/ MOCs). Confined space in self-assembled metal−organic composites are a unique and efficient reaction environment to promote organic reactions. Metal−organic frameworks (MOFs), consisting of metal centers with organic ligands to form a repetitive multidimensional structure, are crystalline, porous materials with a large void space. On the other hand, metal−organic cages (MOCs) exhibit highly symmetrical molecular-like structure with large pore. The structure and characteristics of MOFs can be varied dramatically by changing either the metal centers or the ligands. These properties of MOFs/MOCs make them highly suitable as heterogeneous catalysts. A large number of studies have been undertaken in this area,360 and some of the reactions have been conducted in water. According to a review,361 reactions catalyzed by MOFs or MOCs have mainly involved the acid-catalyzed hydrolysis or esterification of organic compounds, ammonia-borane hydrolysis catalyzed by immobilized metal NPs, or coupling reactions or hydrogenations catalyzed by palladium NPs. Further interesting examples developed in recent years will be summarized in this section. Fujita and co-workers investigated Knoevenagel condensation reactions in water catalyzed by a metal−organic cage without any additional base or acid (Scheme 109).362,363 Palladium(II)−2,4,6-tripyridyl-1,3,5-triazine exhibits cationic characteristics and efficiently captures the organic substrate. The authors assumed that the cationic nature of the cage stabilized an anionic intermediate to enhance the reaction rate. The authors pointed out the similarity of this facilitation in a hydrophobic cavity to the tricks of enzymatic catalysis. A palladium(II)-functionalized 2,2′-bipyridyl-based MOF was also used to construct quaternary carbon centers through the conjugate addition of arylboronic acids to β,β-disubstituted cyclic enones at 100 °C in water, including one example of an acyclic substrate.367 Yaghi, Chang, and co-workers employed cobalt−porphyrinbased covalent organic frameworks for the electrochemical

reduction of CO2 in water (Scheme 110).364 Carbon dioxide was reduced to carbon monoxide on the cobalt center of the Scheme 110. Cobalt−Porphyrin MOF for the Electrocatalytic Reduction of CO2 in Watera

a

Reprinted with permission from ref 362. Copyright 2015 American Association for the Advancement of Science.

framework under a low electrolysis potential (−0.67 V). Highly porous frameworks have a high capacity for carbon dioxide adsorption, and this can lead to quite high catalytic turnover numbers, up to 24 000. Liu, Shi, and co-workers reported the photocatalytic activity of zinc(II) MOFs for degrading organic dyes in water (Scheme 111a).365 LMCT (ligand-to-metal charge transfer) on zinc carboxylate was responsible for the photocatalytic activity, and the pyridinyl or carboxyl linker part worked as a photon antenna to transfer the energy to the ZnO center. Methyl orange, methylene blue, and rhodamine B were subjected to the photodegradation and were successfully decomposed into small organic molecules. Andrew, Lin, and Hsu reported an interesting use of MOFs (Scheme 111b).366 They synthesized iron(III)−fumaric acid frameworks and then carbonized them under high temperature to obtain magnetic iron−carbon nanorods (MICNs). The 704


Chemical Reviews

Review

by the coordination of sulfonamides to the active zinc center. Arylsulfonamide-pyridine-bearing IrCp* complexes then couple with hCA II to catalyze the asymmetric transfer hydrogenation of imines. In silico screening identified up to eight mutations that could improve the interaction, leading to improved activity and selectivity.387 β-Barrel protein nitrobindin (NB) is also regarded as a promising subject because the hydrophobic residues inside the cavity are likely to prevent the catalyst from coordinating to polar solvent molecules or residues such as amino or carboxylic groups. The use of a Grubbs−Hoveyda catalyst anchored in a NB mutant with a suitable cavity size and spacer length has enabled the ring-opening metathesis polymerization of a water-soluble 7-oxanorbornene derivative in water with a TON of >9000.388 Because of the compatibility of artificial metalloenzymes with cellular components, the possibility of engineering enzyme cascades has been investigated. When an artificial metalloenzyme, which alone displayed modest (R)-selectivity in the transfer hydrogenation of imines, was combined with monoamine oxidase-N-9 (MAO-N-9) under an oxygen atmosphere together with the addition of a catalase as a hydrogen peroxide scavenger, concurrent enzyme cascades could achieve excellent (R)-selectivity (>99% ee), starting from racemic amines.380,389 MAO-N-9 oxidizes amines to the corresponding imines in a dynamic kinetic resolution. Furthermore, a NAD(P)+-regeneration process using an artificial metalloenzyme has been coupled with NADH-dependent hydroxybiphenyl monooxygenase (HbpA), allowing phenoxidation of 1-hydroxybiphenyl (TON > 99) in the presence of oxygen. An intriguing application is in reaction cascades combining several natural and artificial enzymes (Scheme 112a) and using NADH-mimics that are compatible with enolate reductases.390,391

Scheme 111. MOFs or Carbonized MOFs as Redox Catalystsa

a

Part (a) reprinted with permission from ref 364. Copyright 2015 Royal Society of Chemistry.

iron−oxygen cluster was confirmed to contain both α- and γFe2O3 by X-ray diffraction (XRD) analysis. The composite showed catalytic activity for Fenton-like oxidation reactions to decolorize rhodamine B using hydrogen peroxide or persulfate as oxidants. 3.2.4. Artificial Supramolecular Catalysts Based on the Chirality of Biomolecules. In contrast to other supports or synthetic models, biological or bioinspired macromolecules such as proteins, sugars, and nucleotides offer catalytic nanoenvironments that accept hydrophobic substrates with specificity to yield the product in a highly enantioselective manner. In recent years, considerable attention has focused on the intrinsic catalysis of artificial metalloenzymes as an alternative to heterogeneous, homogeneous, and enzymatic catalysis.368 These approaches are based on the incorporation of metal complexes into a protein scaffold.369 In principle, different chemogenetic variations can be prescribed to tune the catalytic performance of these complexes. Synthetic supramolecular models, including MOFs (section 3.2.3) and multifunctional modular systems, are discussed in other sections. 3.2.4.1. Artificial Metalloenzymes. The simplest way to introduce an artificial catalyst core into a protein relies on covalent anchoring techniques. The flat hydrophobic pore of the transcriptional repressor from L. lactis (lactococal multidrug resistance regulator, LmrR) has been used to host copper(II)phenanthroline cofactors for Diels−Alder reactions,370 oxaMichael addition,371 and Friedel−Crafts reactions.372−374 Strain-forced azide−alkyne cycloadditions, in which L-4azidophenylalanine was genetically introduced through AMBER codon suppression, were employed to introduce a rhodium(II) dimer into the active site of prolyl oligopeptidase. The biotin−(strept)avidin system represents one of the most commonly adopted technologies. Recent applications include sulfoxidation,375 dihydroxylation,376 the transfer hydrogenation of ketones,377 enones,378 and imines,379−385 and the diastereoselective reduction of NAD+ using DCOO2Na as a hydride source386 in water without any cosolvent. The activity of human carbonic anhydrase II (hCA II), which catalyzes the reversible conversion of CO2 into bicarbonate, is known to be suppressed

Scheme 112. Streptavidin-Based Artificial Metalloenzymesa

a

(a) Artificial catalyst/enzyme cascade. (b) Upregulation induced by proteolytic cleavage of a tripeptide.

There is, however, all of the difference in the world between activity in water and in cells. The activity of artificial metalloenzymes is usually shut down by the presence of glutathione as an active nucleophile, albeit at a millimolar concentration, in the cytosol of a cell.383 In 2016, Ward’s group tailored Gram-negative E. coli cells to express the streptavidin host in their periplasm, the space between the inner and outer cell membranes, where the concentration of glutathione in its 705


Chemical Reviews

Review

thiol form is very low (in contrast to the disulfide form). Directed evolution studies on streptavidin embedding biotinylated ruthenium-based Grubbs−Hoveyda catalyst identified a streptavidin variant with five amino acid residues mutated; this mutant displayed superior performance in umbelliferone production through metathesis.392 In the same year, the upregulation of artificial catalyst activity by a natural enzyme was reported. The biotinylated iridium complex embedded into streptavidin emerged as an artificial zymogen for transfer hydrogenation in water (Scheme 112b).393 The addition of a protease could convert the inactive zymogen into an active catalyst. The latent catalysis of the system was switched on by capturing a released tripeptide on the iridium atom. The tripeptide sequence, as well as the streptavidin mutation, could regulate catalytic activity to achieve an enantiomeric excess (ee) of up to 81%, along with outstanding biocompatibility and upregulation by a natural enzyme. These advantages highlight the potential of this catalytic system for further application in cells. Silica NPs equipped with an artificial imine reductase display remarkable activity toward cyclic imine and NAD+ reduction, with a TON of >46 000 in water and >4000 in the presence of cellular debris.394 3.2.4.2. DNA/RNA-Based Catalysts. Deoxyribonucleic acid (DNA) represents an attractive chiral scaffold for hybrid catalyst design. Since the seminal report in 2005321 by Feringa and co-workers on transferring the chirality of DNA to the chelating environments through the intercalation of achiral ligands coordinating to metal cations in the helical structure of DNA, self-assembled DNA−intercalated nonchiral copper(II) complexes have been studied in a variety of asymmetric reactions using highly active α,β-unsaturated 2-acylimidazoles, such as Diels−Alder reactions (up to 98% ee),395−397 hydration (up to 55% conversion with 72% ee),398 Michael additions with dimethyl malonate (up to 99% ee), nitromethane (up to 94% ee),399 and malononitrile (up to 68% ee), and Friedel−Crafts alkylations (up to 93% ee)400,401 in water. In the early stages of research on DNA-based catalysis, natural duplex salmon test DNA (st-DNA) was usually used, in which the sequence can be considered random. A pronounced effect of DNA was found in the Diels−Alder reaction of azachalcone with cyclopentadiene catalyzed by a copper complex of 4,4′-dimethyl-2,2′-bipyridine (dmbpy), which showed a 100-fold rate increase.396 The dependence of the reaction outcomes on the DNA sequence suggested the importance of G-tracts (Table 1, entries 3−7). Several investigations revealed the sequences to be B-form, with a distortion toward the A-form, and the rate increase was considered attributable to the chemical or shape complementarity of the DNA groove to the activated complex.402,403 Indeed, well-known groove-binder Hoechst 33258-based ligands, which can provide precise and programmable anchoring, showed a high affinity for both calf thymus DNA (ct-DNA) and poly d(AT):poly d(AT).404 Single-stranded DNA resulted in only a trace amount of racemic product (entry 8), except for the case detailed in entry 9, albeit with significant retardation as compared to st-DNA, whereas nonselfcomplementary DNA sequences consisting of GC base pairs were found to induce high enantioselectivity (entries 10−12). These sequences were predicted to form a hairpin structure with a stem comprising three GC base pairs.405 The left-handed double helical structure [d(TCAGGGCCCTGA)2 and d(CAGTCAGTACTGACTGACTG)2] of chimeric

Table 1. Influence of DNA Oligonucleotides on a Diels− Alder Reaction Catalyzed by Copper−dmbpy Complex

Determined at 18 °C. bEnantiomeric excess of endo isomer. Cyclopentadiene (20 equiv), copper complex (10 mol %), and DNA (12 mol %) were used. The reaction time was 72 h. a c

L-DNA hybrid catalyst was found to give the opposite enantiomer with an almost identical level of selectivity.406 Various concentrations of D- and L-DNA resulted in no chiral bias, which suggests both strands associate independently of each other. When an inconsistent DNA sequence was mixed with the self-complementary left-handed oligonucleotide in various concentrations, a nonlinear selectivity outcome was observed. The concept was also extended to a ribonucleic acid (RNA) hybrid catalyst, affording 40% ee in the Friedel−Crafts reaction of 5-methoxyindole when coupled with a copper(II)− dmbpy complex.407 In contrast to double-stranded DNAs,

706


Chemical Reviews

Review

Scheme 113. DNA Hybrid Catalysis with a Nonchiral Copper(II)−dmbpy Complex for Various Asymmetric Reactions in Water

cyclopropanation of styrene derivatives underwent a large rate acceleration induced by DNA, and achieved up to 53% ee. Among the possible conformations of DNA, G-quadruplexes (G4) have also been explored in combination with nonchiral copper(II) complexes because of their intrinsically tunable conformation. They are found at the end of human telomeres and are composed of a repeating string of TTAGGG units. When human telomeric G4 (5′-G3(TTAG3)3-3′) was assembled with copper(II) ions, the Friedel−Crafts reaction of 5methoxyindole gave full conversion with 75% ee.422 Among the several first-row transition-metal species tested, copper showed the highest reactivity and selectivity. In the presence of sodium ions, the antiparallel conformation of the assembled complex was found to become stable and compact, resulting in increased enantioselectivity. The same tendency was observed in Diels−Alder reactions.423 Higher-order G4-DNA−copper complexes can afford remarkably high enantioselectivity (>90% ee).424 The possibility of switching the conformation depending on the chosen Na+/K+ ratio has also been shown.425,426 A copper(II)−dmbpy complex assembled with G4-DNA has also been used in sulfoxidation with hydrogen peroxide in water (giving up to 77% ee).427 Similarly, the G4-DNA-targeting nature of terpyridine metal complexes was applied to Diels− Alder reactions with up to 99% ee.428 Inversion of chirality was proved by replacing natural D-DNA with unnatural L-DNA. Cationic porphyrins were also tested as a G4-DNA binder and as a copper ligand;429 the observed selectivity was as high as 56% ee. A copper(II)−bipyridine core covalently anchored to G4-DNA exhibited the best performance in the Michael addition of dimethyl malonate, with up to 92% ee.430 3.2.4.3. Others. Copper(II) sulfate immobilized on chitosan served as a reliable catalyst for azide−alkyne cycloaddition in water, with recyclability without loss of activity, in a completely heterogeneous manner.431 In 2005, the pumpkin-shaped family of macrocycles called cucurbit[n]urils, CB[n], was employed as nanoreactors in asymmetric catalysis.432 The simple combination of Cu2+ with amino acid, and CB[8] as the host, could be used to catalyze the Diels−Alder reaction with up to 92% ee, accompanied by a 9.5-fold rate acceleration. A helical single-walled nanotube was fabricated by gelation through the self-assembly of a bolaamphiphile terminated with L-glutamic acid in water. Dispersion of the nanotube into

double-stranded RNAs possess a wide and shallow minor groove associated with a deep and narrow major groove, and form a compact A-form helix due to an additional 2′-OH group. To date, this strategy has been applied to several copper(II)catalyzed reactions (Scheme 113), including intramolecular Friedel−Crafts alkylation,408 fluorination with Selectfluor,409 the hydrolytic kinetic resolution of pyridyloxirane,410 protonation,411 and intramolecular cyclopropanation412 with significant rate acceleration and successful chiral induction, albeit with a low level of stereoselection and high dependence on the substrate. Practical applications of DNA hybrid catalysts include the development of a reusable catalyst, st-DNA immobilized on ammonium-functionalized silica beads, with scalability of the reaction;320 implementing a single-pass, continuous-flow process with chiral induction using ct-DNA bound to a cellulose matrix;413 and a cascade with laccase/TEMPOmediated oxidation.414 The covalent attachment of metal complexes to DNA sequences allows the enforced generation of a chiral microenvironment in which the catalyst center is constrained. Research on this approach commenced with the covalent assembly of an N-hydroxysuccinimide (NHS)-activated bipyridine ester and 5′-amino-modified oligonucleotides,415 and then a cisplatin-derived bipyridine ligand.416 Sugiyama and coworkers adopted an intrastrand bipyridine approach to devising artificial DNA metalloenzymes.417 On the basis of their discovery that cytosine exhibited distinct features among bases in the determination of the catalytic capability of copper(II)−bipyridine−DNA conjugate catalyst, flexible linkers such as triethylene glycol were incorporated in positions complementary to cytosine to control the size of the catalytic site, leading to enhanced reactivity and selectivity.418 Carrell’s group envisioned the introduction of pyrazoles or salen as metal-coordinating base pair surrogates, to incorporate the metallic cofactor into the heart of the DNA duplex.419 The observed enantioselectivity was nevertheless less than 40% ee. In progress toward DNA-based catalysis without externally adding a ligand, in vitro selection using biotinylated indole allowed the identification of a single-stranded 72-nucleotide deoxyribozyme that catalyzes Friedel−Crafts reactions.420 A cationic iron−porphyrin/DNA hybrid catalyst was reported for carbene-transfer reactions in water.421 Catalytic 707


Chemical Reviews

Review

aqueous solutions containing various metal ions could produce metal-coordinated single-walled helical nanotubes (M-HN), in which the coordination sites could serve as catalytic sites for asymmetric reactions such as Mukaiyama aldol reactions and Diels−Alder reactions even at low catalyst loadings (Scheme 114).433

The C−H bond adjacent to the tertiary nitrogen was activated in the presence of V2O5 to form the iminium intermediate under reflux conditions, and the catalyst was regenerated by molecular oxygen. Aqueous TBHP coupled with V2O5 under reflux conditions has been used for the oxidation of benzylic azides and alcohols to the corresponding carboxylic acids and ketones, along with oxidative cleavage of 1,2-diols and αhydroxyketones.434 Vanadium(V) alkylperoxy complexes are widely accepted as intermediates. The superior performance of Cu2O over CuO in oxidative decarboxylative ammoxidation in water at 130 °C has been reported (Scheme 116).435 The copper oxides redox cycle

Scheme 114. Metal-Coordinated Helical Nanotube (M-HN) Catalysts

Scheme 116. Aerobic Decarboxylative Ammoxidation of Phenylacetic Acids in Water

3.3. Bulk Metal(0) and Metal Oxides/Hydroxides

(Cu2O/CuO) is known to be driven thermochemically. Lewis bases such as ammonia serve as common probe molecules that can be used to characterize the acidic nature of an oxide surface. Exposing phenylacetic acid at 130 °C without ammonia under standard conditions furnished a 10% yield of benzaldehyde. Time-course GC analysis revealed the formation of benzonitrile, with some starting material remaining at the initial stage of the reaction. The oxygen atoms within the product come from water. The addition of organic solvents in aqueous ammonia was found to lower the reaction yield significantly. The oxidation of HMF is known to provide various furan chemicals. A practical, heterogeneous catalyst with high selectivity toward the oxidation of HMF has therefore long been desired. Reusable MnO2 with NaHCO3 has been used at 100 °C to convert HMF into 2,5-difurandicarboxylic acid (FDCA), a structural analogue of the terephthalic acid monomer, that is, a bioplastics precursor.436 Other manganese-based oxides (MnOOH, Mn2O3, Mn3O4, and MnO) were found to be ineffective. The uncommon production of cyclopentanone derivatives from HMF has also been reported. The catalytic activity of several mixed metal oxides containing Mg, Co, Ni, and Cu (with an Al-rich amorphous support) was evaluated at 140 °C with 20 bar H2.437 The selective formation of 3-hydroxymethylcyclopentanone (HCPN; 86%) and 3hydroxymethylcyclopentanol (HCPL; 94%) was achieved over Cu−Al 2 O 3 (Cu 0 . 2 4 Al 0 . 7 6 O 1 . 2 4 ) and Co−Al 2 O 3 (Co0.56Al0.44O1.48), respectively. 3.3.2. Heteroatomic Oxometalates. Since they were first named by Pope, polyoxometalates have gained attention because of their negative charge, interstitial sites, and extraordinarily high acidity. There has especially been interest in their application in catalytic reactions. Polyoxometalate catalysis in water offers a sustainable approach to synthesis.438 A lacunary Keggin-tungstoborate of K8[BW11O39H]·13H2O has shown good oxidation ability for the oxidation of alcohols with hydrogen peroxide at 90 °C in water.439 The catalytic activity of oxometalate has been evaluated in the ring-opening reaction of cyclohexane oxide with “deactivated” aniline, such as 3,4-dichloroaniline.440 The conversion

Bulk metal(0), metal oxide, and metal hydroxide represent the simplest heterogeneous catalysts both in organic solvents and in water. Given that they are reasonably air- and moisture-stable and practically insoluble, they can be used in highly sustainable systems in which catalysts, reactants, and water can form separated physical phases. Their bulk properties largely depend on the character of the metal−oxygen bonds, which produce a variety of electronic conductivities, allowing these catalysts to be classified into insulators, semiconductors, metallic conductors, superconductors, and high-temperature superconductors. Their composition and crystallographic structure, as well as their bonding character, can dictate their surface properties, including redox and acidic or basic properties, thereby altering their catalytic activity. 3.3.1. Oxidative Reactions. The badly organized, amorphous nature of the bulk surface facilitates the occurrence of the redox mechanism. Highly charged, small, polarizing metal cations contribute to the facile formation of multiple metal−oxygen bonds with lower binding energy. For instance, vanadium oxides undergo a V4+/V5+ redox cycle in which vanadyl groups (VO) with a strong bonding character in V2O5 are considered to be the redox-active species in the catalytic oxidation processes. The facile electron transfer of V4+/V5+ couples expected from the imperceptible variation in V−O bond lengths and the octahedral environment is thought to result in the improved catalytic activity. Vanadium(V) oxide has been used to catalyze an aerobic oxidative coupling reaction between tetrahydroisoquinoline and indoles (Scheme 115).82 Scheme 115. Oxidative CDC Reaction in Water Using Molecular Oxygen

708


Chemical Reviews

Review

transform infrared (FT-IR) analysis of dehydrated TiO2 and hydrated TiO2 in saturated water vapor have revealed that unsaturated coordination TiO4 tetrahedra preserve their Lewis acidity even in water.457,458 This indicates the potential suitability of TiO2 as a water-tolerant heterogeneous Lewis acid. The catalytic performance of TiO2 as a Lewis acid has been demonstrated in an epoxide ring-opening reaction with aniline and indole derivatives catalyzed by TiO2−ZrO2 mixed oxide,459 the hydride transfer of pyruvic aldehyde into lactic acid,458,460 and the allylation of benzaldehyde with allyltin reagent in water.458 Niobic acid, Nb2O5·nH2O, which has both Brønsted and Lewis acid sites, was also found to be an effective water-compatible Lewis acid catalyst. It is noteworthy that the catalytic activity of TiO2 or Nb2O5·nH2O is comparable to that of Sc(OTf)3, although there are substantially fewer effective Lewis acidic sites on TiO2. Further investigation has revealed the effective catalytic performance of Nb2O5·nH2O461 and TiO2462 in the conversion of glucose into HMF (Table 2). It is

was lower in acetonitrile, and the reaction suffered from a competitive side-reaction in tetrahydrofuran. When a mixture of water and an organic solvent such as toluene or acetonitrile was used, the yield of adducts did not improve considerably, and in some cases it was reduced. Cs2.5H0.5PW12O40 has been reported to be an efficient catalyst for the Mannich reaction of benzaldehyde, aniline, and cyclohexanone to give β-amino ketones in water rather anti-selectively,441 and the synthesis of 1,8-dioxo-octahydroxanthene from aldehydes and 1,3-cyclohexanedione/dimedone at 100 °C in water has also been reported.442 The oxidation of aldehydes to their corresponding carboxylic acids has been demonstrated at 50 °C in water with atmospheric oxygen, catalyzed by a single-sided triol-functionalized iron-centered polyoxometalate, [N(C4 H 9) 4 ]3-[FeMo6O18(OH)3{(OCH2)3CNH2}] (0.1 mol %), together with Na2CO3.443 The involvement of high-valent iron intermediates was proposed. 3.3.3. Conversion of Alkynes and Aryl Bromides. Other applications of copper oxide are the conversion of aryl halides and azide−alkyne cycloaddition444 with reliable reusability. The Cu2O/phase-transfer system is commonly used in the synthesis of anilines,445,446 quinazolines,447 benzimidazoles,448 and phenols.449 It is, by and large, difficult to define the active sites on the surface of metal oxide catalysts because there are many shapes, such as octahedral, cubic, wired, rod-shaped, and amorphous structures. Moreover, bulk catalysts have different chemical properties from NPs. Bimetallic oxides are expected to be effective for the concurrence of multiple oxidation states. The copper−manganese spinel oxide is used as a catalyst for the three-component coupling of 2-aminopyridines, aldehydes, and alkynes, followed by 5-exo-dig cycloisomerization.450 XPS analysis indicates that the manganese is in multiple oxidation states, consisting of Mn2+, Mn3+, and Mn4+. The ability of copper(0) powder to function as a catalyst for the N-arylation of heterocycles with aryl halides in water has been reported. Copper(0) powder catalyzed the reaction of iodobenzene with pyrazole in the presence of lithium hydroxide and tetrabutylammonium bromide at 120 °C in water.451 Although the catalytically active species was concluded to be copper(I), the catalytic system could be reused twice with a slight decrease in activity. On the basis of the report that N′phenyl-1H-pyrrole-2-carbohydrazide452 or N,N′-disubstituted oxalic acid bishydrazide453 had the best performance for CuO-, Cu2O-, or CuI-catalyzed Ullmann C−N coupling reactions at 130 °C under microwave irradiation, 2(hydrazinecarbonyl)pyridine N-oxides were developed as new ligands for copper(0) powder to catalyze the N-arylation of imidazoles in water.454 3.3.4. Reactions on Acid or Base Sites. Basic sites on the macroporous metal oxide surface (that is, coordinatively unsaturated oxygen ions) have been found to be applicable for the condensation of aldehydes or imines with ethyl diazoacetate to form β-hydroxy/amino-α-diazo carbonyl compounds in good yields, along with clear rate acceleration in water as compared to that in acetonitrile.455 In contrast, coordinatively unsaturated metal ions function as strong Lewis acids. Because the electrophilic properties of metal decrease at the edges, decreased particle size would result in weak Lewis acidity.456 Moreover, in contrast to the octahedral MO6 units of transition metals with saturated coordination spheres, the corresponding tetrahedral MO4 units exhibit Lewis acidity. Pyridine adsorption experiments coupled with the Fourier

Table 2. Catalytic Activity Test for HMF Formation from Glucose in Water

entry

catalyst

BAa

LAb

conv. (%)

HMF select. (%)

1 2 3 4 5d 6d 7d 8e

H2SO4 Amberlyst-15 H-mordenite Nb2O5·nH2O Sc(OTf)3 TiO2 phosphate/TiO2 phosphate/TiO2

22.4 4.8 1.1 0.17 0 0 0 0

0 0 0.26 0.15 2.0 0.24c 0.22c 0.22c

100 89 12 100 89 81 20 42

0 0 0 12.1 7.9 8.6 65 57

Brønsted acid sites (mmol g−1). bLewis acid sites (mmol g−1). Water-tolerant Lewis acid sites (mmol g−1). dIn D2O. eFor 4 h.

a c

a challenge to achieve viable selectivity toward HMF because of the propensity of HMF to undergo further reaction under acidic conditions, yielding levulinic acid and formic acid. Brønsted acid catalysts deliver levulinic and formic acids from glucose, whereas Lewis acid catalysts can convert glucose into HMF. In the presence of Sc(OTf)3, the reaction undergoes aldose−ketose isomerization with fructose, followed by dehydration to give HMF. In contrast, Lewis acid sites on bare TiO2 and phosphate/TiO2, in which OH groups on TiO2 are esterified as the phosphate, preferentially catalyze the stepwise dehydration of glucose via 3-deoxyglucosoeen reported to catalyze the dehydration of sorbitol to 1,4-sorbitan with high selectivity at 120 °C in water.464 Given that Nb2O5· 709


Chemical Reviews

Review

Scheme 117. Dodecyl-Sulfated Silica-Immobilized Nano-TiO2-Catalyzed Pechmann Condensation in Water

nH2O showed much lower selectivity, this result could be attributed to selective recognition by intercalation with strong Brønsted acid sites. Other examples include dodecyl-sulfated silica-immobilized nano-TiO2 (NTDSS), in which the surfactant parts are connected to the silica directly through an O-linker (Scheme 117).463 The novel catalyst was fully characterized using TEM, scanning electron microscope (SEM), XRD, inductively coupled plasma (ICP), and FT-IR. Its application in Pechmann condensation demonstrated high catalytic performance in water. Easy workup and catalyst recovery and reuse were also realized. 3.3.5. Reactions of Organometallic Species on Surface. Heterogeneous metal oxides/hydroxides or zerovalent metals seem to be effective for the generation of organometallic species in situ on the surface. In contrast to commonly used water-compatible Lewis acids with less nucleophilic counteranions, such as OTf− and ClO4−, such reactions operate better with much more nucleophilic counteranions, such as F− and OH−, in aqueous media.464 For instance, divergent reactivity has been observed in Cu(OH)2- and Bi(OH)3-based systems for the propargylation and allenylation of a hydrazono ester with the aid of sucrose in water (Scheme 118).465 It is

noteworthy that the Cu(OH)2-catalyzed reaction exhibited a preference toward propargylation. The formation of an unusual α-adduct in the presence of Bi(OH)3 could be explained by supposing that a tandem process occurred, consisting of boronto-bismuth transmetalation at the γ-position and the subsequent γ-addition of propargylbismuth species, whereas the reaction with Cu(OH)2 would involve the γ-addition of allenylboronate through Lewis acidic activation by Cu(OH)2. Deuterium-labeling studies with no change in allenyl/propargyl selectivity support a nontransmetalation mechanism involving Cu(OH)2.466 The unique characteristics of indium(0) observed in water have been seen in allylation using allylboronates, as the first example of the catalytic use of indium(0) for C−C bond transformations (Scheme 119).467 The reaction deteriorated in organic solvents, including alcohols. The use of various indium(III) reagents, which are known to be strong Lewis acids, proved to be less effective, with yields ranging from 30% to 61%. Indium(0) is proposed to serve as a surface-activated dual catalyst that is capable of activating allylboronate as a Lewis base and acetophenone as a Lewis acid, although an alternative mechanism involving a single-electron transfer (SET) process is possible. 3.3.6. Chirally Modified Metal(0)/Metal Oxide or Hydroxide. One alluring application of water-tolerant heterogeneous catalysts is in the design of chirally modified metal surfaces by using a strongly absorbing chiral modifier. Composed of insoluble metal salts or zerovalent metals with chiral modifiers, these are, in general, advantageous with respect to durability, recyclability, the prevention of metal contamination of the products, and availability for reaction integration, such as in tandem reactions that are compatible with sustainable organic synthesis. Moreover, they sometimes exhibit superior performance in water as compared to analogous homogeneous systems using cosolvents or anhydrous or neat conditions, even in the reactions between “water-insoluble”

Scheme 118. Addition Reaction of Hydrazono Ester with Allenylboronate in Water

Scheme 119. Racemic and Asymmetric Allylation Reactions in the Presence of a Catalytic Amount of In(0) in Water

710


Chemical Reviews

Review

performed without any solvent (neat conditions). Both Cu(OH)2 and ligand enable heterogeneous catalysis in water, and the solubility of both reactants is also known to be quite low. Several catalyst systems have been reported to date: (1) a heterogeneous catalyst comprising Cu(OH)2; (2) a homogeneous system in which Cu(OH)2 is dissolved by acetic acid; and (3) a homogeneous catalyst comprising Cu(OAc)2. The systems also featured wide substrate scope, including both acyclic and cyclic α,β-unsaturated carbonyl compounds,151 α,β,γ,δ-unsaturated carbonyl compounds,150 α,β-unsaturated imines,469 and α,β-unsaturated nitriles.470 The TOF reached 43 200 h−1 for the Cu(OH)2-based catalyst, which is the highest reported. The switching of regioselectivity depending on the heterogeneity of the system is noteworthy and impressive. Insight into the mechanism of these unique boron conjugate additions in water relies on stereochemical models supported by X-ray crystallographic and ESI−MS analyses. Although the role of water has not been completely revealed in this investigation, water is expected to be effective in the activation of a borylcopper(II) intermediate and a protonation event subsequent to a nucleophilic addition, leading to very high catalytic turnover. Copper(II) catalysis based on heterogeneous basic copper carbonate, comprising CuCO3 and Cu(OH)2 with Walphos-type ligand, has also been reported for one example of β-borylation, that of an α,β-unsaturated ester in water.471,472 The mysterious and unpredictable nature of chiral heterogeneous copper(II) catalysts in water is also manifested in asymmetric silyl conjugate addition using silylboron reagents. This approach has been accompanied by a number of intriguing features, including wide scope and high enantioselectivity, especially in application to β-nitrostyrenes, with an unusual preference toward 1,6-addition, and the transfer of a silyl group to generate a quaternary carbon center bearing a C−Si bond.153 As a result of screening, it was found that the catalyst prepared from Cu(acac)2 (acac = acetylacetonate) and chiral 2,2′bipyridine for asymmetric silyl conjugate addition in water exhibited a heterogeneous nature and high reusability, without requiring the chiral ligand to be supplemented. Despite its insolubility, the catalyst functioned efficiently only in water, implying that the reaction took place at the solid (catalyst)− water interface. Water is responsible for building a sterically confined transition state and accelerating subsequent protonation to achieve high yield and enantioselectivity. Extensive effort led to the discovery of a novel type of catalysis on copper(0) surfaces decollated by a chiral modifier. It was found that the combination of copper(0) and chiral 2,2′bipyridine could catalyze the reaction of chalcone with bis(pinacolato)diboron efficiently. The reaction in organic solvents exhibited significantly inferior catalytic performance. Chiral 2,2′-bipyridine delivered the best result among the screened chiral ligands. By modification of the ligand structure, the mixture of copper(0) and chiral 2,2′-bipyridine was made amenable to spectrometric investigations such as ESI−MS, NMR, and UV−vis analyses. The postulated reaction pathway involves oxidative cyclometalation as a rate-determining step. Catalytic use of Ag2O resulted in the anti-selective allylation of aldehydes using allyltin reagents in aqueous media.473 A number of chiral ligands were subsequently examined to manufacture chiral Ag2O surfaces for asymmetric execution; it was found that a chiral phosphoramidite ligand functioned, albeit with only moderate enantioselectivity (Scheme 122).474 Only the surface of Ag2O was suggested to be an efficacious

substrates. Remarkably, a chiral bis(oxazoline) ligand was found to include the indium(0) metal for asymmetric execution (Scheme 119). A significant decrease in enantioselectivity in the presence of indium(I) or indium(III) instead of indium(0) suggests distinguished catalytic activation of both allylboronate and acetophenone, induced by indium(0). Chiral indium metal surfaces modified by a chiral bis(imidazoline) ligand have also been reported as catalysts for an allylation performed in water (Scheme 120).468 The system Scheme 120. Enantioselective Barbier-Type Allylation of 3Bromoacetophenone with Allylbromide in Water

relies on the use of a stoichiometric amount of In(0) powder and a catalytic amount of chiral ligand, allowing enantioselective Barbier-type allylation in water. The chiral allylindium(III) sesquihalide complex formed with chiral bis(imidazoline) ligand was indicated as an intermediate based on 1H NMR spectroscopic and ESI−MS spectrometric analyses. The number of enantioselective boron conjugate additions to α,β-unsaturated carbonyl compounds has mushroomed thanks to the concept of stereoinduction on the chirally modified metal surface, especially in water. Kobayashi and co-workers reported chiral copper(II) catalysis consisting of chiral 2,2′bipyridine, in contrast to traditional copper(I) catalysis in organic solvents. The research arose from the unpredicted high activity of a chiral Cu(OH)2 surface toward β-borylation using bis(pinacolato)diboron with the aid of acetic acid (Scheme 121).149 Organic solvents prevented the catalysis, and the reaction completely failed to give the desired adduct when Scheme 121. Asymmetric Boron Conjugate Addition Catalyzed by Copper(II) Catalysts in Water

711


Chemical Reviews

Review

detachment, and aggregation should be considered to understand the dynamic nature of catalysts.475 The catalytic performance of NPs is, by and large, determined by their size, shape, composition, dispersity, and morphology and is sometimes distinct largely from that of the corresponding molecular complexes. There have been rapid advances already in size- or shape-controlled NP preparation and structure determination. The methods for preparing metal NP catalysts rely mainly on the reduction of metal salts and on the thermal degradation of organometallic complexes. The stability of NPs can be attributed to electrostatic interaction between ionic compounds, especially in water, and steric effects exerted by neutral molecules such as polymers. In addition, metal NPs immobilized on a catalytically inert metal oxide support often have a dominant impact on activity, resulting from metal− support interactions that are so strong they can modify the electronic state of metals. 3.4.1. Palladium NPs. 3.4.1.1. Coupling Reactions. The Suzuki cross-coupling reactions of arylboronic acids and aryl halides as an accessible route to biaryls have received much attention in the context of the activity of palladium NPs (Pd NPs). One of the pivotal advantages of Pd NPs is their catalytic activity even at relatively low doses. Table 3 shows selected examples of active Pd NP catalysts and a comparison of their catalytic activity in successful couplings of inactivated or lessreactive aryl chloride in water. Dendritic encapsulation conveys advantages due to the spherical topology, precise molecular definition (with size control upon progressive increases in the generation number), and ability to make a microporous network to acquire long-term stability and recyclability. For

catalyst, and the amount of the catalyst could be reduced to less than 0.01 mol %. Scheme 122. Asymmetric Allylation Reactions Catalyzed by a Chiral Silver Oxide Complex in Water

3.4. Metal Nanoparticle Catalysts

Transition-metal NPs have emerged over the past two decades as sustainable alternatives to supported metal ion-based catalysts, thanks to their enormous surface areas, durability, and high reusability as catalysts. Metal NP catalysts are one of the most promising materials to replace existing homogeneous/ heterogeneous catalysts, because they provide a quasihomogeneous phase for efficient reactions under mild and environmentally benign conditions. Meanwhile, identifying catalytically active species often remains elusive, and catalyst interconversions that involve leaching, metal attachment/

Table 3. Representative Examples of Pd NPs as Catalysts for Suzuki, Ullmann, Stille, Heck, and Sonogashira Reactions Using Aryl Chloridesa

ref

Pd NPs

diameter (nm)

476 477 478 479 480 481 482 483 484 485 486 486 488

b

2.0 1.6 ± 0.3 2−5 3.0 ± 0.6 4.9 ± 2.5 1.9 ± 0.7 2.6 0.5−4 4.9 ± 0.9 6.4 3.0 5−15

Pd/G3-p3 G4-OH(Pd40)c Pd/PICd Pd/bis(Im)e MEPI-Pdf Pd/MIL-101g Pd@MIL-101Cr-NH2 Pd/PPhen Pd/UOF-1 Pd/SBA-15 Pd/MSC Pd/CD-GNS Fe-ppm Pd

TON

28−9500 580−66000 880−15000 90−194 1−32 69−109 27−7875 94−183 1460 85737−101218

temp (°C)

recycle number

features

80 80 100 120 100 80 rt 80 25 120 30−100 90 45

8 4 10

dendritic microporous polymer dendrimer

4 5 10 4 4 5 21 3 5

MOF MOF microporous CMP urea-based porous polymers mesoporous silica mesoporous silica/carbon graphene nanosheet

a TONs are calculated on the basis of the original reports. bDendric copolymer consisting of 2-methacryloyloxyethyl isocyanate and a thirdgeneration PAMAM [poly(amindoamine)] dendrimer. cFourth-generation hydroxyl-terminated PAMAM dendrimers. dPorous ionic copolymer (prepared by radical copolymerization of an IL with divinylbenzene). eThermal decomposition of palladium(II) 1-(4-N,N′,N″trimethylbutylammonium)-2-(2-pyridyl)imidazole dichloride. fMetalloenzyme-inspired polymeric imidazole; poly[(N-vinylimidazole)-co-(Nisopropylacrylamide)5] and (NH4)2PdCl4. g(Cr3-(F,OH)(H2O))2O[(O2CC6H4CO2)3·nH2O.

712


Chemical Reviews

Review

instance, Ogasawara and Kato exploited heterogeneous PAMAM templates polymerized with acrylate as a dendritic microporous host.476 The resulting Pd/G3-p3 catalyst had a high turnover number (TON), reaching 8.5 × 104 in the Suzuki−Miyaura coupling of bromoacetophenone in water, along with high durability even when recycled eight times. Palladium was reduced stoichiometrically in the polymerization process wherein AIBN initiated the formation of radicals at the growing polymer chains. A large quantity of nitrogen, such as ammonium or imidazolium cations, appears to be most effectual for stabilizing Pd NPs, giving excellent catalytic performance. Uozumi and co-workers reported a polymeric imidazole palladium catalyst (MEPI-Pd) formed through coordinative convolution based on palladate, and used it for several transformations in water.480 The TON reached 15 000 at 66 mol ppm palladium loading, and the Suzuki−Miyaura coupling of aryl iodide was efficiently catalyzed with a TON of up to 3 570 000. Highly ordered microporous structures with large specific surface areas were also effective for entrapping palladium, such as SBA-15 (Santa Barbara Amorphous silica).485 Lipshutz and co-workers paved the way to minimizing the catalytic amount of palladium by supplying certain sources of iron chloride as an inherent palladium source with the aid of TPGS-750-M (vide infra, section 4.1.3).487,488 The system tends to be intolerant of variations of the reaction conditions, initiating from a reduction of 5 mol % of pure FeCl3 with MeMgCl, deliberately doped with 320 ppm Pd(OAc)2 and SPhos (2-dicyclohexylphosphino-2′,6′-dimethoxybiphenyl). The use of the new monophosphine ligand “HandaPhos” enabled the reaction to be run at less than 1000 ppm palladium loading in water without iron or MeMgCl.489 Subsequently, a synergistic combination of ppm levels of Pd(OAc)2 with copper was developed as a NP catalyst for Suzuki−Miyaura couplings of aryl iodide in water.490 The optimal reaction system did not give any product under an inert atmosphere. The formation of phosphine oxide from the P,Nligand was supposed to play an important role in the catalysis. Other applicable supports for Pd NP catalysts reported so far in cross-coupling reactions include carbon materials,491 silica nanotubes,492 and biomaterials, including reports of coupling within the cytoplasm or on the surface of living cells.493,494 3.4.1.2. Other Reactions. The use of NPs as catalysts for allylic substitution in water commenced with a Pd/C-mediated system. A dopamine-functionalized Pd NP catalyst immobilized on magnetically separable Fe3O4 was applied to the O-allylation of phenols with allylic acetates in refluxing water.495 Inferior reactivity was observed in toluene, tetrahydrofuran, and acetonitrile. A three-dimensional palladium−reduced graphene oxide (3D Pd−rGO) framework with hierarchical macro- and mesoporous structures was found to assist the reactant to contact the Pd NPs’ surfaces, thereby promoting high activity and selectivity in the Tsuji−Trost bisallylation of β-ketoesters in water.496 Pd NPs prepared in situ catalyzed the efficient stereoselective synthesis of 2-alkene-4-ynoates and -nitriles by a reaction of vic-diiodo-(E)-alkenes with acrylic esters and nitriles in water.497 The reaction of acrylic esters produced (E)-isomers exclusively, whereas (Z)-isomers were obtained with high stereoselectivity from reactions of acrylonitrile. Allyl−aryl coupling products can be furnished by the reaction of allylic carbonates with arylboronic acids (Scheme 123).498 It has been reported that 5 min agitation of palladium acetate (0.67 mol %) with phenylboronic acid in water produced well-dispersed Pd NPs with 2.6 nm average particle size. The reaction furnished

Scheme 123. Pd NP-Catalyzed C2-Selective Arylation of Indoles

the allyl−aryl coupling product in quantitative yield with complete enantiospecificity with inversion of the absolute configuration, and without E/Z isomerization or β-H elimination. A high TON (up to 537 000) was recorded for the Tsuji− Trost reaction at 80 °C in water in the presence of Pd NPs stabilized by poly(vinylpyrrolidone) (PVP).499 The addition of triphenylphosphine was crucial to enable the NPs to switch from the aqueous phase to the interphase/organic phase, leading to very high TOF and TON for the Tsuji−Trost reaction of ethyl acetoacetate with allyl methyl carbonate in water under pseudobiphasic conditions. The allylation of lignin showed high selectivity toward the phenolic OH groups. Pd NPs supported on propylamine-functionalized siliceous mesocellular foam (Pd0-AmP-MCF) showed excellent catalytic activity in the arylation of indoles using diaryliodonium salts with exclusive C2-selectivity in water (Scheme 124).500 No C3Scheme 124. Pd NP-Catalyzed C2-Selective Arylation of Indoles

phenylated indole was detected, even when diphenyliodonium salt was reacted with 2-methylindole. The reaction displayed low leaching of palladium (0.6 ppm), and superiority over the corresponding palladium(II) catalyst was confirmed. Pd/C was employed as a catalyst for P−C coupling between diphenylphosphine oxide and halogenated benzoic acids at 180 °C in water under microwave irradiation.501 The reaction was also characterized by a shorter reaction time (1 h) and low catalyst loading (1 mol %). In HMF conversion, magnetically separable Pd/C@Fe3O4 was used with high selectivity toward FDCA at 80 °C in water under an oxygen atmosphere.502 Pd NPs have also been applied to reductive transformation. The distinguished high solubility of gases, including H2, in hydrocarbons enables the selective entrapment of gases inside a micelle. Alkyne semihydrogenation was investigated in the presence of Pd(OAc)2 admixed with NaBH4 under micellar conditions.503 Pd NPs were formed with the release of hydrogen gas. Hydrogenation without any surfactant or with alternative surfactants resulted in a mixture of over-reduced, saturated alkane and the desired alkene in an unselective E/Z manner. The reaction performed in organic solvents, such as 1,2-dimethoxyethane (DME), acetonitrile, and THF, suffered from a significant deterioration in reactivity. The nanomicelles composed of TPGS-750-M around Fe/ppm Pd NPs served as a reaction environment for the reduction of nitro groups with sodium borohydride in water.504 The preferred use of KBH4 as a hydride source allows this process to be performed in a 713


Chemical Reviews

Review

standard reaction vessel, alleviating the need for specialized hydrogenation equipment.505 Glorius and co-workers synthesized negatively charged NHC-stabilized Pd NPs that showed long-term stability in water.506 The hydrogenation of 1-decene and citronellol suffered from moderate to low yield in toluene, methanol, acetonitrile, tetrahydrofuran, and N,N-dimethylformamide even under 10 bar H2 for 16 h. In contrast, the use of water as a reaction medium resulted in complete reduction even at low pressure (2 bar) within a shorter reaction time. Pd NPs encapsulated in MOFs were applied in the hydrodeoxygenation of vanillin in a low-pressure H2 atmosphere in water; the catalysts were prepared by introducing a palladium precursor into a highly porous and hydrothermally stable amine-functionalized UiO-66.507 The exclusive formation of 2methoxy-4-methylphenol was achieved with over 2.0 wt % Pd@ NH2−UiO-66 catalyst with recyclability for up to six cycles. Free amine groups in the framework of NH2−UiO-66 play a key role in the formation of uniform, well-dispersed, and leaching-resistant palladium NPs within the MOF host. 3.4.2. Gold NPs. Since the first, seminal examples of the exceptional performance of Au NPs in aerobic oxidation,508 the increase in interest in gold catalysis has been shown by the exponential growth in the number of publications in this area. Guo and co-workers were the first to demonstrate the application of Au NPs for the Suzuki−Miyaura cross-coupling reactions of less-reactive aryl chloride in water.509 Redox processes between HAuCl4 and 2-aminothiophenol as a reductant afforded Au NPs with suitable size and polymer thickness. At 0.05 mol % catalyst loading, activity was achieved that was comparable to that of the commonly used palladium catalyst. 3.4.2.1. Oxidation and Reduction. The aerobic oxidation of alcohols to their corresponding aldehydes has been demonstrated with Au NPs smaller than 1.5 nm stabilized by PVP in water.510,511 Electron donation from PVP made the Au NPs negatively charged, and the resultant catalytic activity increased with the increasing electron density of the Au NPs. The screening of diverse metal oxides as supports for Au NPs has revealed NiO to be the most efficient support for the production of acetic acid by ethanol oxidation in water with molecular oxygen. Doping the NiO support with Cu improved its semiconductivity, resulting in a higher preference toward acetic acid and a selectivity of above 80% under 0.5 MPa of O2 at 120 °C. The Cu doping also led to an increase in the specific surface area of the NiO support and to the deposition of smaller Au NPs. An increase in active oxygen on the support surfaces and perimeter interfaces between Au NPs and the support may contribute to the improvement in the selectivity toward acetic acid. Au NPs supported on the manganese oxide octahedral molecular sieve KMn8O16 [OMS-2] (Au/OMS-2) efficiently catalyzed the aerobic oxidative α,β-dehydrogenation of structurally diverse β-heteroatom-substituted ketones to give the corresponding α,β-unsaturated ketones (Scheme 125).512 The reaction suffered from a significant loss of reaction yield in N,N-dimethylformamide, N,N-dimethylacetamide, acetonitrile, toluene, 1,4-dioxane, and tetrahydrofuran. The reaction in ethanol was also retarded. The structure of OMS-2 (hollandite) changed gradually to Mn3O4 (stable spinel); the catalyst could, however, be reused with retention of the high performance. The oxidative N-formylation of amines with paraformaldehyde on the surface of Au/Al2O3 has been demonstrated in

Scheme 125. Oxidative Dehydrogenation of 1-Methyl-4piperidone Catalyzed by Au NPs in Water

water.513 Methylene diamine was preferentially obtained in the presence of Al2O3 alone. Au NPs are also known to be effective in reductions. When Au seeds were grown on the surface of Fe3O4 through thermal decomposition of the iron oleate complex, the size and morphology of the nanocomposites were found to be highly dependent on the size of the Au seeds, leading to the formation of dumbbell-like and flower-like nanocatalysts.514 Both structures showed excellent catalytic activity toward nitrophenol reduction with NaBH4 in water. A new active cyclodextrin-based Au NP catalyst has been designed, and the reduction of 4-nitrophenol to 4-aminophenol was found to reach completion in water within 3 min.515 The high porosity and excellent thermal stability were introduced by benzylation and Friedel−Crafts alkylation polymerization to configure a hyperporous polymer based on cyclodextrin (BnCD-HCPP). Au NPs stabilized by a nitrogen-rich poly(ethylene glycol)tagged substrate furnished water-soluble Au NPs with sizecontrollability. Selective reduction of nitroarenes with NaBH4 in water to yield the corresponding anilines at room temperature was achieved.516 3.4.2.2. Hydration. Nanosized gold-decorated titanium oxide (Au/TiO2) showed superior catalytic performance in the hydration of nitriles to their corresponding amides in water at 60 °C.517 The smaller particle size (99%), was observed for Pt catalysts supported by gC3N4 nanosheets.536 Simple thermal oxidation etching of bulk g-C3N4 in air provided graphitic carbon nitride nanosheets with an average thickness of ca. 3 nm. The large specific surface area, uniform dispersion of Pt NPs, and stronger furfural adsorption ability of nanosheets contributed to the considerable catalytic performance. A photocatalytic route for the conversion of lactic acid into acetaldehyde in water yielded CO2 and ethanol in the presence of Pt/TiO2.537 A concerted photodecarboxylation/ dehydrogenation radical mechanism was proposed. Pt NPs stabilized by linear polystyrene were found to be effective for the one-pot synthesis of indoles in water.538 The reaction involves aerobic alcohol oxidation and subsequent cyclization. Bouchard and co-workers demonstrated the use of Pt NPs capped with glutathione to induce heterogeneous parahydrogen-induced polarization in water.539

polyoxometalates, as well as the size of the Au NPs, was of crucial importance. The polyoxometalates facilitate the desorption of gluconic acid and inhibit its further degradation, along with promoting the hydrolysis of cellobiose. Methylsuccinic acid has been successfully formed directly from citric acid in water through the new reaction sequence of dehydration, decarboxylation, and hydrogenation in the presence of Pd NPs supported on BaSO4 with 4 bar H2 at 225 °C.528 The mechanism commences with the dehydration of citric acid to aconitic acid, followed by spontaneous decarboxylation to generate itaconic acid, the α,β-unsaturated carboxylic acid form of which is in an equilibrium between mesaconic and citraconic acid. A mixture of these isomers can be hydrogenated to yield the desired methylsuccinic acid. As a one-step sequential protocol, the reaction potentially suffers from a number of byproducts, such as fragmented products like acetone, pyruvic, and acetic acid, propane-1,2,3-tricarboxylic acid (reduced aconitic acid), methacrylic acid, and crotonic acid (decarboxylated itaconic acid), or their reduced structures, such as isobutyric acid, butyric acid, and propane. Optimal reaction conditions based on Pd/BaSO4 enabled the drastic inhibition of radical fragmentation, giving methylsuccinic acid with yields of up to 89%. 715


Chemical Reviews

Review

Upon increasing the temperature to 80 °C, 4-hydroxy-5-keto-2pyrroline was formed through domino cyclization. The selective synthesis of phenols, anilines, and thiophenols from aryl halides with water, ammonia, and sulfur powder has been reported in the presence of a stoichiometric amount of tetra-n-butylammonium hydroxide in water at 60 °C using CuI NPs; the reaction competed with hydroxylation in water.551 3.4.7. Metal Oxide NPs. Zinc oxide nanomicelles (average 120 nm diameter) stabilized by hexadecyl trimethyl ammonium bromide (CTAB) showed good reactivity and selectivity in the one-pot three-component reaction of 2-naphthol, aldehydes, and anilines552 and in thiazole synthesis from dimethyl acetylenedicarboxylate, trialkyl phosphite, benzoyl isothiocyanate, and primary amine553 in water. Water was far superior to the other solvents examined, which included dichloromethane, acetonitrile, tetrahydrofuran, N,N-dimethylformamide, and ethanol, and gave the exclusive formation of the desired product. Magnetic NPs meet the criteria of sustainable catalysts because of their robustness, ease of separation, and recyclability. NiFe2O4 NPs served as a catalyst for aza- or thia-Michael addition to α,β-unsaturated esters using aniline, aliphatic amines, and phenylthiol at 100 °C in water.554 The reaction reached completion within 10−45 min. Similarly, CuFe2O4 NPs were used in the synthesis of Hantzsch 1,4-dihydropyridines in water.555 CuFe2O4 NPs have also been used in catalytic C−S coupling reactions in water.556 PdO NPs stabilized by linear polystyrene have also been used for several coupling reactions in water.557 A palladium(II) catalytic cycle was proposed in which the locally leached palladium species was immediately restabilized on the catalyst surface while maintaining the size of the NPs.558,559 The assumed mechanism of PdO NP-catalyzed Hiyama coupling in water commences with the reaction with aryltrimethoxysilane rather than aryl halides.560 Nano-Ru(OH)x has been prepared by the postsynthetic functionalization of magnetic NPs with dopamine and the subsequent addition of ruthenium chloride, followed by hydrolysis under basic conditions. The nano-Ru(OH)x catalyst showed high activity for the hydration of a range of nitriles at 120−140 °C in water under microwave irradiation without affecting other sensitive functional groups.561 New phosphotungstic acid-based NPs have been prepared on the surface of organic−inorganic polyoxometalate NPs of H6Cu2[PPDA]6[SiW9Cu3O37]·12H2O (HybPOM; PPDA = pphenylenediamine) and GO/Fe3O4/HybPOM NPs that possess strong and sufficiently acidic sites.562 Higher yield was achieved within a shorter time for three-component Mannich-type reactions in water than in ethanol, polyethylene glycol, ethyl acetate, or dichloromethane. Cerium oxide (CeO2) NPs have been used extensively as catalysts for the multicomponent coupling of β-ketoesters, phenylhydrazine, malononitriles, and isatins to provide biologically interesting spiro[indoline-3,4′-pyrano[2,3-c]pyrazole] derivatives in water.563 Inferior activity was shown in ethanol, acetonitrile, and toluene. CeO2 NPs also displayed efficient catalysis in three-component reactions of 1,2-diamines with aldehydes and isocyanides at 80 °C in water, along with higher activity in water than in organic solvents.564 Fluorescent tetragonal ZrO2 NPs (t-ZrO2 NPs) were used for the one-pot multicomponent reaction of aromatic aldehydes, hydroxynaphthalene derivatives, and malononitrile.565 The average particle size of the t-ZrO2 NPs was 11.4

3.4.5. Iron and Nickel NPs. Iron(0) NPs stabilized by amphiphilic polymer resin have been reported to be effective in the continuous-flow hydrogenation of alkenes, alkynes, aromatic imines, and aldehydes in water, along with showing long-term stability and retention of high activity.540 In contrast, aliphatic amines and aldehydes, ketones, esters, arenes, nitro groups, and aryl halides were unreactive. The hydrogenation of nitrobenzene in water was investigated using a Ni/TiO2 catalyst. Deactivation of the catalyst surface was overcome by the introduction of hydrophobic properties by coating a hydrophobic carbon layer on the surface of the catalyst through the application of a hydrothermal method.541 Ni NPs formed in situ with a micellar system (TPGS-750-M) were found to promote Suzuki−Miyaura cross-coupling reactions at 45 °C in water.542 The reaction relied on a suitable choice of phosphine-based ligand (dippf, 1,1′-bis(diisopropylphosphino)ferrocene). Furthermore, unsupported nanoporous nickel (NiNPore) material has been used efficiently for the hydrogenation of carbonates to give formic acid in water.543 3.4.6. Copper NPs. The synthesis of dithiocarbamates has been achieved by the three-component condensation of amine, carbon disulfide, and aryl iodide or styrenyl bromide in the presence of Cu NPs in refluxing water.544 Cu NPs facilitated the transfer of electrons to promote oxidative coupling with aryl iodide, in contrast to copper(0) powder. Cu NPs were also used as a catalyst for the synthesis of aryl selenides and vinyl selenides from aryl iodide/vinyl bromide with diphenyl diselenide in the presence of zinc in water with heat under reflux.545 Aryl azides underwent reduction mediated by Cu NPs and ammonium formate in water under reflux conditions to afford aniline derivatives.546 Cu NPs were prepared from copper sulfate by reaction with hydrazine hydrate in ethylene glycol. Nitro, benzyl, allyl, nitrile, ester, ketone, and sulfonate groups were tolerated under these conditions. The reactivities recorded in tetrahydrofuran, dioxane, and toluene were far from satisfactory as compared to those in water. The surface of Cu NPs is considered a suitable platform from which to project hydrogen as the active reductant. The efficient combination of Cu NPs and azide was also seen in the three-component 1,3dipolar azide−alkyne cycloaddition reaction using diazonium salts as an azide precursor in water at 70 °C.547 The catalyst, copper NPs supported on activated carbon, was determined to be in the oxidized form of Cu2O and CuO. A magnetically retrievable Fe3O4-glutathione−Cu NP catalyst was subsequently developed.548 A three-component 1,3-dipolar azide− alkyne cycloaddition reaction using alkyl halide as an azide precursor took place at 120 °C in water under microwave irradiation. Nanoferrite functionalization techniques using glutathione were based on the stabilization of Fe3O4 by the coordination of a thiol group and potential cross-linking to other molecules by using amine and carboxylate functionalities. In 2016, Cu NPs encapsulated and stabilized by a water-soluble tris(triazolyl)-polyethylene glycol amphiphilic ligand were developed.549 Even at 20 ppm of Cu loading, simple azide− alkyne coupling was achieved quantitatively, with an exceptional TON of 28 000. Cu NPs formed in situ in micelles with ascorbic acid have been used as a catalyst for the conversion of isoxazoline in water.550 A low catalyst loading (0.6 mol %) at 60 °C was found to be sufficient to reduce isoxazoline to 2-hydroxy-4-keto esters. 716


Chemical Reviews

Review

nm, and the surface contained active hydroxyl, oxide, and Zr4+, which exhibit Lewis acidic or basic natures. Both monoclinic and cubic (bulk) ZrO2 were found to be much less reactive than t-ZrO2 NPs. The reaction gave the product at 80 °C in water within 30 min with 92% yield. A significant decrease in the reaction yield was observed in acetonitrile, toluene, and N,N-dimethylformamide. 3.4.8. Bimetallic NPs. Bi- and multimetallic NPs have been well studied for many catalytic transformations. They sometimes possess beneficial catalytic properties, described as electronic and geometric synergistic effects, which typically differ from those of the constituent metals. The beneficial role of water in gold-mediated oxidation has been discussed extensively, and this has guided the construction of hydrophobic surroundings in water to accelerate the α-hydrogen abstraction process of lipophilic substrates. Pt/Au-alloyed bimetallic NPs immobilized on a mixture of polystyrenebased copolymer backbone with a cross-linking moiety (PI Pt/ Au) exhibited high activity and selectivity in the aerobic oxidation of 1-phenylethan-1-ol in water (Scheme 128).566

the Cu−Ag bimetallic catalyst is more selective than pure silver toward epoxidation. A Pt−Mo bimetallic catalyst has been used for the conversion of levulinic acid into 2-methyltetrahydrofuran at 130 °C in water under a H2 atmosphere (5 MPa).572 Platinum and molybdenum were coimpregnated on H-β zeolite (Pt/ Mo−H-β). The reaction was proposed to involve the dehydrative cyclization of 1,4-pentanediol catalyzed by solid acid. Pt−H-β without Mo species gave only γ-valerolactone, and there was no conversion of levulinic acid when Mo−H-β was used. A Rh−In nanocomposite was discovered to be effective for the amination of various C3 alcohols with ammonia in water.573 The reaction of 1,2-propanediol with ammonia proceeded over bimetallic Rh−In/C to give nearly equimolar amounts of 1amino-2-propanol and 2-amino-1-propanol with a total initial selectivity of 89%. Dimethylpiperazines were competitively formed, presumably by the condensation of two amino alcohol molecules. In contrast, Rh/C showed no activity and In/C exhibited far inferior activity. Rh−In alloy particles with a size of 3−4 nm were revealed to be formed on the carbon support. This results from the efficient separation of photogenerated electron−hole pairs induced by the highly reduced graphene oxide. Uncommon mixed metal oxide NPs have also been reported. The reaction between aromatic aldehydes, hydroxynaphthalene derivatives, and malononitrile was efficiently catalyzed by a bimetallic CuO−ZnO nanocomposite to afford 2-amino-4Hchromenes in water under reflux conditions.574 The reaction in ethanol suffered from significant retardation, and the reaction did not proceed at all in acetonitrile, methanol, or hexane. The agglomerate of nanocomposites had a ca. 38 nm particle diameter, in comparison to 25 nm for ZnO. Bismuth tungstate Bi2WO6 NPs on reduced graphene oxide possessed significantly improved ability for the photocatalytic conversion of benzyl alcohol into benzaldehyde, with high selectivity under solar light irradiation, along with excellent stability and recyclability.575 The valence band and conduction band edges of Bi2WO6 NPs/rGO underwent a continuous increase in energy with the increasing weight ratio of graphene oxide. Quantum dots (QDs) offer versatile possibilities to harvest light energy for chemical transformations because of their quantum confinement effects, rich surface-binding properties, and intense absorption in the visible region. CdSe is a widely studied nanocrystal as a II−VI-type semiconductor; it has an optical window that can cover the whole visible spectrum by tuning the size of the crystal. Wu and co-workers reported in 2012 that the visible light irradiation of CdSe QDs in water resulted in the almost quantitative coupling of a variety of thiols to give disulfides with the concomitant release of molecular hydrogen, without any sacrificial reagents or externally added oxidants.576 Upon the addition of nickel(II) salt as a cocatalyst, the conversion of thiols and hydrogen evolution rate improved dramatically. It was suggested that photogenerated thiyl radicals bound on the QDs’ surfaces coupled to form disulfides before their diffusion into solution. To make use of a thiyl radical on the surface of the QDs before homocoupling, CdSe QDs capped with 3-mercaptopropionic acid (MPA) were admixed with benzylalcohol in water. The reaction provided a powerful method to achieve the selective oxidation of alcohols to aldehydes/ketones without oxidant under visible light irradiation (Scheme 129).577 The release of D2 was detected when the reaction was conducted in D2O even with an isotopically

Scheme 128. Bimetallic PI Catalysts for the Oxidation of Alcohols in Water

Electropositive platinum contributes to the coordination of alcohols. A nanocomposite of polymer and carbon black (PI/ CB-M) can increase the total surface area of the catalyst, enhancing its activity. PI/CB Au/Pd bimetallic catalyst has advantages over PI/CB Au because of its robustness and oxidation ability. Using this catalyst, tandem oxidation/ Horner−Wadsworth−Emmons olefination afforded α,β-unsaturated ester in water (Scheme 128).567 High activity toward aerobic glucose oxidation to gluconic acid was achieved by using a crown-jewel-structured Au/Pd nanocluster (CJ-Au/Pd NC).568 A galvanic replacement process allowed the successful replacement of the topmost Pd atoms by Au atoms. The high activity was ascribed to the presence of the negatively charged top Au atoms. Electron transfer from the anionic top Au atoms to O2 is thought to generate the active hydroperoxo-like species during the reaction. The same combination was also used in the basefree aerobic oxidation of 5-hydroxymethyl-furfural to 2,5furandicarboxylic acid in water.569 Au−Pd alloy NPs supported on carbon nanotubes (CNTs) were also effective. HT-supported NPs are also applicable to bimetallic systems. Pd20Pt80-PVP/HT possessed the highest activity for aerobic oxidation of HMF toward FDCA production in water.570 The superiority of alkene epoxidation in water over that in other organic solvents was demonstrated when Cu−Ag core/ shell bimetallic NPs immobilized on yolk/shell Fe3O4@ chitosan-derived carbon NPs were used as a catalyst.571 Ag atoms can prevent the oxidation of the Cu core, and, indeed, 717


Chemical Reviews

Review

Scheme 129. Photocatalyzed Oxidation of Benzylic Alcohols

Scheme 130. Four Classes of Surfactants

unlabeled substrate, which suggested that the hydrogen abstracted from benzyl alcohol rapidly equilibrated with water. 3.4.9. Chiral Metal NPs. Catalysis on a chirally modified metal surface commenced with the enantioselective hydrogenation of ethyl pyruvate over cinchona alkaloid-modified platinum catalysts (Pt/Al2O3).578 Enantioselective hydrogenation of 2-oxoglutaric acid on cinchonidine-modified Pt/Al2O3 catalysts gave 68% ee of 5-oxo-tetrahydrofuran-2-carboxylic acid.579 The reaction was also investigated in water by using a surfactant-stabilized platinum(0) colloidal suspension modified by cinchonidine as a chiral inducer, resulting in up to 55% ee.580 When N-methylephedrium (S)-lactate was used, enantioselectivity increased slightly, up to 13%.581 When phenylcinnamic acid amine salt was used as a substrate, Pd/C modified by cinchonidine gave 33% ee of the desired product.582 Little progress has been made to date because of the many difficulties associated with the solubility of organic molecules, as well as the weakness of noncovalent interactions between substrates, chiral ligands, and metal ions under competitive polar conditions. The development of chirally modified water-insoluble metal salt surfaces by using a strongly absorbing chiral modifier has attracted considerable attention; this approach is expected to extend to chiral metal NP catalysts even in water in the near future.

environment consisting of both reactants and catalysts. Considering the local congestion of reactants inside the micelles, it is not surprising that unique phenomena such as rate accelerations have been observed in many micellemediated reactions. Even during the past 10 years, the utilization of additional surfactants has played a dominant role in dispersing organic reagents and helping to facilitate organic reactions in water. 4.1.1. Anionic Surfactants. Anionic surfactants, such as sodium dodecyl sulfate (SDS or SLS), have been extensively employed to generate micelle structures in water. The micelles of anionic surfactants possess a high interfacial surface area, on which organic reactions take place. In many metal-catalyzed reactions in water in particular, anionic surfactants can contribute to the binding of metal species into the hydrophobic core of the micelles through ionic interactions. Various cationic surfactants, such as cetyltrimethylammonium bromide (CTAB), cannot be used for many transition-metal-mediated reactions in water because of the coordination of anionic halogen atoms to the metal center, leading to the formation of inactive species. Therefore, it is natural that anionic surfactants have flourished as a top choice for promoting organic reactions in pure water. Surfactant-aided coupling reactions in water are an area in which anionic surfactants have had great significance. For example, Ruiz and co-workers demonstrated that in palladium(II)−hydrotalcite-catalyzed Suzuki cross-coupling reactions, the addition of SDS could promote the reaction to give the product in 51% yield, whereas other cationic/nonionic surfactants only promoted the reaction in low to moderate yield.583 Recently, Buchwald and co-workers also reported the utilization of octanoic acid/sodium octanoate as the surfactant for Lipshutz− Negishi cross-coupling reactions in water (Scheme 131).584 In the presence of 50 mol % octanoic acid as the surfactant, a hybrid VPhos-supported palladium precatalyst was shown to catalyze the coupling reactions of alkyl halides with aryl

4. SURFACTANT-BASED CATALYSTS Surfactants enable the formation of nanosized apolar aggregates in bulk water, in which both the catalyst and the reagents are solubilized because of subtle intermolecular interactions such as hydrophobic effects and ion pairing, which operate at higher concentration. The use of surfactants has been a straightforward approach to achieve emulsion to solubilize hydrophobic substrates in water. New surfactants are continuously being designed and developed that can be used to engineer micelles that can compete with traditional catalysis in organic solvents. 4.1. Surfactant-Aided Catalysts

The solubility issue associated with most organic compounds in water has always been an obstacle when conducting organic reactions in water, despite the advantages and unique proporties that water offers. Water/organic cosolvent systems can overcome the solubility issue, although several characteristics of water as a solvent are lost. On the other hand, cell membranes separate the condensed cell environment from the outer biological fluid in biomolecules. Studies on phospholipid bilayer structures have led to the development of surfactants that form micelles in water. Four classes of surfactants have been developed over the past 50 years: anionic, cationic, amphoteric, and nonionic (Scheme 130). All surfactants possess an amphiphilic structure in which a hydrophilic group interacts with water molecules in an aqueous medium (red), while the other side holds a lipophilic group to exclude water molecules (blue). The self-assembly of surfactants occurs in water to form micelles when the amount of surfactant is above a critical micelle concentration (cmc). The hydrophobic interior of micelles affords a condensed

Scheme 131. Octanoic Acid-Aided Lipshutz−Negishi CrossCoupling Reactions in Water

718


Chemical Reviews

Review

Astruc and co-worker also demonstrated and summarized the effect of surfactants on palladium NP catalysis for carbon− carbon cross-coupling reactions in water.589 In a similar manner, anionic surfactants have been found to be useful for Lewis acid-catalyzed reactions in water. In 1997, Kobayashi’s group reported SDS-aided Lewis acid-catalyzed Mukaiyama aldol reactions in water (Table 4).590,591 In the

electrophiles in good yield. Interestingly, when 50 mol % SDS was employed as the surfactant, the reaction did not proceed at all. Anionic surfactants have also been revealed to have some interesting effects on reactions mediated by platinum and palladium catalysts in water. For example, in the platinum(II)catalyzed asymmetric Baeyer−Villiger oxidation reaction of 4tert-butyl-cyclohexanone reported by Strukul and co-workers, a significant improvement in enantioselectivity was observed when switching the solvent system from dichloromethane to an SDS/H2O system.585 The authors proposed that the precise control of enantioselectivity observed in the SDS/H2O system could be attributed to attractive and repulsive interactions caused by the well-ordered nanoenvironments inside the micelles. Other anionic surfactants, such as sodium dodecylbenzenesulfonate (SDBS) and dodecanesulfonic acid sodium salt, promoted the reactions to afford the products in better yield but with lower enantioselectivity as compared to SDS. On the other hand, in a report of the platinum(II)−diphosphinamine-catalyzed hydration of alkynes in water, Wass and coworkers discovered that the employment of SDS as a surfactant afforded the product in the best yield (Scheme 132).585,586 The

Table 4. Sc(OTf)3-Catalyzed Mukaiyama Aldol Reactions in Pure Water

surfactant

time (h)

yield (%)

none SDS Triton X-100 CTAB

4 4 60 4

3 88 89 trace

presence of SDS, Sc(OTf)3 can catalyze the reaction to give the desired product in moderate yield in pure water, while the reaction proceeded sluggishly and only 3% yield of product was obtained without SDS. Although nonionic surfactants, such as Triton X-100, could promote the reactions with similar yield, a reduced reaction rate was observed. CTAB failed to promote the reaction. Moreover, in the asymmetric ring-opening reactions of mesoepoxides with aromatic amines catalyzed by Bi(OTf)3 in pure water, the choice of anionic surfactants was found to be crucial for achieving smooth reactions with good enantioselectivity (Scheme 134).592,593 The employment of SDS afforded the

Scheme 132. Surfactant Screening for the Hydration Reaction of 1-Octyne with Platinum Catalyst in Water

utilization of other surfactants such as zwitterionic and nonionic (Triton X-100) surfactants only gave the products in inferior yield. It is noteworthy that the reaction only proceeded in homogeneous H2O/acetone or H2O/dioxane. Recently, Kobayashi and co-workers discovered the unique nature of palladium(II) catalysis for the 1,4-addition of indoles to enones with the aid of an anionic surfactant and an additive (Scheme 133).587,588 Interestingly, the palladium(II) catalyst did not respond to commonly recognized phosphine-based ligands but rather to chiral 2,2′-bipyridine. It is also noteworthy that only anionic surfactants could promote the reactions in good yield with high enantioselectivity. Neither cationic (CTAB) nor nonionic (e.g., Triton X-114, TPGS-750-M) surfactants promoted the reaction.

Scheme 134. Bi(OTf)3-Catalyzed Ring-Opening Reactions in the Presence of SDBS as a Surfactant in Water

desired product with good enantioselectivity but in low yield. It was found that SDBS was the most efficient anionic surfactant, affording the product in 80% yield with 88% ee. The use of

Scheme 133. Effects of Surfactants on the Chiral Pd(II)-Catalyzed 1,4-Addition Reaction of Indoles in Water

719


Chemical Reviews

Review

4.1.2. Cationic Surfactants. Unlike anionic surfactants, the effect of cationic surfactants on organic reactions in water is less clear. Nevertheless, cationic surfactants, such as tetraalkyl ammonium salts, do possess some unique properties. Jeffery was a pioneer in this area, and demonstrated that the use of tetrabutylammonium chloride (TBAC) can significantly accelerate the Heck-type reactions of phenyl iodide and methyl acrylate.597 The reaction yield increased from 5% to 98% yield when 1 equiv of TBAC was introduced into the system. Tetrabutylammonium bromide (TBAB) exhibited a similar tendency, whereas simple metal salts, such as LiCl and KCl, did not improve the reaction yield significantly. Recently, Singh et al. screened several types of cationic quaternary ammonium surfactants for the Claisen−Schmidt condensation reaction in water (Scheme 138).598 The employ-

Aerosol OT (sodium dioctyl sulfosuccinate) led to the corresponding β-amino alcohols, which were obtained in 65% yield with 87% ee. Other surfactants, such as CTAB or Triton X-100, did not afford any product. Water was confirmed to be the best solvent. Indeed, Bi(OTf)3-catalyzed ring-opening reactions proceeded sluggishly in organic solvents, with only moderate enantioselectivity. Later, Liu and co-workers reported the InBr3-mediated synthesis of 4-aminocyclopentenones through a 4π conrotatory electrocyclization in water with the aid of SDBS (Scheme 135).594 In the absence of SDBS, the reaction did not proceed. Scheme 135. SDBS-Aided InBr3-Mediated Synthesis of 4Aminocyclopentenones in Water

Scheme 138. DTAB-Aided Claisen−Schmidt Condensation Reaction in Water

Recently, Nakamura and co-workers also reported the use of a chiral bis(imidazoline)-copper(I) catalyst in water (Scheme 136).595 With the aid of SDS in water, the catalyst promoted ment of dodecyltrimethylammonium bromide (DTAB) as a surfactant afforded the desired products with the best results (up to 94% yield). The authors also investigated the reusability of aqueous micellar media. Ding, Peng and co-workers also established a highly efficient FeCl3-catalyzed tandem reaction of 2-iodoanilines with isothiocyanates for the synthesis of 2-aminobenzothiazoles aided by octadecyltrimethylammonium chloride (OTAC or PTC-4) in water (Scheme 139).599 A wide range of substrate

Scheme 136. Surfactant Screening for Copper(I)-Catalyzed Enantioselective Three-Component Reactions

Scheme 139. FeCl3-Catalyzed Tandem Synthesis of 2Aminobenzothiazoles in Water with PTC-4 as the Surfactant the direct enantioselective three-component synthesis of optically active propargylamines in excellent yield with high enantioselectivity. It was revealed that only SDS was effective for achieving a smooth reaction. Surfactant-free conditions or the use of CTAB did not afford any product. Low yield was observed when Triton X-100 was utilized as the surfactant. Very recently, Ollevier and co-workers also reported that in the presence of SDS, iron(III) sulfate could catalyze the rearrangement of 2-alkyl-3-aryloxaziridines in water to afford the desired N-alkylbenzamides in excellent yield (Scheme 137).596 The reaction only afforded the products in low yield

generality was accomplished. The easy separation of products from the reaction mixture as well as straightforward catalyst recovery and reuse are other advantages of this protocol. In 2014, Chen, Qiu and co-workers reported a CTABboosted cascade reaction between 2-haloaryltriazenes and sodium azide in water and in the presence of CuI as a catalyst.600 CTAB, as a cationic surfactant, was the only surfactant that could boost the reaction to afford the desired product in improved yield. Other surfactants, such as SDS and Macrogol 400, resulted in lower yield. 4.1.3. Nonionic Surfactants. Nonionic surfactants are well-known as inexpensive commodity chemicals that can enhance the solubility of hydrophobic compounds in water. The most common nonionic surfactants are those based on ethylene oxide, referred to as ethoxylated surfactants, and can be roughly distinguished as (1) alcohol ethoxylates (e.g., Brij); (2) alkyl phenol ethoxylates (e.g., Triton); (3) fatty acid ethoxylates; (4) monoalkaolamide ethoxylates; (5) sorbitan

Scheme 137. Fe(III)-Catalyzed Synthesis of NAlkylbenzamides in the Presence of SDS

without SDS, even at raised temperatures. The authors also compared the atom economy and the generated waste to those reported previously. The authors concluded that the new overall approach, starting from N-alkylamines and benzaldehydes, appeared to be greener and more cost-effective. 720


Chemical Reviews

Review

Scheme 140. Brij 30-Aided Cross-Couplings between Alkyl and Aryl Bromides by Using Palladium Catalyst in Water

ester ethoxylates (e.g., Tweens, Spans); (6) fatty amine ethoxylates; and (7) ethylene oxide−propylene oxide copolymers. The critical micelle concentration (cmc) of nonionic surfactants is about 2 orders of magnitude lower than that of the corresponding anionic surfactants with the same alkyl chain length. Among the nonionic surfactants, Brij and Triton are most widely employed to disperse organic compounds in water. By using water−surfactant media, the platinum-catalyzed asymmetric epoxidation reaction of terminal alkenes with hydrogen peroxide has been achieved by Strukul and co-workers.601 Triton X-114 or Triton X-100 was essential for the reaction to proceed smoothly with high enantioselectivity. Neither cationic surfactant (CTAB) nor anionic surfactant (SDS) could promote the reaction. Furthermore, Lipshutz and co-workers reported palladium-catalyzed reductive cross-coupling reactions in water with the aid of Brij 30 (polyethylene glycol monododecyl ether) as a surfactant (Scheme 140).602 The smooth reaction arose from the fact that Brij 30 affords the largest micelles, up to 110 nm (Brij 35, 15 nm; Triton X-100, 10 nm; TPGS, 13 nm), leading to more extensive buffering and stabilization of the water-sensitive RZnX intermediate. Likewise, Ren and co-workers very recently reported the Tween 20-aided regioselective Ullmann reaction of indazoles with aryl iodides in water.603 The aqueous protocol facilitated the Ullmann reaction at a mild temperature (60 °C) within a short reaction time (2 h). A broad substrate scope (up to 25 examples) was demonstrated, and good isolated yields were obtained with high regioselectivity. The use of other nonionic amphiphilic reagents, such as Kolliphor EL, which is a well-established drug emulsifier, has also been explored, and recently was confirmed to be suitable for dispersing organic compounds and for mediating organic reactions in water. Kolliphor EL was found to assemble into nanomicelles with oxygen-free cores. Thus, Kolliphor EL and its analogue could potentially be the most suitable surfactants for mediating reactions that require deoxygenated environments. Indeed, it was demonstrated that Kolliphor EL could mediate palladium-catalyzed micellar cross-coupling reactions in water smoothly even under an air atmosphere (Table 5).604 When TPGS-750-M or Triton-X was employed as a surfactant, a significant decrease in yield was observed when the atmosphere was switched from N2 to air. Lipshutz and co-workers assumed that the nonpolar (interior) portions of micelles in water may serve to some extent as the reaction “solvent”. Therefore, their structure is as important in this context as the choice of solvent is in any traditional organic reaction. Hence, they introduced the concept of “designer” surfactants (Scheme 141), wherein the composition and resulting size and shape of these micelles in water could be manipulated. To date, three generations of designer surfactants have been developed by Lipshutz and coworkers.

Table 5. Coupling Reactions between 3-Bromoisoquinoline and 3-Thiopheneboronic Acid in Water with Different Surfactants

entry

surfactant

atmosphere

time (h)

yield (%)

1 2 3

Kolliphor EL TPGS-750-M TPGS-750-M

air N2 air

1 2 2

90 69 95

Scheme 141. Three Generations of “Designer” Surfactants

The first-generation designer surfactant, polyoxyethanyl αtocopheryl sebaccate (PTS), was developed in 2008, when the authors first applied the vitamin E-based amphiphile to ruthenium-catalyzed olefin cross-metathesis reactions in water.605 Since then, the use of PTS as a surfactant has greatly extended the possibilities of organic reactions in water, including Heck couplings, Suzuki−Miyaura cross-couplings, etc. Details of the applications and characteristics of PTS and its derivatives have been well summarized.606 In 2011, the authors developed the second-generation designer surfactant, TPGS-750-M, which is composed of racemic α-tocopherol, MPEG-750, and succinic acid.607 Far larger micelles were generated in water with the TPGS analogue than with PTS. Interestingly, despite the similarity in the structural makeup of the TPGS analogue and PTS, the size and the nature of the micelle particles formed in water could be significantly varied. Indeed, it was confirmed through dynamic light scattering (DLS) and cryogenic transmission electron microscopy (cryo-TEM) analyses that TPGS-1000 forms spherical micelles with uniform diameters. Meanwhile, PTS was found to be composed of two types of micelle 721


Chemical Reviews

Review

particles: 8−10 nm spheres and rod-like particles with highly variable length. Notably, TPGS-750-M afforded an even higher percentage of larger rod-like particles in water. Various reactions have been studied with TPGS. It is also noteworthy that the recycling of TPGS-750-M was realized through simple in-flask extraction after the reactions. In metathesis reactions, up to eight instances of recycling were tested, and, in all cases, high conversion was retained. TPGS-750-M has served as a successful aid in organic reactions in water, including coppercatalyzed conjugate addition to enones,608 Stille couplings,609 Suzuki−Miyaura couplings involving widely utilized N-methylimidodiacetic (MIDA) boronates,610 chemoselective reductions of nitroaromatics by zinc,611 trifluoromethylation of heterocycles,612 copper-catalyzed hydrophosphinations of styrenes,613 gold-catalyzed dehydrative cyclizations614 and lactonization,615 dehalogenation of functionalized alkyl halides,616 and nucleophilic aromatic substitution reactions.617 It has also been noted that, in the presence of TPGS-750-M, ppm amounts of Pd NPs work well as catalysts for both selective nitro group reductions504 and Suzuki−Miyaura couplings in water (vide supra).490 A tandem deprotection/coupling sequence was reported for solution-phase peptide synthesis in water with an aid of TPGS-750-M.618 In 2014, the third-generation designer surfactant was developed: Nok.619 Nok employed β-sitosterol as the interior component, and was, therefore, much less expensive than the second-generation amphiphile TPGS-750-M, which was based on expensive vitamin E. In many cases, Nok exhibited reactivities similar to those achieved by TPGS-750-M. In some examples, such as palladium-mediated reductions of aryl bromides, the use of Nok enabled the highest levels of conversion.620 Similarly, Tan very recently discovered that the sequential regioselective C−H functionalization of thiophenes could be achieved in water in the presence of Nok as the surfactant (Scheme 142).621 Interestingly, water was identified

developed C4-Azo-PEG surfactant can organize and disorganize in aqueous solution under UV irradiation. Irradiation at 365 nm in water can transform the trans C4-Azo-PEG into the cis form, which possesses a higher cmc (8 μM) than that of the trans form (4.1 μM). Heating or irradiation at 254 nm can convert the cis form back into the trans form. Therefore, when conducting the reaction in 6 μM at 70 °C or under irradiation at 254 nm, micelles form in solution, and the reaction proceeds smoothly to afford the desired products in good yield. By irradiating the solution at 365 nm after the reaction, cis C4-AzoPEG generates, with a collapse of micelle structure, enabling much easier extraction of the products from an aqueous phase. Such photochromic properties could not only enhance the reactivity of the reaction but also allow better extraction of the products and improved recyclability. Interestingly, Tomaselli, Sfrazzetto and co-workers reported a bifunctional surfactant that can not only solubilize the organic reactants into water, but also work as a cocatalyst to achieve a smooth reaction (Scheme 144).625 The authors revealed that

Scheme 142. Nok-Aided Sequential Regioselective C−H Functionalization of Thiophenes in Water

Scheme 144. Enantioselective Epoxidation of Alkenes in Water in the Presence of AOE-14

as the optimal solvent that could limit the decomposition of the substrates and products. This was the first reported perfluorotoluimide-directed C−H functionalization in water. Very recently, Lipshutz and co-workers also demonstrated Suzuki−Miyaura cross-coupling reactions mediated by ppm levels of palladium with HandaPhos as the ligand (vide supra).489 Moro and co-workers reported the copper(II)catalyzed hydroboration of propargyl-functionalized alkynes in water.622 In both cases, Nok was confirmed to be essential for achieving smooth reactions in water. Recently, the use of HandaPhos-gold complex enabled several cycloisomerization reactions of allenic substrates at 0.1 mol % catalyst loading in the presence of Nok.623 Len and co-workers demonstrated a photochromic surfactant that, in combination with palladium catalysts, can mediate the Tsuji−Trost reaction in water (Scheme 143).624 Their

the (salen) manganese(III) complex could catalyze the enantioselective epoxidation of nonfunctionalized alkenes in the presence of diethyltetradecylamine N-oxide (AOE-14). The authors noted that, as the surfactant, AOE-14 could bind the manganese(III) center of the chiral catalyst, improving the catalyst stability, the reaction rate, and the enantioselectivity. The past 20 years have witnessed great success in utilizing such designer surfactants and other nonionic surfactants, as well as cationic/anionic surfactants, for organic reactions in water. These represent a straightforward approach to bring reactants into contact with catalysts in pure water. These surfactants have paved the way for the use of water as an alternative solvent for organic reactions, even with water-sensitive reactants and/or catalysts.

Scheme 143. Pd-Catalyzed Tsuji−Trost Reactions in Water in the Presence of a Photochromic Surfactant

722


Chemical Reviews

Review

4.2. Surfactant-Combined Catalysts

reactants in the micelle emulsions, leading to unique reactivities and/or selectivities. Subsequently, various LASCs were tested in Mukaiyama aldol reactions and Diels−Alder reactions in water.627 Whereas sodium-, manganese-, and cobalt-derived LASCs exhibited almost no catalytic activity, other LASCs could afford the products in moderate to good yield. In the initial stages of research, copper and silver-based LASCs were found to give the highest reaction rates, whereas scandium and ytterbium-based LASCs exhibited the most effective results when considering the yield at the final stage of the reactions. On one hand, because metal cations with higher charges form salts of low cation-to-anion ratios and thereby attenuate the headgroup repulsion of the anionic surfactant, the packing of these metal head-groups becomes tighter. Thus, it is reasonable to assume that such tighter packing would reduce the chance for the aldehyde to coordinate to the metal cations, resulting in lower catalytic activity of scandium and ytterbium as compared to copper or silver. On the other hand, an increased amount of anionic surfactant could suppress the excessive hydrolysis of silyl enolate in water, providing overall higher yield at the end stage of the reactions. Further studies have revealed that the use of Brønsted acids can sometimes dramatically accelerate LASC-mediated aldol and allylation reactions in water. In particular, the addition of HCl enhanced the catalytic activity of Sc(OSO3C12H25)3 or Sc(OSO2C12H25)3 in Mukaiyama aldol reactions with various substrates.628 The extraordinary activity of scandium-derived LASCs has attracted Kobayashi’s group to extend their possibilities. The chain length effects of scandium-based LASCs, as well as the categories of LASCs, were systematically examined through Mukaiyama aldol reactions in water (Table 6).629 Interestingly,

Surfactants have frequently been employed to perform reactions in water. When surfactants are combined, a hydrophobic environment is created in water, which thereby leads to a partially increased concentration of reactants and to a higher reaction rate. However, the direct employment of surfactants, especially ionic surfactants, in water is not always practical for catalytic reactions. The existence of metal cations in surfactants (e.g., Na+ in SDS) may affect the formation of the metal−ligand complex, while halide anions (e.g., Br− in CTAB) could result in deactivation of the active metal species, such as platinum or rhodium, because of their strong covalent coordination ability. In addition, water can alter the activity or enantioselectivity by interrupting the ionic interactions and hydrogen bonds that are critical for stabilizing the transition states of the reactions. Thus, special designs may be required to perform reactions in water. 4.2.1. Lewis Acid−Surfactant Combined Catalysts. Lewis acid catalysts have been widely employed to activate reactants and/or reagents. Despite the discovery of watercompatible Lewis acid catalysts, problems remained, such as the insufficient dispersion of organic reactants. As a result, low yield due to aggregations as well as undesired reaction pathways were often observed. Under these circumstances, the dissolved Lewis acids, such as metal triflates and metal perchlorates, are shut out from the hydrophobic micelle interiors because of their excellent solubility and hydrophilicity. To overcome these problems, a new type of catalyst, the Lewis acid−surfactant combined catalyst (LASC), was developed. LASC has anionic surfactant parts and the corresponding cationic Lewis acid part in one molecule. The strong electrostatic interaction allows the hydrophilic metal cations to stay in the vicinity of micelles, and hence affords a more efficient reaction environment. LASC systems have been used to achieve great success in water chemistry. The first example of LASC for organic reactions can be traced back to 1998, when Kobayashi and co-workers reported the preparation of scandium tris(dodecyl sulfate) [STDS, Sc(DS)3 (DSOSO3C12H25)] and its successful application in Mukaiyama aldol reactions (Scheme 145).626 The employment

Table 6. Mukaiyama Aldol Reactions Catalyzed by Sc-LASCs in Water

Scheme 145. First Example of a LASC-Mediated Organic Reaction in Water

entry

LASC

yield (%)

1 2 3 4 5 6

Sc(OSO3C12H25)3 Sc(OSO2C10H21)3 Sc(OSO2C11H23)3 Sc(OSO2C12H25)3 Sc(OSO2C13H27)3 Sc(OSO2C14H29)3

92 60 68 83 76 19

Sc(OSO2C12H25)3 catalyzed aldol reactions to afford the product in the best yield, whereas scandium-based LASCs with either longer or shorter alkyl chains gave inferior yields. In general, OSO3-type scandium-based LASCs afforded better results than those of OSO2-type scandium-based LASCs in Mukaiyama aldol reactions, three-component Mannich-type reactions, and the allylation of tetraalkyltin. The colloidal particles of LASCs in water were characterized through light microscopy and dynamic light scattering (DLS), TEM, and AFM analyses. Subsequently, scandium-based LASCs were found to be applicable for various reactions in water, including the synthesis of α-amino phosphonates,630 Michael reactions of β-ketoesters with enones,631 Friedel−Crafts-type conjugate addition of

of Sc(DS)3 enabled the precise construction of a reaction center exclusively in water, and significantly broadened the substrate scope in the Mukaiyama aldol reaction. In particular, the Mukaiyama aldol reaction of benzaldehyde and 3pentanone-derived silyl enol ether was found to proceed 5 × 103 times faster in water than in dichloromethane. It is noteworthy that Sc(DS)3 can mediate the reactions to afford the products in higher yield and with higher enantioselectivity than Sc(OTf)3+SDS. The superior results have been ascribed to the microhydrophobic compartments generated in the aqueous phase. Such a structure can not only overcome the problem of miscibility between organic reactants and the catalyst-containing aqueous phase, but also accumulate the 723


Chemical Reviews

Review

indoles, 632 enantioselective ring-opening of meso-epoxides,633−635 hydroxymethylation with aqueous formaldehyde,636 and Nazarov-type reactions.637 Sc(DS)3 was also found to be suitable for the Friedländer synthesis of quinolines in water.638 In particular, scandium-catalyzed hydroxymethylation reactions, the first example in pure water, enabled the direct use of aqueous HCHO solution (Scheme 146). This approach

Table 7. Iron(III)-Catalyst Screening for the Synthesis of a Chromeno[4,3-b]chromene Derivative

Scheme 146. Sc(OSO2C11H23)3-Catalyzed Hydroxymethylation with Aqueous Formaldehyde in Water

entry

Fe(III) catalyst

solvent

1 2 3 4

FeCl3 FeCl3 FeCl3 + SDS Fe(DS)3

DCM H2O H2O H2O

the key to high yield. Indeed, the simple combination of FeCl3 and SDS only afforded the product in moderate yield. Only 25% yield was observed when DCM was employed as the solvent. Fe(DS)3 could be easily recovered and reused after the reaction through a simple wash with diethyl ether. A surfactant−iron(III) complex, Fe2O(DS)4, was found to be suitable for the oxidation of aryl alkanes with aqueous TBHP as an oxidant in water (Scheme 148).643 Micelle formation was the key to achieving high yield.

avoided the use of either toxic HCHO gas or polyacetal, and thus was much more environmentally friendly than the traditional solutions. Notably, in all examples, water was identified as a required solvent for the reactions to proceed with good enantioselectivities. Other than scandium(III), LASCs derived from iron(II), copper(II), and zinc(II) were also found to be suitable for aldol-type reactions in water. For instance, Kobayashi and coworkers revealed that asymmetric Mukaiyama aldol reactions can proceed well with catalysis by Cu(DS)2 and bis(oxaline) ligand.639 In Mannich reactions, Cu(DS)2 also exhibited better yields than Sc(DS)3, with wider substrate generality, including heteroaromatic, α,β-unsaturated, and aliphatic aldehydes.629 Recently, Ollevier and co-workers also reported Fe(DS)2mediated asymmetric Mukaiyama aldol reactions in water.640 It is noteworthy that in the asymmetric ring-opening of meso-epoxide and indole, opposite enantiomers were observed after switching the catalyst from Sc(OSO2C11H23)3 to either Cu(OSO2C11H23)2 or Zn(OSO2C11H23)2 under the same conditions (Scheme 147).641 The inversion of enantioselectiv-

Scheme 148. Fe2O(DS)4-Mediated Oxidation of Aryl Alkanes in Water

The LASCs of traditional Lewis acids, such as aluminum(III) and zirconium(IV), were also discovered to work well in water, despite the fact that their chloride salts are vulnerable to humidity. Al(DS)3 was found to be suitable for converting epoxides into thiiranes or amino alcohols at room temperature in water.644 Zr(DS)4 was found to be adaptable for epoxide ring-opening reactions,645 Michael reactions,646 the synthesis of quinolines647 and quinoxaline derivatives,648 and the synthesis of bis-indolyl and tris-indolylmethanes.649 For the zirconium(IV)-catalyzed diversity-oriented synthesis of quinazoline derivatives in water, Zr(DS)4 has been identified as a highly efficient, reusable catalyst (Scheme 149).648 Other zirconium(IV) salts, including homogeneous Zr(NO3)4 and heterogeneous ZrOCl2, catalyzed the reactions with only low to moderate yield.

Scheme 147. LASC-Catalyzed Asymmetric Ring-Opening Reactions of meso-Epoxides in Water

Scheme 149. Zr(IV)-Catalyzed Synthesis of Quinazoline Derivatives in Water

ity could be explained by the catalysts’ crystal structures. In all asymmetric openings of meso-epoxides, the reaction proceeded faster in water than in DCM. Iron(III)−surfactant combined catalysts are another unique species that can be used in water. It has been revealed that Fe(DS)3 as a LASC can promote the one-pot synthesis of chromeno[4,3-b]chromene derivatives in water (Table 7).642 The integration of iron(III) as a Lewis acid and the surfactant is

Very recently, Chow, Gong and co-workers reported the synthesis of a photocontrollable and highly recyclable catalyst, ZrOPPAZOSO3H, through the immobilization of 4-[4-(6phosphonic acid hexanoxyl)phenylazo]benzenesulfonic acid on zirconium phosphonate (Scheme 150).650 This catalyst was characterized by Fourier transform infrared spectroscopy, scanning electron microscopy, X-ray powder diffraction, 724


Chemical Reviews

Review

Scheme 150. ZrOPPAZOSO3H-Catalyzed Mannich Reaction

Scheme 151. DBSA-Mediated Synthesis of trans-3-Alkenyl Indazoles from Triazenylaryl Allylic Alcohols in Water

nitrogen adsorption−desorption analyses, and UV−vis analyses. The catalytic activity of ZrOPPAZOSO3H was investigated in the one-pot, three-component Mannich-type reaction of benzaldehyde, aniline, and cyclohexanone in water at room temperature, and gave excellent yields. Interestingly, the catalytic activity could be regulated by photoirradiation. Several supported LASCs have also been developed. Kobayashi and co-workers reported the first example of a polymer-supported Lewis acid catalyst by changing the hydrophobic surfactant part of a LASC to polymer chains with “spacers” composed of alkyl aromatic moieties.651 This polymer-supported catalyst not only exhibited superior reactivity in water over organic solvents, but also possessed advantages such as simple procedures and easy recovery and reuse. In 2011, Wang et al. synthesized a Brønsted−Lewis− surfactant combined heteropolyacid, Cr[(OSO3C 12 H25 )H2PW12O40]3, and applied this heterogeneous catalyst to the conversion of cellulose into 5-hydroxymethylfurfural in one pot.652 The conversion was up to 77.1% with 52.7% yield within 2 h at 150 °C. Good catalyst stability and easy recyclability were also confirmed. 4.2.2. Brønsted Acid−Surfactant Combined Catalysts (BASCs). Most of the Brønsted acid catalysts, unlike many traditional Lewis acid catalysts, are stable toward water and oxygen, and therefore have been intensively studied as watercompatible catalysts. Simple sulfuric acids such as DBSA were found to be excellent surfactant-type Brønsted acid catalysts in water for various reactions, including dehydration, nucleophilic substitution, and multicomponent reactions. In particular, the discovery that DBSA was effective in promoting the dehydration reaction in water significantly deepened our understanding of the characteristics of micelles in water and expanded the possibilities for organic reactions in water. Kobayashi and coworkers systematically investigated DBSA-mediated dehydration reactions in water, including esterification, etherification, thioetherification, and dithioacetalization. The synthesis of trans-3-alkenyl indazoles from triazenylaryl allylic alcohols in water is an advanced application of DBSA that exploits its dehydration ability. Thus, 20 mol % DBSA mediated the reaction to give the desired cyclized product in up to 99% yield with wide substrate generality (Scheme 151).653 Other acids, such as HCl or TsOH, only afforded the product in low yield. DBSA was thought to activate the hydroxy group, leading to the formation of the carbocation intermediate, which undergoes an intramolecular SN2′-type reaction as the rate-determining step, thereby affording the desired products rapidly. Other surfactant-type sulfuric acids were also found to be suitable for organic reactions in water. Konwer and co-workers reported that simple dodecyl sulfonic acid (DSA) could catalyze the Biginelli reaction to give the desired product in high yield. Water was identified as the best solvent for achieving

a smooth reaction.654 Wang and co-workers reported the use of calix[n]arene sulfonic acids bearing pendant aliphatic chains. Calix[6]arene sulfonic acids, with an octyl chain, were found to be the best catalyst, mediating the allylic alkylation with allyl alcohols with up to 94% yield. Through simple extraction and centrifugation, the catalysts could be recovered and reused directly in the next cycle. Up to seven recycling runs were conducted, and the catalytic activity was found to remain at a high level.655 Cellulose sulfuric acid (CellSA) is another interesting category with excellent catalytic properties for organic reactions in water. For example, Kumar and co-workers reported the CellSA-catalyzed multicomponent one-pot reaction of naphthol, aromatic aldehyde, and urea/thiourea/amide in water, affording 1,2-dihydro-1-aryl-3H-naphth[1,2-e][1,3]oxazin-3one and amidoalkyl naphthol derivatives as the desired products in excellent yields. 656 Catalyst recycling was conducted for four runs, and reactivity was maintained at a high level. FT-IR analysis confirmed that the catalyst structure was unchanged before and after the reaction. Other macromolecules, such as PEG and polystyrene, can be combined with sulfuric acid to form BASCs. For example, Shekouhy reported that sulfuric acid-modified PEG-6000 (PEG-OSO3H) is an efficient BASC for the one-pot, threecomponent synthesis of α-aminonitriles in water.657 4.2.3. Surfactant-Integrated Ligands for Metal Catalysts. Another approach is to impart surfactant-type properties to metal catalysts by synthesizing anionic tenside phosphine ligands. An interesting feature of such amphiphilic ligands is that they can produce a high concentration of catalytic active species inside the hydrophobic core of the micelles formed in the aqueous media. The integration of PEG with bipyridine ligand represents one such strategy, providing water-compatible palladium catalysts for Heck reactions in water. It is also noteworthy that the employment of amphiphilic alkylpolyoxyethylene aminodipyridyl ligand allows product/catalyst separation at room temperature without extraction with organic solvent.658 By using the same strategy, Lipshutz and co-workers attached PQS onto the Grubbs−Hoveyda metathesis catalyst.659,660 The PQS-integrated ruthenium catalyst could afford micelle structures in which the ring-closing metathesis of water-insoluble dienic substrates occurred. It is also noteworthy that the catalyst can be recycled continuously without reaction workup (Scheme 152). In 2012, the same group integrated PQS onto the BINAP ligand, which, in combination with rhodium catalysts, could promote the asymmetric conjugate additions of arylboronic acids to enones in water in excellent yield with high enantioselectivity.661 The water-soluble surfactant-combined rhodium catalyst could also be recycled without removal from the reaction flask. In 2009, Sómeril, Matt and co-workers reported the synthesis of a calix[4]arene-diphosphite combined ligand (Scheme 725


Chemical Reviews

Review

rhodium-catalyzed asymmetric transfer hydrogenation of ketones in water (Scheme 154).664 Typically, in the reduction

Scheme 152. PQS-Integrated Grubbs Catalyst for RCM Reactions in Pure Water

Scheme 154. Asymmetric Transfer Hydrogenation by a Surfactant-Type Rh Catalyst in Water

153).662 When chelated with [Rh(acac)(CO)2], the combined rhodium catalyst facilitated olefin hydroformylation reactions in

of octan-2-one, the new system afforded the product in 94% yield with 84% ee, whereas employing a ligand without the surfactant part only gave the product in 15% yield with 35% ee. The surfactant-combined system was found to be applicable to a broad range of aliphatic ketones, especially those bearing functional groups that might afford key intermediates of bioactive compounds and natural products. The same group designed and synthesized a series of amphiphilic ligands that were suitable for the rhodiumcatalyzed asymmetric transfer hydrogenation of a broad range of long-chained aliphatic ketoesters in neat water.665 Quantitative conversion with excellent enantioselectivity (up to 99% ee) was observed for α-, β-, γ-, δ-, and ε-ketoesters as well as for α- and β-acyloxyketones using a chiral surfactanttype Rh precatalyst. The authors proposed that the CH/π interaction and the strong hydrophobic interaction of long aliphatic chains between the catalyst and the substrate in the metallomicelle core were the key to the high reactivities observed in water. Indeed, the reactivity and enantioselectivity were found to be dependent on not only the temperature, the pH, and the volume of water, but also the alkyl chain length of the aliphatic ketones and ketoesters as well as the surfactant length on the ligands. In 2014, Nome and co-workers developed zwitterionicsurfactant-stabilized palladium NPs for the hydrogen transfer reductive amination of benzaldehydes in water.666 The catalyst not only exhibited superior activity over the common Pd/C catalyst, but the catalyst loading could also be reduced to 0.054 mol %, affording a TON of up to 1722 h−1. 4.2.4. Surfactant-Combined Nonmetal Catalysts. The past 20 years have seen a large number of nonmetal catalysts become available for a wide range of organic reactions. However, there has been limited success in employing nonmetal catalysts in pure water. Indeed, the majority of these catalysts have required mixed aqueous organic solvent to dissolve the insoluble reactants. Several reports of the successful utilization of nonmetal catalysts in water actually employed a large excess of water-soluble ketones such as acetone, resulting in a somewhat wet organic system. The development of nonmetal catalysts that can function in pure water is a true challenge, and special designs for nonmetal catalysts are required to perform asymmetric reactions in water. The development of surfactant-type nonmetal catalysts emerged as one of the solutions. These compounds both promote the reactions as a catalyst and solubilize the organic substrates as a surfactant, simultaneously.

Scheme 153. Rhodium-Catalyzed Asymmetric Hydroformylation of Norbornene

water. The introduction of the surfactant part had a direct impact on both catalyst activity and the regioselectivity of the reaction. Moreover, the nature of the lipophilic tails of the surfactants can significantly influence the catalytic activity. The addition of n-butyl-substituted calix[4]arene was revealed to form micelle structures in water, and afforded the best result in the asymmetric hydroformylation of norbornene. Indeed, shorter-alkyl-chain-substituted calixarene (e.g., R = methyl) did not form micelles, whereas longer-alkyl-chain-substituted calixarene (e.g., R = dodecyl) afforded unimolecular micellar structures in water. This result is consistent with experimental observations. In 2011, Palmans, Meijer and co-workers reported the synthesis, analysis, and application of a water-soluble segmented terpolymer in which a helical structure in the apolar core was created around a ruthenium-based catalyst.663 The supramolecular chirality of this catalytic system was ascribed to the self-assembly of benzene-1,3,5-tricarboxamide side chains. The polymers exhibited a two-state folding process and showed excellent activity for transfer hydrogenation with a combination of Ru catalysts in water. On the other hand, a simple integration of a chiral diamine structure with surfactant alkyl chains was revealed by Deng and co-workers to possess high performance as a ligand for the 726


Chemical Reviews

Review

In the early years of this research, a simple integration of alkyl chains with enamine-based nonmetal catalysts allowed organic reactions to proceed in pure water. For example, Takabe, Barbas III and co-workers demonstrated a diamine/ TFA bifunctional catalyst-mediated direct asymmetric aldol reaction that could be performed in water without the addition of organic solvents.667 On the other hand, inspired by the success of LASCs, Luo, Cheng and co-workers developed a surfactant-type asymmetric nonmetal catalyst (STAO) through the combination of chiral imidazolium cations and surfactant anions (Scheme 155). The STAO enabled smooth asymmetric Michael addition to nitroalkenes in pure water in high yield, with excellent diastereo- and enantioselectivity.668

Scheme 157. Nitro-Michael Reactions Catalyzed by Different Generations of Dendritic Nonmetal Catalysts in Water

Scheme 155. Asymmetric Michael Addition to Nitroalkenes in Water Catalyzed by STAO

In 2015, Nezhad and co-worker also developed polyethylene glycol-bonded 1,8-diazabicyclo[5.4.0]undec-7-ene (PEG-DBU) as a new surfactant-combined base catalyst.673 This new catalyst was successfully applied in the syntheses of novel 8-substituted pyrido[2,3-d]pyrimidine-6-carbonitrile derivatives through onepot, multicomponent reactions in water using nucleosides (adenosine, guanosine, and cytidine) as starting materials. Polypeptide-based surfactant molecules have been used as astmmetric catalysts. Wennemers and co-workers showed a tripeptide-based amphiphile was effective for asymmetric conjugate addition of aldehydes with nitroolefins in water (Scheme 158).674 The surfactant moiety is crucial, because the

Further studies by Li and co-workers suggested that the assembly of the amphiphilic chiral nonmetal catalyst that has been originally developed by Hayashi and co-workers in 2006669 is an indispensable requirement for enhancing the activity and stereoselectivity of aldol reactions (Scheme 156).670 Indeed, whereas the reaction proceed smoothly in water, the use of neat conditions afforded almost none of the desired product. Scheme 156. Asymmetric Direct Aldol Reactions Catalyzed by an Amphiphilic Nonmetal Catalyst

Scheme 158. Lipopeptide-Based Nonmetal Catalysts for Conjugate Addition Reactions in Water

Chow and co-worker also prepared three series of chiral amphiphilic G1−G3 dendritic nonmetal catalysts containing an optically active polar proline-derived core and one, two, or three nonpolar hydrocarbon dendrons (Scheme 157).671 The application of these dendritic nonmetal catalysts to asymmetric aldol and nitro-Michael additions in water revealed that increasing the size and number of dendrons led to higher product enantioselectivity because of their better steric stereodifferentiation properties. Notably, the highest generation G3 dendritic nonmetal catalysts could be recovered by partition between MeOH and heptane, and reused in the same or different reactions with little loss of reactivity or stereoselectivity. In another example, by covalently combining their welldeveloped designer surfactant part with a proline structure, Lipshutz and co-workers developed a new type of nonmetal catalyst that was soluble in water and could catalyze asymmetric aldol reactions through spontaneous nanomicelle formation in good yield and with high enantioselectivity. It is also noteworthy that, upon the completion of reactions, typical extractive workup was not required, and in-flask recycling of the catalyst could be easily performed.672

parent tripeptide showed remarkably reduced activity and selectivity in water. Alves and co-workers also developed chiral nonmetal catalysts based on lipopeptide micelles for aldol reactions in water.675 Various instrumental analyses, including fluorescence assays, in situ small-angle X-ray scattering (SAXS), molecular dynamics simulations, and cryo-TEM image analysis, determined the critical aggregation concentration and the diameter of the micelles. The application of lipopeptide catalysts in the direct aldol reaction between cyclohexanone and p-nitrobenzaldehyde showed improved activity, enabled by the self-association of the amphiphilic nonmetal catalyst. The surfactant-integrated TEMPO-mediated aerobic oxidation of activated alcohols to aldehydes in water is another interesting example, reported by Rodionov and co-workers (Scheme 159).676 Because the solubility of TEMPO is moderate in water/benzyl alcohol mixtures, the aerobic oxidation of the alcohol is relatively slow in the absence of surfactants, leading to the noncompletion of reactions. TEMPO was thus functionalized with surfactant alkyl chains so as to improve the result. Indeed, just 5 mol % of the surfactantfunctionalized TEMPO was sufficient to catalyze the oxidation of benzyl alcohol to completion, with a significantly lower 727


Chemical Reviews

Review

ORCID

Scheme 159. Aerobic Oxidations of Benzyl Alcohol Catalyzed by a Surfactant-Functionalized TEMPO System

Shu̅ Kobayashi: 0000-0002-8235-4368 Notes

The authors declare no competing financial interest. Biographies Taku Kitanosono earned his B.Sc. and M.Sc. degrees from the University of Tokyo under the supervision of Prof. S. Kobayashi. After receiving his Ph.D. degree in 2015, he was appointed assistant professor in the Department of Chemistry at the University of Tokyo. His research interests include the unusual application of catalysis in aqueous environments, such as chiral heterogeneous catalysis, micellar catalysis, and artificial metalloenzymes.

loading of DMAP (20 mol %) and CuSO4 (2 mol %) under ambient conditions in water. It is remarkable that the development of surfactant-combined catalysts not only extended the possibility of using water as an alternative solvent for organic reactions, but also led to the discovery of many unique reactivities and selectivities that occur exclusively in water. Overall, the utilization of surfactants will further broaden the possibilities of water as a reaction medium.

Koichiro Masuda received his B.Sc. in chemistry and M.Sc. in chemistry from the University of Tokyo, Japan, in 2010 and 2012, respectively. He then received his Ph.D. in Science in 2015 under the supervision of Prof. Shu̅ Kobayashi at the same institute. He developed a new quantitative technique to analyze heterogeneous reaction mixture in real time by using mass spectrometry. He currently is working with Prof. Shu̅ Kobayashi as a postdoctoral research fellow to investigate novel synthetic chemistry using continuous flow technique for the facile preparation of complex molecules.

5. SUMMARY AND OUTLOOK Water has long been accepted as an exemplary green solvent. Skepticism regarding the practical use of water as a reaction medium in diverse organic synthesis reactions has been gradually mitigated by the ever-evolving techniques associated with water-compatible catalysts, emulsification, and water disinfection. In addition to advantages of water from the point of view of green chemistry, sustainability, safety, and economic concerns, synthetic methodologies in water can utilize the unique properties exerted by water. The inherently low solubility of oxygen gas in water can facilitate operations with air-sensitive transition-metal catalysis in open air. The flourishing of synthetic methodologies that can be used in water over the past decade has thus been reviewed. Water-soluble compounds such as formaldehyde, carbohydrates, and peptides can be reacted without laborious derivatization under the action of a number of homo- and heterogeneous catalysts. After separation from water-insoluble organic compounds, catalysts usually show a satisfactory level of recyclability without loss of catalytic activity. The integration of emulsifying capacity into catalysts or substrates serves as a strategy to overcome solubility issues. Upon the compaction of essential functions into one structure, the catalytic activity can deteriorate without ingenious orchestration of the multiple functions. Besides conventional water-compatible catalysts for the conversion of water-soluble substrates or surfactant-combined catalysts, functional macromolecules with molecular weights of hundreds or thousands have emerged as water-compatible catalysts that can offer microenvironments encapsulating hydrophobic substrates, and that more closely mimic enzymatic architectures. It is thought that the compartmentalization of such catalysts leads to the creation of a secluded catalytic center, which enables broad compatibility even with natural enzymes, along with enhanced reactivity and selectivity. Unanswered research questions regarding synthetic methodologies in water, and the mushrooming number of catalytic systems that work in water, suggest that the field is still a diamond in the rough. This overview is intended to illustrate the tremendous potential of water as a reaction medium for both established and entirely new catalytic transformations, streamlining synthetic sequences, and advancing progress toward sustainable chemistry.

Xu Pengyu received his B.Sc. in chemistry and M.Sc. in chemistry from the University of Tokyo, Japan, in 2012 and 2014, respectively. He then received his Ph.D. in 2017 under the supervision of Prof. Dr. Shu̅ Kobayashi at the same institute. Shu̅ Kobayashi studied at the University of Tokyo, receiving his Ph.D. in 1988 working under the direction of Professor T. Mukaiyama. Following an initial period as assistant professor, he was promoted to lecturer and then associate professor at the Science University of Tokyo (SUT). In 1998, he moved to the Graduate School of Pharmaceutical Sciences, the University of Tokyo, as full professor. In 2007, he was appointed to his current position as professor of organic chemistry in the Department of Chemistry, Faculty of Science, The University of Tokyo. He has held various visiting professorships, including the Universite Louis Pasteur, Strasbourg (1993), Kyoto University (1995), Nijmegen University (1996), Philipps-University of Marburg (1997), and Paris-Sud (2010). Professor Kobayashi has wideranging research interests that include the development of new synthetic methods and novel catalysts, organic reactions in water, solid-phase synthesis, total synthesis of biologically interesting compounds, and organometallic chemistry.

ACKNOWLEDGMENTS This work was supported by a Grant-in-Aid for Specially Promoted Research (JSPS KAKENHI 15H05698), the Global COE Program, the University of Tokyo, MEXT, Japan, and the Japan Science Technology Agency (JST). P.X. thanks the JSPS for a Research Fellowship for Young Scientists. REFERENCES (1) Welton, T. Solvents and sustainable chemistry. Proc. R. Soc. London, Ser. A 2015, 471, 20150502. (2) Lipshutz, B. H.; Gallou, F.; Handa, S. Evolution of Solvents in Organic Chemistry. ACS Sustainable Chem. Eng. 2016, 4, 5838−5849. (3) Kerton, F. M.; Marriot, R. Alternative Solvents for Green Chemistry, 2nd ed.; RSC Green Chemistry Book Series; RSC Publishing: Cambridge, UK, 2013; pp 1−350. (4) Clark, J. H.; Tavener, S. Alternative Solvents: Shades of Green. Org. Process Res. Dev. 2007, 11, 149−155.

AUTHOR INFORMATION Corresponding Author

*E-mail: [email protected]. 728


Chemical Reviews

Review

Importance From Research and Industrial Point of View. J. Catal. 2014, 402860402860. (28) Jimeno, C. Water in Asymmetric Organocatalytic Systems: a Global Perspective. Org. Biomol. Chem. 2016, 14, 6147−6164. (29) Guo, W.; Wu, B.; Zhou, X.; Chen, P.; Wang, X.; Zhou, Y.-G.; Liu, Y.; Li, C. Formal Asymmetric Catalytic Thiolation with a Bifunctional Catalyst at a Water-Oil Interface: Synthesis of Benzyl Thiols. Angew. Chem., Int. Ed. 2015, 54, 4522−4526. (30) Sim, J. H.; Song, C. E. Water-Enabled Catalytic Asymmetric Michael Reactions of Unreactive Nitroalkenes: One-Pot Synthesis of Chiral GABA-Analogs with All-Carbon Quaternary Stereogenic Centers. Angew. Chem., Int. Ed. 2017, 56, 1835−1839. (31) Font, Daniel; Bastero, Amaia; Sayalero, Sonia; Ciril Jimeno, A.; Pericàs, Miquel A Highly Enantioselective A-Aminoxylation of Aldehydes and Ketones with a Polymer-Supported Organocatalyst. Org. Lett. 2007, 9, 1943−1946. (32) Alza, E.; Cambeiro, X. C.; Jimeno, C.; Pericàs, M. A. Highly Enantioselective Michael Additions in Water Catalyzed by a PSSupported Pyrrolidine. Org. Lett. 2007, 9, 3717−3720. (33) Font, D.; Jimeno, C.; Pericàs, M. A. Polystyrene-Supported Hydroxyproline: an Insoluble, Recyclable Organocatalyst for the Asymmetric Aldol Reaction in Water. Org. Lett. 2006, 8, 4653−4655. (34) Font, D.; Sayalero, S.; Bastero, A.; Jimeno, C.; Pericàs, M. A. Toward an Artificial Aldolase. Org. Lett. 2008, 10, 337−340. (35) Gruttadauria, M.; Giacalone, F.; Marculescu, A. M.; Noto, R. Novel Prolinamide-Supported Polystyrene as Highly Stereoselective and Recyclable Organocatalyst for the Aldol Reaction. Adv. Synth. Catal. 2008, 350, 1397−1405. (36) Llanes, P.; Sayalero, S.; Rodríguez Escrich, C.; Pericàs, M. A. Asymmetric Cross- and Self-Aldol Reactions of Aldehydes in Water with a Polystyrene-Supported Triazolylproline Organocatalyst. Green Chem. 2016, 18, 3507−3512. (37) Huerta, E.; Stals, P. J. M.; Meijer, E. W.; Palmans, A. R. A. Consequences of Folding a Water-Soluble Polymer Around an Organocatalyst. Angew. Chem., Int. Ed. 2013, 52, 2906−2910. (38) Wang, B. G.; Ma, B. C.; Wang, Q.; Wang, W. Superparamagnetic Nanoparticle-Supported (S)-Diphenyl- Prolinol Trimethylsilyl Ether as a Recyclable Catalyst for Asymmetric Michael Addition in Water. Adv. Synth. Catal. 2010, 352, 2923−2928. (39) Khalafi-Nezhad, A.; Nourisefat, M.; Panahi, F. L-ProlineModified Magnetic Nanoparticles (LPMNP): a Novel Magnetically Separable Organocatalyst. RSC Adv. 2014, 4, 22497−22500. (40) Khalafi-Nezhad, A.; Nourisefat, M.; Panahi, F. L-Cysteine Functionalized Magnetic Nanoparticles (LCMNP): a Novel Magnetically Separable Organocatalyst for One-Pot Synthesis of 2-Amino-4HChromene-3-Carbonitriles in Water. Org. Biomol. Chem. 2015, 13, 7772−7779. (41) Monge-Marcet, A.; Cattoën, X.; Alonso, D. A.; Nájera, C.; Man, M. W. C.; Pleixats, R. Recyclable Silica-Supported Prolinamide Organocatalysts for Direct Asymmetric Aldol Reaction in Water. Green Chem. 2012, 14, 1601−1610. (42) Khalafi-Nezhad, A.; Shahidzadeh, E. S.; Sarikhani, S.; Panahi, F. A New Silica-Supported Organocatalyst Based on L-Proline: an Efficient Heterogeneous Catalyst for One-Pot Synthesis of Spiroindolones in Water. J. Mol. Catal. A: Chem. 2013, 379, 1−8. (43) Gao, J.; Liu, J.; Bai, S.; Wang, P.; Zhong, H.; Yang, Q.; Li, C. The Nanocomposites of SO3H-Hollow-Nanosphere and Chiral Amine for Asymmetric Aldol Reaction. J. Mater. Chem. 2009, 19, 8580−8590. (44) Gao, J.; Liu, J.; Tang, J.; Jiang, D.; Li, B.; Yang, Q. Chirally Functionalized Hollow Nanospheres Containing L-Prolinamide: Synthesis and Asymmetric Catalysis. Chem. - Eur. J. 2010, 16, 7852−7858. (45) Zhao, W.; Qu, C.; Yang, L.; Cui, Y. Chitosan-Supported Cinchonine as an Efficient Organocatalyst for Direct Asymmetric Aldol Reaction in Water. Chin. J. Catal. 2015, 36, 367−371. (46) Ricci, A.; Bernardi, L.; Gioia, C.; Vierucci, S.; Robitzer, M.; Quignard, F. Chitosan Aerogel: a Recyclable, Heterogeneous Organocatalyst for the Asymmetric Direct Aldol Reaction in Water. Chem. Commun. 2010, 46, 6288−6290.

(5) Sheldon, R. A. Green solvents for sustainable organic synthesis: state of the art. Green Chem. 2005, 7, 267−278. (6) Sherman, J.; Chin, B.; Huibers, P. D.; Garcia-Valls, R.; Hatton, T. A. Solvent replacement for green processing. Environ. Health Perspect. 1998, 106, 253−271. (7) Filly, A.; Fabiano-Tixier, A. S.; Louis, C.; Fernandez, X.; Chemat, F. Water as a green solvent combined with different techniques for extraction of essential oil from lavender flowers. C. R. Chim. 2016, 19, 707−717. (8) Seow, T. W.; Lim, C. K.; Nor, M. H. M.; Mubarak, M. F. M.; Lam, C. Y.; Yahya, A.; Ibrahim, Z. Review on Wastewater Treatment Technologies. Int. J. Appl. Environ. Sci. 2016, 11, 111−126. (9) Dhote, J.; Ingole, S.; Chavhan, A. Review On Waste water Treatment Technologies. Int. J. Eng. Res. Technol. 2012, 1, 1−10. (10) Martinez-Huitle, C. A.; Ferro, S. Electrochemical oxidation of organic pollutants for the wastewater treatment: direct and indirect processes. Chem. Soc. Rev. 2006, 35, 1324−1340. (11) Rideout, D. C.; Breslow, R. Hydrophobic acceleration of DielsAlder reactions. J. Am. Chem. Soc. 1980, 102, 7816−7817. (12) Diels, O.; Alder, K. Synthesen in der hydroaromatischen Reihe. XII. Mitteilung. Justus Liebigs Ann. Chem. 1931, 490, 243−257. (13) Breslow, R.; Guo, T. Diels-Alder reactions in nonaqueous polar solvents. Kinetic effects of chaotropic and antichaotropic agents and of β-βcyclodextrin. J. Am. Chem. Soc. 1988, 110, 5613−5617. (14) Breslow, R.; Rizzo, C. J. Chaotropic salt effects in a hydrophobically accelerated Diels-Alder reaction. J. Am. Chem. Soc. 1991, 113, 4340−4341. (15) Narayan, S.; Muldoon, J.; Finn, M. G.; Fokin, V. V.; Kolb, H. C.; Sharpless, K. B. ″On water″: unique reactivity of organic compounds in aqueous suspension. Angew. Chem., Int. Ed. 2005, 44, 3275−3279. (16) Chanda, A.; Fokin, V. V. Organic Synthesis “On Water. Chem. Rev. 2009, 109, 725−748. (17) Du, Q.; Superfine, R.; Freysz, E.; Shen, Y. R. Vibrational spectroscopy of water at the vapor/water interface. Phys. Rev. Lett. 1993, 70, 2313−2316. (18) Butler, R. N.; Coyne, A. G. Understanding “On-Water” Catalysis of Organic Reactions. Effects of H+ and Li+ Ions in the Aqueous Phase and Nonreacting Competitor H-Bond Acceptors in the Organic Phase: On H2O versus on D2O for Huisgen Cycloadditions. J. Org. Chem. 2015, 80, 1809−1817. (19) Zuo, Y.-J.; Qu, J. How Does Aqueous Solubility of Organic Reactant Affect a Water-Promoted Reaction? J. Org. Chem. 2014, 79, 6832−6839. (20) Karhan, K.; Khaliullin, R. Z.; Kühne, T. D. On the role of interfacial hydrogen bonds in “on-water” catalysis. J. Chem. Phys. 2014, 141, 22D528. (21) Devi, R. V.; Garande, A. M.; Maity, D. K.; Bhate, P. M. A Serendipitous Synthesis of 11a-Hydroxy-11,11a-dihydrobenzo[e]indeno[2,1-b][1,4]diazepine-10,12-dione Derivatives by Condensation of 2-Aminobenzamides with Ninhydrin in Water. J. Org. Chem. 2016, 81, 1689−1695. (22) Naidu, B. N.; Li, W.; Sorenson, M. E.; Connolly, T. P.; Wichtowski, J. A.; Zhang, Y.; Kim, O. K.; Matiskella, J. D.; Lam, K. S.; Bronson, J. J.; Ueda, Y. Organic reactions in frozen water: Michael addition of amines and thiols to the dehydroalanine side chain of nocathiacins. Tetrahedron Lett. 2004, 45, 1059−1063. (23) Zhang, F.-Z.; Tian, Y.; Li, G.-X.; Qu, J. Intramolecular Etherification and Polyene Cyclization of p-Activated Alcohols Promoted by Hot Water. J. Org. Chem. 2015, 80, 1107−1115. (24) Patrick, H. R.; Griffith, K.; Liotta, C. L.; Eckert, C. A. NearCritical Water: A Benign Medium for Catalytic Reactions. Ind. Eng. Chem. Res. 2001, 40, 6063−6067. (25) Savage, P. E. Heterogeneous catalysis in supercritical water. Catal. Today 2000, 62, 167−173. (26) Malek, B.; Fang, W.; Abramova, I.; Wakakaweka, N.; Ggigare, A. A.; Greer, A. Ene” Reactions of Singlet Oxygen at the Air-Water Interface. J. Org. Chem. 2016, 81, 6395−6401. (27) Shaikh, I. R. Organocatalysis: Key Trends in Green Synthetic Chemistry, Challenges, Scope Towards Heterogenization, and 729


Chemical Reviews

Review

(68) Koito, Y.; Nakajima, K.; Hasegawa, R.; Kobayashi, H.; Kitano, M.; Hara, M. Lewis Acid Properties of Some Metal Salts for Lactic Acid Formation in Water: 31P NMR Spectroscopy with Trimethylphosphine Oxide as a Molecular Probe. Catal. Today 2014, 226, 198− 203. (69) Koito, Y.; Nakajima, K.; Kobayashi, H.; Hasegawa, R.; Kitano, M.; Hara, M. Slow Reactant-Water Exchange and High Catalytic Performance of Water-Tolerant Lewis Acids. Chem. - Eur. J. 2014, 20, 8068−8075. (70) Biaggi, C.; Benaglia, M.; Puglisi, A. Catalysis in Water: Synthesis of β-Amino Amides by Sc(III) Promoted Condensation of Silylketene Pyridylthioacetal and Imines. J. Organomet. Chem. 2007, 692, 5795− 5798. (71) Kitanosono, T.; Kobayashi, S. Toward Chemistry-Based Design of the Simplest Metalloenzyme-Like Catalyst That Works Efficiently in Water. Chem. - Asian J. 2015, 10, 133−138. (72) Ueno, M.; Kitanosono, T.; Sakai, M.; Kobayashi, S. Chiral Sccatalyzed Asymmetric Michael Reactions of Thiols with Enones in Water. Org. Biomol. Chem. 2011, 9, 3619−3621. (73) Kitanosono, T.; Sakai, M.; Ueno, M.; Kobayashi, S. Chiral-Sc catalyzed asymmetric Michael addition/protonation of thiols with enones in water. Org. Biomol. Chem. 2012, 10, 7134−7147. (74) Ni, J.; Sohma, Y.; Kanai, M. Scandium(III) Triflate-Promoted Serine/threonine-Selective Peptide Bond Cleavage. Chem. Commun. 2017, 53, 3311−3314. (75) Kobayashi, S. Lanthanide Trifluoromethanesulfonates as Stable Lewis Acids in Aqueous Media. Yb(OTf)3 Catalyzed Hydroxymethylation Reaction of Silyl Enol Ethers with Commercial Formaldehyde Solution. Chem. Lett. 1991, 20, 2187−2190. (76) Firouzabadi, H.; Iranpoor, N.; Kazemi, S.; Ghaderi, A.; Garzan, A. Highly Efficient Halogenation of Organic Compounds with Halides Catalyzed by Cerium(III) Chloride Heptahydrate Using Hydrogen Peroxide as the Terminal Oxidant in Water. Adv. Synth. Catal. 2009, 351, 1925−1932. (77) Procopio, A.; Gaspari, M.; Nardi, M.; Oliverio, M.; Rosati, O. Highly Efficient and Versatile Chemoselective Addition of Amines to Epoxides in Water Catalyzed by Erbium(III) Triflate. Tetrahedron Lett. 2008, 49, 2289−2293. (78) Zhao, H.; Li, H.; Yue, Y.; Qin, X.; Sheng, Z.; Cui, J.; Su, S.; Song, X.; Yan, H.; Zhong, R. Synlett 2012, 23, 1990−1994. (79) Aplander, K.; Ding, R.; Lindström, U. M.; Wennerberg, J.; Schultz, S. α-Amino Acid Induced Rate Acceleration in Aqueous Biphasic Lewis Acid Catalyzed Michael Addition Reactions. Angew. Chem., Int. Ed. 2007, 46, 4543−4546. (80) Zhao, G.; Tan, R.; Zhang, Y.; Luo, X.; Xing, C.; Yin, D. Cooperative chiral salen TiIV catalysts with built-in phase-transfer capability accelerate asymmetric sulfoxidation in water. RSC Adv. 2016, 6, 24704−24711. (81) Marui, K.; Higashiura, Y.; Kodama, S.; Hashidate, S.; Nomoto, A.; Yano, S.; Ueshima, M.; Ogawa, A. Vanadium-Catalyzed Green Oxidation of Benzylic Alcohols in Water under Air Atmosphere. Tetrahedron 2014, 70, 2431−2438. (82) Alagiri, K.; Kumara, G. S. R.; Prabhu, K. R. An Oxidative CrossDehydrogenative-Coupling Reaction in Water Using Molecular Oxygen as the Oxidant: Vanadium Catalyzed Indolation of Tetrahydroisoquinolines. Chem. Commun. 2011, 47, 11787−11789. (83) Sako, M.; Takizawa, S.; Yoshida, Y.; Sasai, H. Enantioselective and Aerobic Oxidative Coupling of 2-Naphthol Derivatives Using Chiral Dinuclear vanadium(V) Complex in Water. Tetrahedron: Asymmetry 2015, 26, 613−616. (84) Malkov, A. V.; Czemerys, L.; Malyshev, D. A. VanadiumCatalyzed Asymmetric Epoxidation of Allylic Alcohols in Water. J. Org. Chem. 2009, 74, 3350−3355. (85) Xu, X.; Hirao, T. Vanadium-Catalyzed Pinacol Coupling Reaction in Water. J. Org. Chem. 2005, 70, 8594−8596. (86) Ren, L.; Wang, L.; Lv, Y.; Shang, S.; Chen, B.; Gao, S. Synthesis of 6,7-Dihydro-5H-cyclopenta[b]pyridin-5-one Analogues through Manganese-Catalyzed Oxidation of the CH2 Adjacent to Pyridine Moiety in Water. Green Chem. 2015, 17, 2369−2372.

(47) Kong, Y.; Tan, R.; Zhao, L.; Yin, D. L-Proline supported on ionic liquid-modified magnetic nanoparticles as a highly efficient and reusable organocatalyst for direct asymmetric aldol reaction in water. Green Chem. 2013, 15, 2422−2433. (48) Xu, D.-Q.; Wu, J.; Luo, S.-P.; Zhang, J.-X.; Wu, J.-Y.; Du, X.-H.; Xu, Z.-Y. Fischer Indole Synthesis Catalyzed by Novel SO 3 HFunctionalized Ionic Liquids in Water. Green Chem. 2009, 11, 1239− 1246. (49) Rueping, M.; Theissmann, T. Asymmetric Brønsted Acid Catalysis in Aqueous Solution. Chem. Sci. 2010, 1, 473−476. (50) Sakakura, A.; Koshikari, Y.; Akakura, M.; Ishihara, K. Hydrophobic N,N-Diarylammonium Pyrosulfates as Dehydrative Condensation Catalysts under Aqueous Conditions. Org. Lett. 2012, 14, 30−33. (51) Stanley, N.; Bucataru, G.; Miao, Y.; Favrelle, A.; Bria, M.; Stoffelbach, F.; Woisel, P.; Zinck, P. Brønsted Acid-Catalyzed Polymerization of E-Caprolactone in Water: a Mild and Straightforward Route to Poly(E-Caprolactone)- Graft-Water-Soluble Polysaccharides. J. Polym. Sci., Part A: Polym. Chem. 2014, 52, 2139−2145. (52) Chen, C.; Zhu, X.; Wu, Y.; Sun, H.; Zhang, G.; Zhang, W.; Gao, Z. 5-Sulfosalicylic Acid Catalyzed Direct Mannich Reaction in Pure Water. J. Mol. Catal. A: Chem. 2014, 395, 124−127. (53) Rahman, M.; Ling, I.; Abdullah, N.; Hashim, R.; Hajra, A. Organocatalysis by P-Sulfonic Acid Calix [4] Arene: a Convenient and Efficient Route to 2, 3-Dihydroquinazolin-4 (1 H)-Ones in Water. RSC Adv. 2015, 5, 7755−7760. (54) Lin, Y.-M.; Lu, G.-P.; Wang, G.-X.; Yi, W.-B. Acid/PhosphideInduced Radical Route to Alkyl and Alkenyl Sulfides and Phosphonothioates From Sodium Arylsulfinates in Water. J. Org. Chem. 2017, 82, 382−389. (55) Takale, S.; Parab, S.; Phatangare, K.; Pisal, R.; Chaskar, A. IBX in Aqueous Medium: a Green Protocol for the Biginelli Reaction. Catal. Sci. Technol. 2011, 1, 1128−1132. (56) Bérubé, C.; Barbeau, X.; Lagüe, P.; Voyer, N. Revisiting the Juliá-Colonna Enantioselective Epoxidation: Supramolecular Catalysis in Water. Chem. Commun. 2017, 53, 5099. (57) Haino, T.; Rudkevich, D. M.; Rebek, J. Kinetically Stable Caviplexes in Water. J. Am. Chem. Soc. 1999, 121, 11253−11254. (58) Hooley, R. J.; Biros, S. M.; Rebek, J. A Deep, Water-Soluble Cavitand Acts as a Phase-Transfer Catalyst for Hydrophobic Species. Angew. Chem., Int. Ed. 2006, 45, 3517−3519. (59) Biros, S. M.; Rebek, J., Jr. Structure and Binding Properties of Water-Soluble Cavitands and Capsules. Chem. Soc. Rev. 2007, 36, 93− 104. (60) Hooley, R. J.; Rebek, J., Jr. Chemistry and Catalysis in Functional Cavitands. Chem. Biol. 2009, 16, 255−264. (61) Wu, N.-W.; Rebek, J., Jr. Cavitands as Chaperones for Monofunctional and Ring-Forming Reactions in Water. J. Am. Chem. Soc. 2016, 138, 7512−7515. (62) Long, B.; Ding, Z.; Wang, X. Carbon Nitride for the Selective Oxidation of Aromatic Alcohols in Water Under Visible Light. ChemSusChem 2013, 6, 2074−2078. (63) Lam, E.; Chong, J. H.; Majid, E.; Liu, Y.; Hrapovic, S.; Leung, A. C. W.; Luong, J. H. T. Carbocatalytic Dehydration of Xylose to Furfural in Water. Carbon 2012, 50, 1033−1043. (64) Guo, Y.; Li, W.; Yan, J.; Moosa, B.; Amad, M.; Werth, C. J.; Khashab, N. M. Fullerene-Catalyzed Reduction of Azo Derivatives in Water Under UV Irradiation. Chem. - Asian J. 2012, 7, 2842−2847. (65) Yang, F.; Chi, C.; Wang, C.; Wang, Y.; Li, Y. High Graphite N Content in Nitrogen-Doped Graphene as an Efficient Metal-Free Catalyst for Reduction of Nitroarenes in Water. Green Chem. 2016, 18, 4254−4262. (66) Wagner, A. J.; Zubarev, D. Y.; Aspuru-Guzik, A.; Blackmond, D. G. Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis. ACS Cent. Sci. 2017, 3, 322−328. (67) Kobayashi, S.; Nagayama, S.; Busujima, T. Lewis Acid Catalysts Stable in Water. Correlation between Catalytic Activity in Water and Hydrolysis Constants and Exchange Rate Constants for Substitution of Inner-Sphere Water Ligands. J. Am. Chem. Soc. 1998, 120, 8287−8288. 730


Chemical Reviews

Review

(87) Teo, Y.-C. Efficient Cross-Coupling Reactions of Nitrogen Nucleophiles with Aryl Halides in Water. Adv. Synth. Catal. 2009, 351, 720−724. (88) Wang, H.; Lorion, M. M.; Ackermann, L. Air-Stable Manganese(I)-Catalyzed C-H Activation for Decarboxylative C-H/ C-O Cleavages in Water. Angew. Chem., Int. Ed. 2017, 56, 6339. (89) Egami, H.; Katsuki, T. Fe(salan)-Catalyzed Asymmetric Oxidation of Sulfides with Hydrogen Peroxide in Water. J. Am. Chem. Soc. 2007, 129, 8940−8941. (90) Rezaeifard, A.; Jafarpour, M.; Naeimi, A.; Kaafi, S. A Novel Strategy for Clean and Selective Oxygenation of Hydrocarbons with nBu4NHSO5 in Neat Water Catalyzed by Recyclable Water-Insoluble Iron (III) Tetraphenylporphyrins. Catal. Commun. 2011, 12, 761−765. (91) Morandi, B.; Dolva, A.; Carreira, E. M. Iron-Catalyzed Cyclopropanation with Glycine Ethyl Ester Hydrochloride in Water. Org. Lett. 2012, 14, 2162−2163. (92) Sorokin, A. B.; Kudrik, E. V.; Bouchu, D. Bio-Inspired Oxidation of Methane in Water Catalyzed by N-Bridged Diiron Phthalocyanine Complex. Chem. Commun. 2008, 2562−2564. (93) Hu, X.; Wang, C.; Sun, Y.; Sun, H.; Li, H. Two Unexpected Roles of Water: Assisting and Preventing Functions in the Oxidation of Methane and Methanol Catalyzed by Porphyrin−Fe and Porphyrin−SH−Fe. J. Phys. Chem. B 2008, 112, 10684−10688. (94) Huang, Y.-T.; Lu, S.-Y.; Yi, C.-L.; Lee, C.-F. Iron-Catalyzed Synthesis of Thioesters from Thiols and Aldehydes in Water. J. Org. Chem. 2014, 79, 4561−4568. (95) Ren, Y.; Cheng, L.; Tian, X.; Zhao, S.; Wang, J.; Hou, C. IronCatalyzed Conversion of Unactivated Aryl Halides to Phenols in Water. Tetrahedron Lett. 2010, 51, 43−45. (96) Zhang, X.; Ye, D.; Sun, H.; Guo, D.; Wang, J.; Huang, H.; Zhang, X.; Jiang, H.; Liu, H. Microwave-Assisted Synthesis of Quinazolinone Derivatives by Efficient and Rapid Iron-Catalyzed Cyclization in Water. Green Chem. 2009, 11, 1881−1888. (97) Olson, M. E.; Carolan, J. P.; Chiodo, M. V.; Lazzara, P. R.; Mohan, R. S. Iron(III) Tosylate-Catalyzed Deprotection of Aromatic Acetals in Water. Tetrahedron Lett. 2010, 51, 3969−3971. (98) Sengoden, M.; Punniyamurthy, T. On Water”: Efficient IronCatalyzed Cycloaddition of Aziridines with Heterocumulenes. Angew. Chem., Int. Ed. 2013, 52, 572−575. (99) Trillo, P.; Baeza, A.; Nájera, C. Direct Nucleophilic Substitution of Free Allylic Alcohols in Water Catalyzed by FeCl3·6H2O: Which Is the Real Catalyst? ChemCatChem 2013, 5, 1538−1542. (100) Jamal, Z.; Teo, Y.-C. Cobalt-Catalyzed Direct Alkenylation of 2-Methylquinolines with Aldehydes via C(sp3)−H Functionalization in Water. Synlett 2014, 25, 2049−2053. (101) Teo, Y.-C.; Chua, G.-L. Cobalt-Catalyzed N-Arylation of Nitrogen Nucleophiles in Water. Chem. - Eur. J. 2009, 15, 3072−3075. (102) Tan, B. Y.-H.; Teo, Y.-C. Efficient Cobalt-Catalyzed C−N Cross-Coupling Reaction between Benzamide and Aryl Iodide in Water. Org. Biomol. Chem. 2014, 12, 7478−7481. (103) Lan, M.-T.; Wu, W.-Y.; Huang, S.-H.; Luo, K.-L.; Tsai, F.-Y. Reusable and Efficient CoCl2·6H2O/cationic 2,2′-Bipyridyl SystemCatalyzed S-Arylation of Aryl Halides with Thiols in Water under Air. RSC Adv. 2011, 1, 1751−1755. (104) Wu, C.-J.; Zhong, J.-J.; Meng, Q.-Y.; Lei, T.; Gao, X.-W.; Tung, C.-H.; Wu, L.-Z. Cobalt-Catalyzed Cross-Dehydrogenative Coupling Reaction in Water by Visible Light. Org. Lett. 2015, 17, 884−887. (105) Zhang, X.; Liu, H.; Hu, X.; Tang, G.; Zhu, J.; Zhao, Y. Ni(II)/ Zn Catalyzed Reductive Coupling of Aryl Halides with Diphenylphosphine Oxide in Water. Org. Lett. 2011, 13, 3478−3481. (106) Kim, W. G.; Kang, M. E.; Lee, J. B.; Jeon, M. H.; Lee, S.; Lee, J.; Choi, B.; Cal, P. M. S. D.; Kang, S.; Kee, J.-M.; Bernardes, G. J. L.; Rohde, J.-U.; Choe, W.; Hong, S. Y. Nickel-Catalyzed Azide-Alkyne Cylcoaddition To Access 1,5-Disubstituted 1,2,3-Triazoles in Air and Water. J. Am. Chem. Soc. 2017, 139, 12121−12124. (107) Bauke Albada, H.; Rosati, F.; Coquière, D.; Roelfes, G.; Liskamp, R. M. J. Enantioselective CuII-Catalyzed Diels-Alder and Michael Addition Reactions in Water Using Bio-Inspired Triazacyclophane-Based Ligands. Eur. J. Org. Chem. 2011, 1714−1720.

(108) Lai, G.; Guo, F.; Zheng, Y.; Fang, Y.; Song, H.; Xu, K.; Wang, S.; Zha, Z.; Wang, Z. Highly Enantioselective Henry Reactions in Water Catalyzed by a Copper Tertiary Amine Complex and Applied in the Synthesis of (S)-N-trans-Feruloyl Octopamine. Chem. - Eur. J. 2011, 17, 1114−1117. (109) Ma, Z.; Gurbanov, A. V.; Maharramov, A. M.; Guseinov, F. I.; Kopylovich, M. N.; Zubkov, F. I.; Mahmudov, K. T.; Pombeiro, A. J. L. Copper(II) Arylhydrazone Complexes as Catalysts for CH Activation in the Henry Reaction in Water. J. Mol. Catal. A: Chem. 2017, 426, 526−533. (110) Chen, Z.; Lin, L.; Wang, M.; Liu, X.; Feng, X. Asymmetric Synthesis of trans-β-Lactams by a Kinugasa Reaction on Water. Chem. Eur. J. 2013, 19, 7561−7567. (111) Barbero, N.; Carril, M.; SanMartin, R.; Domínguez, E. CopperCatalyzed Intramolecular N-Arylation of Ureas in Water: A Novel Entry to Benzoimidazolones. Tetrahedron 2008, 64, 7283−7288. (112) Joubert, N.; Baslé, E.; Vaultier, M.; Pucheault, M. Mild, BaseFree Copper-Catalyzed N-Arylations of Heterocycles Using Potassium Aryltrifluoroborates in Water under Air. Tetrahedron Lett. 2010, 51, 2994−2997. (113) Li, X.; Yang, D.; Jiang, Y.; Fu, H. Efficient Copper-Catalyzed N-Arylations of Nitrogen-Containing Heterocycles and Aliphatic Amines in Water. Green Chem. 2010, 12, 1097−1105. (114) Wu, Z.; Zhou, L.; Jiang, Z.; Wu, D.; Li, Z.; Zhou, X. SulfonatoCu(salen) Complex Catalyzed N-Arylation of Aliphatic Amines with Aryl Halides in Water. Eur. J. Org. Chem. 2010, 4971−4975. (115) Lv, R.; Wang, Y.; Zhou, C.; Li, L.; Wang, R. Efficient CopperCatalyzed Ullmann Reaction of Aryl Bromides with Imidazoles in Water Promoted by a pH-Responsive Ligand. ChemCatChem 2013, 5, 2978−2982. (116) Yu, L.; Zhou, X.; Wu, D.; Xiang, H. Synthesis of Phenazines by Cu-Catalyzed Homocoupling of 2-Halogen Anilines in Water. J. Organomet. Chem. 2012, 705, 75−78. (117) Meng, F.; Wang, C.; Xie, J.; Zhu, X.; Wan, Y. N2,N2′Disubstituted Oxalic Acid Bishydrazides: Novel Ligands for CopperCatalyzed C-N Coupling Reactions in Water. Appl. Organomet. Chem. 2011, 25, 341−347. (118) Geng, X.; Mao, S.; Chen, L.; Yu, J.; Han, J.; Hua, J.; Wang, L. Copper-Catalyzed Direct N-Arylation of N-Arylsulfonamides Using Diaryliodonium Salts in Water. Tetrahedron Lett. 2014, 55, 3856− 3859. (119) Nasrollahzadeh, M.; Ehsani, A.; Maham, M. Copper-Catalyzed N-Arylation of Sulfonamides with Boronic Acids in Water under Ligand-Free and Aerobic Conditions. Synlett 2014, 25, 505−508. (120) Yan, N.-N.; Wu, F.-T.; Zhang, J.; Wei, Q.-B.; Liu, P.; Xie, J.-W.; Dai, B. Efficient Copper Catalyzed C-N Coupling Reaction in Water by Using 2-Hydroxybenzohydrazides as Ligands. Asian J. Org. Chem. 2014, 3, 1159−1162. (121) Wang, Y.; Zhang, Y.; Yang, B.; Zhang, A.; Yao, Q. N-(1-Oxy-2Picolyl)oxalamic Acids as a New Type of O,O-Ligands for the CuCatalyzed N-Arylation of Azoles with Aryl Halides in Water or Organic Solvent. Org. Biomol. Chem. 2015, 13, 4101−4114. (122) Sharma, K. K.; Mandloi, M.; Rai, N.; Jain, R. Copper-Catalyzed N-(Hetero)arylation of Amino Acids in Water. RSC Adv. 2016, 6, 96762−96767. (123) Rout, L.; Saha, P.; Jammi, S.; Punniyamurthy, T. Efficient Copper(I)-Catalyzed C−S Cross Coupling of Thiols with Aryl Halides in Water. Eur. J. Org. Chem. 2008, 640−643. (124) Herrero, M. T.; SanMartin, R.; Domínguez, E. Copper(I)Catalyzed S-Arylation of Thiols with Activated Aryl Chlorides on Water. Tetrahedron 2009, 65, 1500−1503. (125) Ke, F.; Qu, Y.; Jiang, Z.; Li, Z.; Wu, D.; Zhou, X. An Efficient Copper-Catalyzed Carbon−Sulfur Bond Formation Protocol in Water. Org. Lett. 2011, 13, 454−457. (126) Zhao, N.; Liu, L.; Wang, F.; Li, J.; Zhang, W. Copper/ N,N,N′,N′ -Tetramethylethylenediamine-Catalyzed Synthesis of N -Substituted Benzoheterocycles via C-S Cross-Coupling at Ambient Temperature in Water. Adv. Synth. Catal. 2014, 356, 2575−2579. 731


Chemical Reviews

Review

Alcohol Catalyzed by the CuII−TEMPO Catalyst in Alkaline Water Solution. RSC Adv. 2015, 5, 83976−83984. (145) Matsushita, T.; Moriyama, Y.; Nagae, G.; Aburatani, H.; Okamoto, A. DNA-friendly Cu(II)/TEMPO-catalyzed 5-hydroxymethylcytosine-specific oxidation. Chem. Commun. 2017, 53, 5756. (146) Ito, H.; Yamanaka, H.; Tateiwa, J.; Hosomi, A. Boration of an α,β-Enone Using a Diboron Promoted by a copper(I)−phosphine Mixture Catalyst. Tetrahedron Lett. 2000, 41, 6821−6825. (147) Takahashi, K.; Takagi, J.; Ishiyama, T.; Miyaura, N. Synthesis of 1-Alkenylboronic Esters via Palladium-Catalyzed Cross-Coupling Reaction of Bis(pinacolato)diboron with 1-Alkenyl Halides and Triflates. Chem. Lett. 2000, 29, 126−127. (148) Takahashi, K.; Ishiyama, T.; Miyaura, N. A Borylcopper Species Generated from Bis(pinacolato)diboron and Its Additions to α,β-Unsaturated Carbonyl Compounds and Terminal Alkynes. J. Organomet. Chem. 2001, 625, 47−53. (149) Kobayashi, S.; Xu, P.; Endo, T.; Ueno, M.; Kitanosono, T. Chiral Copper(II)-Catalyzed Enantioselective Boron Conjugate Additions to α,β-Unsaturated Carbonyl Compounds in Water. Angew. Chem., Int. Ed. 2012, 51, 12763−12766. (150) Kitanosono, T.; Xu, P.; Kobayashi, S. Heterogeneous and Homogeneous Chiral Cu(ii) Catalysis in Water: Enantioselective Boron Conjugate Additions to Dienones and Dienoesters. Chem. Commun. 2013, 49, 8184−8186. (151) Kitanosono, T.; Xu, P.; Kobayashi, S. Heterogeneous versus Homogeneous Copper(II) Catalysis in Enantioselective ConjugateAddition Reactions of Boron in Water. Chem. - Asian J. 2014, 9, 179− 188. (152) Calderone, J. A.; Santos, W. L. Copper(II)-Catalyzed Silylation of Activated Alkynes in Water: Diastereodivergent Access to E- or Z.β-Silyl-α,β-Unsaturated Carbonyl and Carboxyl Compounds. Angew. Chem., Int. Ed. 2014, 53, 4154−4158. (153) Kitanosono, T.; Zhu, L.; Liu, C.; Xu, P.; Kobayashi, S. An Insoluble Copper(II) Acetylacetonate−Chiral Bipyridine Complex That Catalyzes Asymmetric Silyl Conjugate Addition in Water. J. Am. Chem. Soc. 2015, 137, 15422−15425. (154) Demir, A. S.; Emrullahoglu, M. Zinc Perchlorate Catalyzed One-Pot Amination−annulation of α-Cyanomethyl-β-Ketoesters in Water. Regioselective Synthesis of 2-Aminopyrrole-4-Carboxylates. Tetrahedron 2006, 62, 1452−1458. (155) Deng, T.; Cui, X.; Qi, Y.; Wang, Y.; Hou, X.; Zhu, Y. Conversion of Carbohydrates into 5-Hydroxymethylfurfural Catalyzed by ZnCl2 in Water. Chem. Commun. 2012, 48, 5494−5496. (156) Darbre, T.; Machuqueiro, M. Zn-Proline Catalyzed Direct Aldol Reaction in Aqueous Media. Chem. Commun. 2003, 1090−1091. (157) Fernandez-Lopez, R.; Kofoed, J.; Machuqueiro, M.; Darbre, T. A Selective Direct Aldol Reaction in Aqueous Media Catalyzed by Zinc-Proline. Eur. J. Org. Chem. 2005, 5268−5276. (158) Kofoed, J.; Machuqueiro, M.; Reymond, J.-L.; Darbre, T. Zinc−proline Catalyzed Pathway for the Formation of Sugars. Chem. Commun. 2004, 1540−1541. (159) Kofoed, J.; Darbre, T.; Reymond, J.-L. Dual Mechanism of Zinc-Proline Catalyzed Aldol Reactions in Water. Chem. Commun. 2006, 1482−1484. (160) Jantke, D.; Cokoja, M.; Drees, M.; Herrmann, W. A.; Kühn, F. E. Ruthenium-Catalyzed Hydrogenation of Oxygen-Functionalized Aromatic Compounds in Water. ChemCatChem 2013, 5, 3241−3248. (161) Cadierno, V.; Francos, J.; Gimeno, J. Ruthenium/TFACatalyzed Regioselective C-3-Alkylation of Indoles with Terminal Alkynes in Water: Efficient and Unprecedented Access to 3-(1Methylalkyl)-1H-Indoles. Chem. Commun. 2010, 46, 4175−4177. (162) Wu, X.; Wang, C.; Xiao, J. Asymmetric Transfer Hydrogenation in Water with Platinum Group Metal Catalysts. Platinum Met. Rev. 2010, 54, 3−19. (163) Kovács, G.; Ujaque, G.; Lledós, A.; Joó, F. The Role of Water in the Stereoselective Hydrogenation of 1,2-Diphenylacetylene Catalyzed by the Water-Soluble [{RuCl2(mtppms)2}2]. Eur. J. Inorg. Chem. 2007, 2879−2889.

(127) Kumar, A. V.; Reddy, V. P.; Reddy, C. S.; Rao, K. R. Potassium Selenocyanate as an Efficient Selenium Source in C−Se CrossCoupling Catalyzed by Copper Iodide in Water. Tetrahedron Lett. 2011, 52, 3978−3981. (128) Wang, D.; Kuang, D.; Zhang, F.; Tang, S.; Jiang, W. Triethanolamine as an Inexpensive and Efficient Ligand for CopperCatalyzed Hydroxylation of Aryl Halides in Water. Eur. J. Org. Chem. 2014, 315−318. (129) Jing, L.; Wei, J.; Zhou, L.; Huang, Z.; Li, Z.; Zhou, X. Lithium Pipecolinate as a Facile and Efficient Ligand for Copper-Catalyzed Hydroxylation of Aryl Halides in Water. Chem. Commun. 2010, 46, 4767. (130) Wu, T.-M.; Huang, S.-H.; Tsai, F.-Y. A Reusable CuSO4 · 5H2O/cationic 2,2′-Bipyridyl System Catalyzed Homocoupling of Terminal Alkynes in Water. Appl. Organomet. Chem. 2011, 25, 395− 399. (131) Guan, J. T.; Yu, G.-A.; Chen, L.; Qing Weng, T.; Yuan, J. J.; Liu, S. H. CuI/PPh3 -Catalyzed Sonogashira Coupling Reaction of Aryl Iodides with Terminal Alkynes in Water in the Absence of Palladium. Appl. Organomet. Chem. 2009, 23, 75−77. (132) Yang, D.; Li, B.; Yang, H.; Fu, H.; Hu, L. Efficient CopperCatalyzed Sonogashira Couplings of Aryl Halides with Terminal Alkynes in Water. Synlett 2011, 702−706. (133) Rostovtsev, V. V.; Green, L. G.; Fokin, V. V.; Sharpless, K. B. A Stepwise Huisgen Cycloaddition Process: Copper(I)-Catalyzed Regioselective “Ligation” of Azides and Terminal Alkynes. Angew. Chem., Int. Ed. 2002, 41, 2596−2599. (134) Tornøe, C. W.; Christensen, C.; Meldal, M. Peptidotriazoles on Solid Phase: [1,2,3]-Triazoles by Regiospecific Copper(I)Catalyzed 1,3-Dipolar Cycloadditions of Terminal Alkynes to Azides. J. Org. Chem. 2002, 67, 3057−3064. (135) Wang, F.; Fu, H.; Jiang, Y.; Zhao, Y. Copper-Catalyzed Cycloaddition of Sulfonyl Azides with Alkynes to Synthesize N -Sulfonyltriazoles “on Water” at Room Temperature. Adv. Synth. Catal. 2008, 350, 1830−1834. (136) Wang, F.; Fu, H.; Jiang, Y.; Zhao, Y. Quick and Highly Efficient Copper-Catalyzed Cycloaddition of Aliphatic and Aryl Azides with Terminal Alkynes “on Water. Green Chem. 2008, 10, 452−456. (137) Sharghi, H.; Hosseini-Sarvari, M.; Moeini, F.; Khalifeh, R.; Beni, A. S. One-Pot, Three-Component Synthesis of 1-(2-Hydroxyethyl)-1H −1,2,3-Triazole Derivatives by Copper-Catalyzed 1,3Dipolar Cycloaddition of 2-Azido Alcohols and Terminal Alkynes under Mild Conditions in Water. Helv. Chim. Acta 2010, 93, 435−449. (138) Ali, A. A.; Chetia, M.; Saikia, P. J.; Sarma, D. (DHQD)2PHAL Ligand-Accelerated Cu-Catalyzed Azide−alkyne Cycloaddition Reactions in Water at Room Temperature. RSC Adv. 2014, 4, 64388− 64392. (139) Zhou, C.; Zhang, J.; Liu, P.; Xie, J.; Dai, B. 2Pyrrolecarbaldiminato−Cu(II) Complex Catalyzed Three-Component 1,3-Dipolar Cycloaddition for 1,4-Disubstituted 1,2,3-Triazoles Synthesis in Water at Room Temperature. RSC Adv. 2015, 5, 6661−6665. (140) Ö zçubukçu, S.; Ozkal, E.; Jimeno, C.; Pericàs, M. A. A Highly Active Catalyst for Huisgen 1,3-Dipolar Cycloadditions Based on the Tris(triazolyl)methanol−Cu(I) Structure. Org. Lett. 2009, 11, 4680− 4683. (141) Liu, M.; Li, C.-J. Catalytic Fehling’s Reaction: An Efficient Aerobic Oxidation of Aldehyde Catalyzed by Copper in Water. Angew. Chem., Int. Ed. 2016, 55, 10806−10810. (142) Gao, J.; Ren, Z.-G.; Lang, J.-P. Oxidation of Benzyl Alcohols to Benzaldehydes in Water Catalyzed by a Cu(II) Complex with a Zwitterionic calix[4]arene Ligand. J. Organomet. Chem. 2015, 792, 88− 92. (143) Zhang, G.; Han, X.; Luan, Y.; Wang, Y.; Wen, X.; Xu, L.; Ding, C.; Gao, J. Copper-Catalyzed Aerobic Alcohol Oxidation under Air in Neat Water by Using a Water-Soluble Ligand. RSC Adv. 2013, 3, 19255−19258. (144) Duan, R. F.; Cheng, L.; Zhang, Q. C.; Ma, L. S.; Ma, H. Y.; Yang, J. C. Mechanistic Insight into the Aerobic Oxidation of Benzyl 732


Chemical Reviews

Review

(164) Pavlova, A.; Meijer, E. J. Understanding the Role of Water in Aqueous Ruthenium-Catalyzed Transfer Hydrogenation of Ketones. ChemPhysChem 2012, 13, 3492−3496. (165) Hong, S. H.; Grubbs, R. H. Highly Active Water-Soluble Olefin Metathesis Catalyst. J. Am. Chem. Soc. 2006, 128, 3508−3509. (166) Jordan, J. P.; Grubbs, R. H. Small-Molecule N-HeterocyclicCarbene-Containing Olefin-Metathesis Catalysts for Use in Water. Angew. Chem., Int. Ed. 2007, 46, 5152−5155. (167) Gallivan, J. P.; Jordan, J. P.; Grubbs, R. H. A Neutral, WaterSoluble Olefin Metathesis Catalyst Based on an N-Heterocyclic Carbene Ligand. Tetrahedron Lett. 2005, 46, 2577−2580. (168) Gułajski, Ł.; Michrowska, A.; Narożnik, J.; Kaczmarska, Z.; Rupnicki, L.; Grela, K. A Highly Active Aqueous Olefin Metathesis Catalyst Bearing a Quaternary Ammonium Group. ChemSusChem 2008, 1, 103−109. (169) Michrowska, A.; Gułajski, Ł.; Kaczmarska, Z.; Mennecke, K.; Kirschning, A.; Grela, K. A Green Catalyst for Green Chemistry: Synthesis and Application of an Olefin Metathesis Catalyst Bearing a Quaternary Ammonium Group. Green Chem. 2006, 8, 685−688. (170) Grela, K.; Gułajski, Ł.; Skowerski, K. Alkene Metathesis in Water. Metal-Catalyzed Reactions in Water; Wiley-VCH Verlag GmbH & Co. KGaA: Weinheim, Germany, 2013; pp 291−336. (171) Arockiam, P. B.; Fischmeister, C.; Bruneau, C.; Dixneuf, P. H. C−H Bond Functionalization in Water Catalyzed by Carboxylato Ruthenium(II) Systems. Angew. Chem., Int. Ed. 2010, 49, 6629−6632. (172) Li, B.; Dixneuf, P. H. Metal-Catalyzed C−H Bond Activation and C−C Bond Formation in Water. Metal-Catalyzed Reactions in Water; Wiley-VCH Verlag GmbH & Co. KGaA: Weinheim, Germany, 2013; pp 47−86. (173) Tlili, A.; Schranck, J.; Pospech, J.; Neumann, H.; Beller, M. Ruthenium-Catalyzed Carbonylative C-C Coupling in Water by Directed C-H Bond Activation. Angew. Chem., Int. Ed. 2013, 52, 6293−6297. (174) Tlili, A.; Schranck, J.; Pospech, J.; Neumann, H.; Beller, M. Ruthenium-Catalyzed Hydroaroylation of Styrenes in Water through Directed C-H Bond Activation. ChemCatChem 2014, 6, 1562−1566. (175) Zhang, L.; Nguyen, D. H.; Raffa, G.; Desset, S.; Paul, S.; Dumeignil, F.; Gauvin, R. M. Efficient Deuterium Labelling of Alcohols in Deuterated Water Catalyzed by Ruthenium Pincer Complexes. Catal. Commun. 2016, 84, 67−70. (176) García-Á lvarez, R.; Díaz-Á lvarez, A. E.; Borge, J.; Crochet, P.; Cadierno, V. Ruthenium-Catalyzed Rearrangement of Aldoximes to Primary Amides in Water. Organometallics 2012, 31, 6482−6490. (177) García-Á lvarez, R.; Díaz-Á lvarez, A. E.; Crochet, P.; Cadierno, V. Ruthenium-Catalyzed One-Pot Synthesis of Primary Amides from Aldehydes in Water. RSC Adv. 2013, 3, 5889−5894. (178) García-Á lvarez, R.; Zablocka, M.; Crochet, P.; Duhayon, C.; Majoral, J.-P.; Cadierno, V. Thiazolyl-Phosphine Hydrochloride Salts: Effective Auxiliary Ligands for Ruthenium-Catalyzed Nitrile Hydration Reactions and Related Amide Bond Forming Processes in Water. Green Chem. 2013, 15, 2447−2456. (179) Gong, H.; Zeng, H.; Zhou, F.; Li, C.-J. Rhodium(I)-Catalyzed Regiospecific Dimerization of Aromatic Acids: Two Direct C-H Bond Activations in Water. Angew. Chem., Int. Ed. 2015, 54, 5718−5721. (180) Zhang, H.; Deng, G.-J.; Li, S.; Li, C.-J.; Gong, H. NonSymmetrical Diarylcarboxylic Acids via Rhodium(I)-Catalyzed Regiospecific Cross-Dehydrogenation Coupling of Aromatic Acids: Twofold Direct C−H Bond Activations in Water. RSC Adv. 2016, 6, 91617−91620. (181) Kurahashi, T.; Shinokubo, H.; Osuka, A. Intermolecular Rhodium-Catalyzed Carbometalation/Heck-Type Reaction in Water. Angew. Chem., Int. Ed. 2006, 45, 6336−6338. (182) Wang, Y.-H.; Tsai, F.-Y. Reusable Rhodium(I)/Cationic Bipyridyl-Catalyzed Polymerization of Phenylacetylenes in Water under Aerobic Conditions. Chem. Lett. 2007, 36, 1492−1493. (183) Wang, Y.-H.; Huang, S.-H.; Lin, T.-C.; Tsai, F.-Y. Rhodium(I)/ cationic 2,2′-Bipyridyl-Catalyzed [2 + 2+2] Cycloaddition of α,ωDiynes with Alkynes in Water under Air. Tetrahedron 2010, 66, 7136− 7141.

(184) Gómez, A. B.; Holmberg, P.; Bäckvall, J.-E.; Martín-Matute, B. Transition Metal-Catalyzed Redox Isomerization of Codeine and Morphine in Water. RSC Adv. 2014, 4, 39519−39522. (185) Candeias, N. R.; Gois, P. M. P.; Afonso, C. A. M. Rh(II)Catalyzed Intramolecular C−H Insertion of Diazo Substrates in Water: Scope and Limitations. J. Org. Chem. 2006, 71, 5489−5497. (186) Liang, Y.; Yu, K.; Li, B.; Xu, S.; Song, H.; Wang, B. Rh(iii)Catalyzed Synthesis of 1-Aminoindole Derivatives from 2-Acetyl-1Arylhydrazines and Diazo Compounds in Water. Chem. Commun. 2014, 50, 6130−6133. (187) Muthusamy, S.; Ramkumar, R. On-Water” Generation of Carbonyl Ylides from Diazoamides: rhodium(II) Catalyzed Synthesis of Spiroindolo-Oxiranes and -Dioxolanes with an Interesting Diastereoselectivity. Tetrahedron 2015, 71, 6219−6226. (188) Estevan, F.; Lloret, J.; Sanaú, M.; Ú beda, M. A. Enantio- and Diastereocontrol in Intermolecular Cyclopropanation Reaction of Styrene Catalyzed by Dirhodium(II) Complexes with Bulky Ortho -Metalated Aryl Phosphines: Catalysis in Water as Solvent. Study of a (+)-Nonlinear Effect. Organometallics 2006, 25, 4977−4984. (189) McLaughlin, E. C.; Doyle, M. P. Propargylic Oxidations Catalyzed by Dirhodium Caprolactamate in Water: Efficient Access to α,β-Acetylenic Ketones. J. Org. Chem. 2008, 73, 4317−4319. (190) Wang, X.; Wang, C.; Liu, Y.; Xiao, J. Acceptorless Dehydrogenation and Aerobic Oxidation of Alcohols with a Reusable Binuclear Rhodium(II) Catalyst in Water. Green Chem. 2016, 18, 4605−4610. (191) Kuang, Y.; Wang, Y. Dirhodium(II)-Catalyzed Cross-Coupling Reactions of Aryl Aldehydes with Arylboronic Acids in Water. Eur. J. Org. Chem. 2014, 1163−1166. (192) Aqueous-Phase Organometallic Catalysis; Cornils, B., Herrmann, W. A., Eds.; Wiley-VCH Verlag GmbH & Co. KGaA: Weinheim, FRG, 2004. (193) Wiebus, E.; Cornils, B. Die Großtechnische Oxosynthese Mit Immobilisiertem Katalysator. Chem. Ing. Tech. 1994, 66, 916−923. (194) Chen, S.-J.; Wang, Y.-Y.; Li, Y.-Q.; Zhao, X.-L.; Liu, Y. Ion-Pair Effect of Phosphino-Imidazolium Salts on Rh(III)-Complex Catalyzed Hydroformylation of 1-Octene in Water Suspension. Catal. Commun. 2014, 50, 5−8. (195) Alsalahi, W.; Trzeciak, A. M. Comparison of “on Water” and Solventless Procedures in the Rhodium-Catalyzed Hydroformylation of Diolefins, Alkynes, and Unsaturated Alcohols. J. Mol. Catal. A: Chem. 2016, 423, 41−48. (196) Manbeck, K. A.; Brennessel, W. W.; Jones, W. D. Examination of a Dicationic Rhodium Methyl Aquo Complex. Inorg. Chim. Acta 2013, 397, 140−143. (197) Ali, M. A.; Yao, X.; Sun, H.; Lu, H. [RhCp*Cl2]2-Catalyzed Directed N-Boc Amidation of Arenes “on Water. Org. Lett. 2015, 17, 1513−1516. (198) Ali, M. A.; Yao, X.; Li, G.; Lu, H. Rhodium-Catalyzed Selective Mono- and Diamination of Arenes with Single Directing Site “On Water. Org. Lett. 2016, 18, 1386−1389. (199) Shi, L.; Wang, B. Tandem Rh(III)-Catalyzed C-H Amination/ Annulation Reactions: Synthesis of Indoloquinoline Derivatives in Water. Org. Lett. 2016, 18, 2820−2823. (200) Kim, S.; Han, S.; Park, J.; Sharma, S.; Mishra, N. K.; Oh, H.; Kwak, J. H.; Kim, I. S. Cp*Rh(III)-Catalyzed C(sp3)−H Alkylation of 8-Methylquinolines in Aqueous Media. Chem. Commun. 2017, 53, 3006−3009. (201) Cui, W.; Wayland, B. B. Hydrocarbon C-H Bond Activation by Rhodium Porphyrins. J. Porphyrins Phthalocyanines 2004, 8, 103−110. (202) Fu, X.; Basickes, L.; Wayland, B. B. Aqueous Organometallic Reactions of Rhodium Porphyrins: Equilibrium Thermodynamics. Chem. Commun. 2003, 520−521. (203) Fu, X.; Li, S.; Wayland, B. B. Regioselectivity and Equilibrium Thermodynamics for Addition of Rh−OH to Olefins in Water. J. Am. Chem. Soc. 2006, 128, 8947−8954. (204) Zhang, J.; Li, S.; Fu, X.; Wayland, B. B. Aerobic Oxidation of Alkenes Mediated by Porphyrin Rhodium(iii) Complexes in Water. Dalt. Trans. 2009, 3661−3663. 733


Chemical Reviews

Review

(205) Liu, L.; Yu, M.; Wayland, B. B.; Fu, X. Aerobic Oxidation of Alcohols Catalyzed by Rhodium(iii) Porphyrin Complexes in Water: Reactivity and Mechanistic Studies. Chem. Commun. 2010, 46, 6353− 6355. (206) Yu, M.; Fu, X. Visible Light Promoted Hydroxylation of a Si− C(sp3) Bond Catalyzed by Rhodium Porphyrins in Water. J. Am. Chem. Soc. 2011, 133, 15926−15929. (207) Chatterjee, A.; Ward, T. R. Recent Advances in the Palladium Catalyzed Suzuki−Miyaura Cross-Coupling Reaction in Water. Catal. Lett. 2016, 146, 820−840. (208) Genêtê, J.-P.; Savignac, M. Recent Developments of palladium(0) Catalyzed Reactions in Aqueous Medium. J. Organomet. Chem. 1999, 576, 305−317. (209) Shaughnessy, K. H. Beyond TPPTS: New Approaches to the Development of Efficient Palladium-Catalyzed Aqueous-Phase CrossCoupling Reactions. Eur. J. Org. Chem. 2006, 1827−1835. (210) Polshettiwar, V.; Decottignies, A.; Len, C.; Fihri, A. SuzukiMiyaura Cross-Coupling Reactions in Aqueous Media: Green and Sustainable Syntheses of Biaryls. ChemSusChem 2010, 3, 502−522. (211) Levin, E.; Ivry, E.; Diesendruck, C. E.; Lemcoff, N. G. Water in N-Heterocyclic Carbene-Assisted Catalysis. Chem. Rev. 2015, 115, 4607−4692. (212) Wallow, T. I.; Novak, B. M. In Aqua Synthesis of WaterSoluble Poly(p-Phenylene) Derivatives. J. Am. Chem. Soc. 1991, 113, 7411−7412. (213) Moore, L. R.; Shaughnessy, K. H. Efficient Aqueous-Phase Heck and Suzuki Couplings of Aryl Bromides Using Tri(4,6-Dimethyl3-Sulfonatophenyl)phosphine Trisodium Salt (TXPTS). Org. Lett. 2004, 6, 225−228. (214) DeVasher, R. B.; Moore, L. R.; Shaughnessy, K. H. AqueousPhase, Palladium-Catalyzed Cross-Coupling of Aryl Bromides under Mild Conditions, Using Water-Soluble, Sterically Demanding Alkylphosphines. J. Org. Chem. 2004, 69, 7919−7927. (215) Ueda, M.; Nishimura, M.; Miyaura, N. A Palladium-Catalyzed Biaryl Coupling of Arylboronic Acids in Aqueous Media Using A Gluconamide-Substituted Triphenylphosphine (GLCAphos) Ligand. Synlett 2000, 0856−0858. (216) Liu, N.; Liu, C.; Yan, B.; Jin, Z. Thermoregulated LigandPalladium-Catalyzed Suzuki Reaction in Water. Appl. Organomet. Chem. 2011, 25, 168−172. (217) Wu, W.-Y.; Chen, S.-N.; Tsai, F.-Y. Recyclable and Highly Active Cationic 2,2′-Bipyridyl palladium(II) Catalyst for Suzuki CrossCoupling Reaction in Water. Tetrahedron Lett. 2006, 47, 9267−9270. (218) Botella, L.; Nájera, C. A Convenient Oxime-CarbapalladacycleCatalyzed Suzuki Cross-Coupling of Aryl Chlorides in Water. Angew. Chem., Int. Ed. 2002, 41, 179−181. (219) Crisóstomo-Lucas, C.; Toscano, R. A.; Morales-Morales, D. Synthesis and Characterization of New Potentially Hydrosoluble Pincer Ligands and Their Application in Suzuki−Miyaura CrossCoupling Reactions in Water. Tetrahedron Lett. 2013, 54, 3116−3119. (220) Li, Q.; Zhang, L.-M.; Bao, J.-J.; Li, H.-X.; Xie, J.-B.; Lang, J.-P. Suzuki-Miyaura Reactions Promoted by a PdCl 2 /sulfonate-Tagged Phenanthroline Precatalyst in Water. Appl. Organomet. Chem. 2014, 28, 861−867. (221) Zhang, G.; Zhang, W.; Luan, Y.; Han, X.; Ding, C. PEG ClickTriazole Palladacycle: An Efficient Precatalyst for Palladium-Catalyzed Suzuki-Miyaura and Copper-Free Sonogashira Reactions in Neat Water. Chin. J. Chem. 2015, 33, 705−710. (222) Kostas, I. D.; Coutsolelos, A. G.; Charalambidis, G.; Skondra, A. The First Use of Porphyrins as Catalysts in Cross-Coupling Reactions: A Water-Soluble Palladium Complex with a Porphyrin Ligand as an Efficient Catalyst Precursor for the Suzuki−Miyaura Reaction in Aqueous Media under Aerobic Conditions. Tetrahedron Lett. 2007, 48, 6688−6691. (223) Zhong, R.; Pöthig, A.; Feng, Y.; Riener, K.; Herrmann, W. A.; Kühn, F. E. Facile-Prepared Sulfonated Water-Soluble PEPPSI-PdNHC Catalysts for Aerobic Aqueous Suzuki−Miyaura Cross-Coupling Reactions. Green Chem. 2014, 16, 4955−4962.

(224) Li, L.; Wang, J.; Zhou, C.; Wang, R.; Hong, M. pH-Responsive Chelating N-Heterocyclic Dicarbene Palladium(ii) Complexes: Recoverable Precatalysts for Suzuki−Miyaura Reaction in Pure Water. Green Chem. 2011, 13, 2071−2077. (225) Lukowiak, M.; Meise, M.; Haag, R. Synthesis and Application of N-Heterocyclic Carbene−Palladium Ligands with Glycerol Dendrons for the Suzuki−Miyaura Cross-Coupling in Water. Synlett 2014, 25, 2161−2165. (226) Liu, D.-X.; Gong, W.-J.; Li, H.-X.; Gao, J.; Li, F.-L.; Lang, J.-P. Palladium(II)-Catalyzed Suzuki−Miyaura Reactions of Arylboronic Acid with Aryl Halide in Water in the Presence of 4-(Benzylthio)N,N,N-Trimethybenzenammonium Chloride. Tetrahedron 2014, 70, 3385−3389. (227) Kaboudin, B.; Salemi, H.; Mostafalu, R.; Kazemi, F.; Yokomatsu, T. Pd(II)-β-Cyclodextrin Complex: Synthesis, Characterization and Efficient Nanocatalyst for the Selective Suzuki-Miyaura Coupling Reaction in Water. J. Organomet. Chem. 2016, 818, 195−199. (228) Wolf, C.; Lerebours, R. Palladium−Phosphinous AcidCatalyzed NaOH-Promoted Cross-Coupling Reactions of Arylsiloxanes with Aryl Chlorides and Bromides in Water. Org. Lett. 2004, 6, 1147−1150. (229) Gordillo, Á .; de Jesús, E.; López-Mardomingo, C. C−C Coupling Reactions of Aryl Bromides and Arylsiloxanes in Water Catalyzed by Palladium Complexes of Phosphanes Modified with Crown Ethers. Org. Lett. 2006, 8, 3517−3520. (230) Alacid, E.; Nájera, C. The First Fluoride-Free Hiyama Reaction of Vinylsiloxanes Promoted by Sodium Hydroxide in Water. Adv. Synth. Catal. 2006, 348, 2085−2091. (231) Gordillo, A.; de Jesús, E.; López-Mardomingo, C. On the PdCatalyzed Vinylation of Aryl Halides with Tris(alkoxy)vinylsilanes in Water. J. Am. Chem. Soc. 2009, 131, 4584−4585. (232) Gordillo, A.; Ortuño, M. A.; López-Mardomingo, C.; Lledós, A.; Ujaque, G.; de Jesús, E. Mechanistic Studies on the Pd-Catalyzed Vinylation of Aryl Halides with Vinylalkoxysilanes in Water: The Effect of the Solvent and NaOH Promoter. J. Am. Chem. Soc. 2013, 135, 13749−13763. (233) Turner, G. L.; Morris, J. A.; Greaney, M. F. Direct Arylation of Thiazoles on Water. Angew. Chem., Int. Ed. 2007, 46, 7996−8000. (234) Flegeau, E. F.; Popkin, M. E.; Greaney, M. F. Direct Arylation of Oxazoles at C2. A Concise Approach to Consecutively Linked Oxazoles. Org. Lett. 2008, 10, 2717−2720. (235) Ohnmacht, S. A.; Mamone, P.; Culshaw, A. J.; Greaney, M. F. Direct Arylations on Water: Synthesis of 2,5-Disubstituted Oxazoles Balsoxin and Texaline. Chem. Commun. 2008, 1241−1243. (236) Ohnmacht, S. A.; Culshaw, A. J.; Greaney, M. F. Direct Arylations of 2H -Indazoles On Water. Org. Lett. 2010, 12, 224−226. (237) Ruiz-Rodríguez, J.; Albericio, F.; Lavilla, R. Postsynthetic Modification of Peptides: Chemoselective C-Arylation of Tryptophan Residues. Chem. - Eur. J. 2010, 16, 1124−1127. (238) Islam, S.; Larrosa, I. On Water”, Phosphine-Free PalladiumCatalyzed Room Temperature C-H Arylation of Indoles. Chem. - Eur. J. 2013, 19, 15093−15096. (239) Joucla, L.; Batail, N.; Djakovitch, L. On Water” direct and SiteSelective Pd-Catalysed C-H Arylation of (NH)-Indoles. Adv. Synth. Catal. 2010, 352, 2929−2936. (240) Cho, B. S.; Chung, Y. K. Palladium-Catalyzed Bisarylation of 3Alkylbenzofurans to 3-Arylalkyl-2-Arylbenzofurans on Water: Tandem C(sp3)−H and C(sp2)−H Activation Reactions of 3-Alkylbenzofurans. Chem. Commun. 2015, 51, 14543−14546. (241) Cho, B. S.; Bae, H. J.; Chung, Y. K. Phosphine-Free PalladiumCatalyzed Direct Bisarylation of Pyrroles with Aryl Iodides on Water. J. Org. Chem. 2015, 80, 5302−5307. (242) Su, Y.-X.; Deng, Y.-H.; Ma, T.-T.; Li, Y.-Y.; Sun, L.-P. On Water” Direct Pd-Catalysed C−H Arylation of thiazolo[5,4-d]pyrimidine Derivatives. Green Chem. 2012, 14, 1979−1981. (243) Chen, F.; Min, Q.-Q.; Zhang, X. Pd-Catalyzed Direct Arylation of Polyfluoroarenes on Water under Mild Conditions Using PPh 3 Ligand. J. Org. Chem. 2012, 77, 2992−2998. 734


Chemical Reviews

Review

(244) Li, B.; Dixneuf, P. H. sp2 C−H Bond Activation in Water and Catalytic Cross-Coupling Reactions. Chem. Soc. Rev. 2013, 42, 5744− 5767. (245) Xiong, T.; Li, Y.; Mao, L.; Zhang, Q.; Zhang, Q. PalladiumCatalyzed Allylic C−H Amination of Alkenes with N-Fluorodibenzenesulfonimide: Water Plays an Important Role. Chem. Commun. 2012, 48, 2246−2248. (246) Hikawa, H.; Ino, Y.; Suzuki, H.; Yokoyama, Y. Pd-Catalyzed Benzylic C−H Amidation with Benzyl Alcohols in Water: A Strategy To Construct Quinazolinones. J. Org. Chem. 2012, 77, 7046−7051. (247) Hikawa, H.; Yokoyama, Y. Palladium-Catalyzed Benzylation of Unprotected Anthranilic Acids with Benzyl Alcohols in Water. Org. Lett. 2011, 13, 6512−6515. (248) Hikawa, H.; Yokoyama, Y. Palladium-Catalyzed Mono-NAllylation of Unprotected Amino Acids with 1,1-Dimethylallyl Alcohol in Water. Org. Biomol. Chem. 2011, 9, 4044−4050. (249) Hikawa, H.; Yokoyama, Y. Palladium-Catalyzed S-Benzylation of Unprotected Mercaptobenzoic Acid with Benzyl Alcohols in Water. Org. Biomol. Chem. 2012, 10, 2942−2945. (250) Hikawa, H.; Yokoyama, Y. Pd-Catalyzed C−H Activation in Water: Synthesis of Bis(indolyl)methanes from Indoles and Benzyl Alcohols. RSC Adv. 2013, 3, 1061−1064. (251) Hikawa, H.; Izumi, K.; Ino, Y.; Kikkawa, S.; Yokoyama, Y.; Azumaya, I. Palladium-Catalyzed Benzylic C-H Benzylation via BisBenzylpalladium(II) Complexes in Water: An Effective Pathway for the Direct Construction of N-(1,2-Diphenylethyl)anilines. Adv. Synth. Catal. 2015, 357, 1037−1048. (252) Brink, G. t. Green, Catalytic Oxidation of Alcohols in Water. Science 2000, 287, 1636−1639. (253) Feng, B.; Hou, Z.; Wang, X.; Hu, Y.; Li, H.; Qiao, Y. Selective Aerobic Oxidation of Styrene to Benzaldehyde Catalyzed by WaterSoluble palladium(II) Complex in Water. Green Chem. 2009, 11, 1446−1452. (254) Buffin, B. P.; Belitz, N. L.; Verbeke, S. L. Electronic, Steric, and Temperature Effects in the Pd(II)-Biquinoline Catalyzed Aerobic Oxidation of Benzylic Alcohols in Water. J. Mol. Catal. A: Chem. 2008, 284, 149−154. (255) Bhattacharjya, A.; Klumphu, P.; Lipshutz, B. H. Ligand-Free, Palladium-Catalyzed Dihydrogen Generation from TMDS: Dehalogenation of Aryl Halides on Water. Org. Lett. 2015, 17, 1122−1125. (256) Liu, T.; Zeng, Y.; Zhang, H.; Wei, T.; Wu, X.; Li, N. Facile PdCatalyzed Chemoselective Transfer Hydrogenation of Olefins Using Formic Acid in Water. Tetrahedron Lett. 2016, 57, 4845−4849. (257) Ojha, D. P.; Gadde, K.; Prabhu, K. R. Generation of Hydrogen from Water: A Pd-Catalyzed Reduction of Water Using Diboron Reagent at Ambient Conditions. Org. Lett. 2016, 18, 5062−5065. (258) Shirakawa, S.; Kobayashi, S. Ag(I)-Catalyzed Michael Additions of β-Ketoesters to Nitroalkenes in Water: Remarkable Effect of Water as a Reaction Medium on Reaction Rates. Synlett 2006, 1410−1412. (259) Jia, Z.; Zhou, F.; Liu, M.; Li, X.; Chan, A. S. C.; Li, C.-J. SilverCatalyzed Hydrogenation of Aldehydes in Water. Angew. Chem., Int. Ed. 2013, 52, 11871−11874. (260) Zhang, N.; Yang, D.; Wei, W.; Yuan, L.; Nie, F.; Tian, L.; Wang, H. Silver-Catalyzed Double-Decarboxylative Cross-Coupling of α-Keto Acids with Cinnamic Acids in Water: A Strategy for the Preparation of Chalcones. J. Org. Chem. 2015, 80, 3258−3263. (261) Kovács, J.; Todd, T. D.; Reibenspies, J. H.; Darensbourg, D. J. Water-Soluble Organometallic Compounds. 9. Catalytic Hydrogenation and Selective Isomerization of Olefins by Water-Soluble Analogues of Vaska’s Complex. Organometallics 2000, 19, 3963−3969. (262) Horváth, H.; Kathó, Á .; Udvardy, A.; Papp, G.; Szikszai, D.; Joó, F. New Water-Soluble Iridium(I)−N-Heterocyclic Carbene− Tertiary Phosphine Mixed-Ligand Complexes as Catalysts of Hydrogenation and Redox Isomerization. Organometallics 2014, 33, 6330− 6340. (263) Ramakrishna, K.; Sivasankar, C. Iridium Catalyzed Acceptor/ acceptor Carbene Insertion into N−H Bonds in Water. Org. Biomol. Chem. 2017, 15, 2392−2396.

(264) Wu, X.; Li, X.; Zanotti-Gerosa, A.; Pettman, A.; Liu, J.; Mills, A. J.; Xiao, J. RhIII- and IrIII-Catalyzed Asymmetric Transfer Hydrogenation of Ketones in Water. Chem. - Eur. J. 2008, 14, 2209−2222. (265) Zhou, Z.; Ma, Q.; Zhang, A.; Wu, L. Synthesis of WaterSoluble Monotosylated Ethylenediamines and Their Application in Ruthenium and Iridium-Catalyzed Transfer Hydrogenation of Aldehydes. Appl. Organomet. Chem. 2011, 25, 856−861. (266) Sun, M.; Campbell, J.; Kang, G.; Wang, H.; Ni, B. Imidazolium Ion Tethered TsDPENs as Efficient Ligands for Iridium Catalyzed Asymmetric Transfer Hydrogenation of α-Keto Phosphonates in Water. J. Organomet. Chem. 2016, 810, 12−14. (267) Thangavel, S.; Friedrich, H. B.; Omondi, B. Syntheses and Structural Investigations of New Half Sandwich Ir(III) and Rh(III) Amine Compounds and Their Catalytic Transfer Hydrogenation of Aromatic Ketones and Aldehydes in Water. Mol. Catal. 2017, 429, 27− 42. (268) Maenaka, Y.; Suenobu, T.; Fukuzumi, S. Hydrogen Evolution from Aliphatic Alcohols and 1,4-Selective Hydrogenation of NAD+ Catalyzed by a [C,N] and a [C,C] Cyclometalated Organoiridium Complex at Room Temperature in Water. J. Am. Chem. Soc. 2012, 134, 9417−9427. (269) Fujita, K.; Ito, W.; Yamaguchi, R. Dehydrogenative Lactonization of Diols in Aqueous Media Catalyzed by a WaterSoluble Iridium Complex Bearing a Functional Bipyridine Ligand. ChemCatChem 2014, 6, 109−112. (270) Kawahara, R.; Fujita, K.; Yamaguchi, R. N-Alkylation of Amines with Alcohols Catalyzed by a Water-Soluble Cp*Iridium Complex: An Efficient Method for the Synthesis of Amines in Aqueous Media. Adv. Synth. Catal. 2011, 353, 1161−1168. (271) Qu, P.; Sun, C.; Ma, J.; Li, F. The N-Alkylation of Sulfonamides with Alcohols in Water Catalyzed by the Water-Soluble Iridium Complex {Cp*Ir[6,6′-(OH)2bpy](H2O)}[OTf]2. Adv. Synth. Catal. 2014, 356, 447−459. (272) Wang, R.; Fan, H.; Zhao, W.; Li, F. Acceptorless Dehydrogenative Cyclization of o-Aminobenzyl Alcohols with Ketones to Quinolines in Water Catalyzed by Water-Soluble Metal−Ligand Bifunctional Catalyst [Cp*(6,6′-(OH)2bpy)(H2O)][OTf]2. Org. Lett. 2016, 18, 3558−3561. (273) Belger, K.; Krause, N. Ammonium-Salt-Tagged IMesAuCl Complexes and Their Application in Gold-Catalyzed Cycloisomerization Reactions in Water. Eur. J. Org. Chem. 2015, 220−225. (274) Li, L.; Shu, C.; Zhou, B.; Yu, Y.-F.; Xiao, X.-Y.; Ye, L.-W. Generation of Gold Carbenes in Water: Efficient Intermolecular Trapping of the α-Oxo Gold Carbenoids by Indoles and Anilines. Chem. Sci. 2014, 5, 4057−4064. (275) Shen, C.; Li, L.; Zhang, W.; Liu, S.; Shu, C.; Xie, Y.; Yu, Y.; Ye, L. Gold-Catalyzed Tandem Cycloisomerization/Functionalization of in Situ Generated α-Oxo Gold Carbenes in Water. J. Org. Chem. 2014, 79, 9313−9318. (276) Rodríguez-Á lvarez, M. J.; Vidal, C.; Schumacher, S.; Borge, J.; García-Á lvarez, J. AuI Iminophosphorane Complexes as Efficient Catalysts for the Cycloisomerization of Alkynyl Amides under Air, at Room Temperature, and in Aqueous or Eutectic-Mixture Solutions. Chem. - Eur. J. 2017, 23, 3425−3431. (277) Hikawa, H.; Suzuki, H.; Azumaya, I. Au(III)/TPPMSCatalyzed Benzylation of Indoles with Benzylic Alcohols in Water. J. Org. Chem. 2013, 78, 12128−12135. (278) Hikawa, H.; Tada, A.; Kikkawa, S.; Azumaya, I. Direct Use of Benzylic Alcohols for Gold(III)-Catalyzed S-Benzylation of Mercaptobenzoic Acids in Water. Adv. Synth. Catal. 2016, 358, 395−402. (279) Khalili, B.; Darabi, F. S.; Eftekhari-Sis, B.; Rimaz, M. Green Chemistry: ZrOCl2·8H2O Catalyzed Regioselective Synthesis of 5Amino-1-Aryl-1H-Tetrazoles from Secondary Arylcyanamides in Water. Monatsh. Chem. 2013, 144, 1569−1572. (280) Gogoi, S. R.; Boruah, J. J.; Sengupta, G.; Saikia, G.; Ahmed, K.; Bania, K. K.; Islam, N. S. Peroxoniobium(V)-Catalyzed Selective Oxidation of Sulfides with Hydrogen Peroxide in Water: A Sustainable Approach. Catal. Sci. Technol. 2015, 5, 595−610. 735


Chemical Reviews

Review

(300) Yang, Y.; Hu, C.; Abu-Omar, M. M. The Effect of Hydrochloric Acid on the Conversion of Glucose to 5-Hydroxymethylfurfural in AlCl3−H2O/THF Biphasic Medium. J. Mol. Catal. A: Chem. 2013, 376, 98−102. (301) Pagán-Torres, Y. J.; Wang, T.; Gallo, J. M. R.; Shanks, B. H.; Dumesic, J. A. Production of 5-Hydroxymethylfurfural from Glucose Using a Combination of Lewis and Brønsted Acid Catalysts in Water in a Biphasic Reactor with an Alkylphenol Solvent. ACS Catal. 2012, 2, 930−934. (302) Tang, J.; Guo, X.; Zhu, L.; Hu, C. Mechanistic Study of Glucose-to-Fructose Isomerization in Water Catalyzed by [Al(OH)2(aq)]+. ACS Catal. 2015, 5, 5097−5103. (303) Yang, J.-M.; Jiang, R.; Wu, L.; Xu, X.-P.; Wang, S.-Y.; Ji, S.-J. In(OTf)3 Catalyzed N-Benzylation of Amines Utilizing Benzyl Alcohols in Water. Tetrahedron 2013, 69, 7988−7994. (304) William, J. M.; Kuriyama, M.; Onomura, O. An Efficient Method for Selective Oxidation of 1,2-Diols in Water Catalyzed by Me2SnCl2. RSC Adv. 2013, 3, 19247−19250. (305) Näslund, J.; Persson, I.; Sandström, M. Solvation of the Bismuth(III) Ion by Water, Dimethyl Sulfoxide, N, N ′-Dimethylpropyleneurea, and N, N -Dimethylthioformamide. An EXAFS, LargeAngle X-Ray Scattering, and Crystallographic Structural Study. Inorg. Chem. 2000, 39, 4012−4021. (306) Kobayashi, S.; Ogawa, C. New Entries to Water-Compatible Lewis Acids. Chem. - Eur. J. 2006, 12, 5954−5960. (307) Ollevier, T.; Nadeau, E.; Guay-Bégin, A.-A. Direct-Type Catalytic Three-Component Mannich Reaction in Aqueous Media. Tetrahedron Lett. 2006, 47, 8351−8354. (308) Li, H.; Zeng, H.; Shao, H.; R, H. O. BiCl, rt. Bismuth(III) Chloride-Catalyzed One-Pot Mannich Reaction: Three-Component Synthesis of B-Amino Carbonyl Compounds. Tetrahedron Lett. 2009, 50, 6858−6860. (309) K. Banik, B.; Garcia, I.; R. Morales, F. Bismuth NitrateCatalyzed Michael Reactions of Indoles in Water. Heterocycles 2007, 71, 919. (310) Bailey, A. D.; Baru, A. R.; Tasche, K. K.; Mohan, R. S. Environmentally Friendly Organic Synthesis Using Bismuth Compounds: bismuth(III) Iodide Catalyzed Deprotection of Acetals in Water. Tetrahedron Lett. 2008, 49, 691−694. (311) Yadav, J.; Reddy, B.; Premalatha, K.; Shiva Shankar, K. Bismuth(III)-Catalyzed Rapid Synthesis of 2,3-Disubstituted Quinoxalines in Water. Synthesis 2008, 3787−3792. (312) T. Muhammad, M.; M. Khan, K.; Taha, M.; Khan, T.; Hussain, S.; I. Fakhri, M.; Perveen, S.; Voelter, W. New Facile, Eco-Friendly and Rapid Synthesis of Trisubstituted Alkenes Using Bismuth Nitrate as Lewis Acid. Lett. Org. Chem. 2016, 13, 231−235. (313) Coca, A.; Feinn, L.; Dudley, J. Microwave Synthesis of 5Substituted 1 H -Tetrazoles Catalyzed by Bismuth Chloride in Water. Synth. Commun. 2015, 45, 1023−1030. (314) Minakata, S.; Komatsu, M. Organic Reactions on Silica in Water. Chem. Rev. 2009, 109, 711−724. (315) Zhang, F.; Li, H. Water-Medium Organic Synthesis over Active and Reusable Organometal Catalysts with Tunable Nanostructures. Chem. Sci. 2014, 5, 3695−3707. (316) Gu, Y.; Ogawa, C.; Kobayashi, J.; Mori, Y.; Kobayashi, S. A Heterogeneous Silica-Supported Scandium/Ionic Liquid Catalyst System for Organic Reactions in Water. Angew. Chem., Int. Ed. 2006, 45, 7217−7220. (317) Mondal, J.; Modak, A.; Dutta, A.; Basu, S.; Jha, S. N.; Bhattacharyya, D.; Bhaumik, A. One-Pot Thioetherification of Aryl Halides with Thiourea and Benzyl Bromide in Water Catalyzed by CuGrafted Furfural Imine-Functionalized Mesoporous SBA-15. Chem. Commun. 2012, 48, 8000−8002. (318) Wang, P.; Dong, Z.; Lei, Y.; Du, Y.; Li, H.; Yang, H.; Nie, Y.; Ma, J. Highly Selective Oxidation of Alcohols Catalyzed by Cu(II)Schiff Base-SBA-15 with Hydrogen Peroxide in Water. J. Porous Mater. 2013, 20, 277−284. (319) Zhang, W.-D.; Xu, L.-X.; Shi, W.; Wang, C.-C.; Hui, Y.-H.; Xie, Z.-F. Oxidation of Aldehydes to Carboxylic Acids in Water Catalyzed

(281) Sakuraba, H.; Maekawa, H. Enantioselective Oxidation of Sulfides Catalyzed by Chiral MoV and CuII Complexes of CatecholAppended β-Cyclodextrin Derivatives in Water. J. Inclusion Phenom. Mol. Recognit. Chem. 2006, 54, 41−45. (282) Francos, J.; Borge, J.; Díez, J.; García-Garrido, S. E.; Cadierno, V. Easy Entry to Donor/acceptor Butadiene Dyes through a MWAssisted InCl3-Catalyzed Coupling of Propargylic Alcohols with Indan1,3-Dione in Water. Catal. Commun. 2015, 63, 10−14. (283) Fringuelli, F.; Pizzo, F.; Tortoioli, S.; Vaccaro, L. InCl3Catalyzed Regio- and Stereoselective Thiolysis of α,β-Epoxycarboxylic Acids in Water. Org. Lett. 2005, 7, 4411−4414. (284) Li, B.; Wang, G.; Li, Z.; Meng, X. InCl3-Catalyzed Synthesis of C-Pyrrolyl Glycosides via Tandem Condensation of Aminosugars and 1,3-Dicarbonyl Compounds in Water. Tetrahedron Lett. 2011, 52, 3891−3894. (285) Urinda, S.; Kundu, D.; Majee, A.; Hajra, A. Indium TriflateCatalyzed One-Pot Synthesis of 14-Alkyl or Aryl-14H -Dibenzo[a, j]Xanthenes in Water. Heteroat. Chem. 2009, 20, 232−234. (286) Zhang, H. B.; Liu, L.; Chen, Y. J.; Wang, D.; Li, C. J. Synthesis of Aryl-Substituted 1,4-Benzoquinone via Water-Promoted and In(OTf)3-Catalyzed in Situ Conjugate Addition-Dehydrogenation of Aromatic Compounds to 1,4-Benzoquinone in Water. Adv. Synth. Catal. 2006, 348, 229−235. (287) Wu, L.; Jiang, R.; Yang, J.-M.; Wang, S.-Y.; Ji, S.-J. In(OTf)3 Catalyzed C3-Benzylation of Indoles with Benzyl Alcohols in Water. RSC Adv. 2013, 3, 5459−5464. (288) Zhang, H.-B.; Liu, L.; Chen, Y.-J.; Wang, D.; Li, C.-J. Synthesis of Aryl-Substituted 1,4-Benzoquinone via Water-Promoted and In(OTf)3-Catalyzed in situ Conjugate Addition-Dehydrogenation of Aromatic Compounds to 1,4-Benzoquinone in Water. Adv. Synth. Catal. 2006, 348, 229−235. (289) Ranu, B. C.; Bhadra, S.; Adak, L. Indium(III) ChlorideCatalyzed Oxidative Cleavage of Carbon−carbon Multiple Bonds by tert-Butyl Hydroperoxide in Watera Safer Alternative to Ozonolysis. Tetrahedron Lett. 2008, 49, 2588−2591. (290) Srivastava, N.; Banik, B. K. Bismuth Nitrate-Catalyzed Versatile Michael Reactions. J. Org. Chem. 2003, 68, 2109−2114. (291) Bailey, A. D.; Baru, A. R.; Tasche, K. K.; Mohan, R. S. Environmentally Friendly Organic Synthesis Using Bismuth Compounds: bismuth(III) Iodide Catalyzed Deprotection of Acetals in Water. Tetrahedron Lett. 2008, 49, 691−694. (292) Yadav, J.; Reddy, B.; Premalatha, K.; Shiva Shankar, K. Bismuth(III)-Catalyzed Rapid Synthesis of 2,3-Disubstituted Quinoxalines in Water. Synthesis 2008, 3787−3792. (293) Muramatsu, W.; William, J. M.; Onomura, O. Selective Monobenzoylation of 1,2- and 1,3-Diols Catalyzed by Me2SnCl2 in Water (Organic Solvent Free) under Mild Conditions. J. Org. Chem. 2012, 77, 754−759. (294) Enslow, K. R.; Bell, A. T. SnCl4-Catalyzed Isomerization/ dehydration of Xylose and Glucose to Furanics in Water. Catal. Sci. Technol. 2015, 5, 2839−2847. (295) Li, Y.; Chen, H.; Liu, J.; Wan, X.; Xu, Q. Clean Synthesis of Primary to Tertiary Carboxamides by CsOH-Catalyzed Aminolysis of Nitriles in Water. Green Chem. 2016, 18, 4865−4870. (296) Dijkstra, G.; Kruizinga, W. H.; Kellogg, R. M. An Assessment of the Causes of The “cesium Effect. J. Org. Chem. 1987, 52, 4230− 4234. (297) Choudhary, V.; Pinar, A. B.; Lobo, R. F.; Vlachos, D. G.; Sandler, S. I. Comparison of Homogeneous and Heterogeneous Catalysts for Glucose-to-Fructose Isomerization in Aqueous Media. ChemSusChem 2013, 6, 2369−2376. (298) De, S.; Dutta, S.; Saha, B. Microwave Assisted Conversion of Carbohydrates and Biopolymers to 5-Hydroxymethylfurfural with Aluminium Chloride Catalyst in Water. Green Chem. 2011, 13, 2859− 2868. (299) Yang, Y.; Hu, C.; Abu-Omar, M. M. Conversion of Carbohydrates and Lignocellulosic Biomass into 5-Hydroxymethylfurfural Using AlCl3·6H2O Catalyst in a Biphasic Solvent System. Green Chem. 2012, 14, 509−513. 736


Chemical Reviews

Review

by cobalt(II) Schiff-Base Complex Anchored to SBA-15/MCM-41. Russ. J. Gen. Chem. 2014, 84, 782−788. (320) Park, S.; Ikehata, K.; Sugiyama, H. Solid-Supported DNA for Asymmetric Synthesis: A Stepping-Stone toward Practical Applications. Biomater. Sci. 2013, 1, 1034−1036. (321) Roelfes, G.; Feringa, B. L. DNA-Based Asymmetric Catalysis. Angew. Chem., Int. Ed. 2005, 44, 3230−3232. (322) Shintaku, H.; Nakajima, K.; Kitano, M.; Hara, M. Efficient Mukaiyama Aldol Reaction in Water with TiO4 Tetrahedra on a Hydrophobic Mesoporous Silica Surface. Chem. Commun. 2014, 50, 13473−13476. (323) Bermejo-Deval, R.; Assary, R. S.; Nikolla, E.; Moliner, M.; Roman-Leshkov, Y.; Hwang, S.-J.; Palsdottir, A.; Silverman, D.; Lobo, R. F.; Curtiss, L. a.; et al. Metalloenzyme-like Catalyzed Isomerizations of Sugars by Lewis Acid Zeolites. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, 9727−9732. (324) Yamaguchi, K.; Matsushita, M.; Mizuno, N. Efficient Hydration of Nitriles to Amides in Water, Catalyzed by Ruthenium Hydroxide Supported on Alumina. Angew. Chem., Int. Ed. 2004, 43, 1576−1580. (325) Gorbanev, Y. Y.; Kegnæs, S.; Riisager, A. Selective Aerobic Oxidation of 5-Hydroxymethylfurfural in Water Over Solid Ruthenium Hydroxide Catalysts with Magnesium-Based Supports. Catal. Lett. 2011, 141, 1752−1760. (326) Gorbanev, Y. Y.; Kegnæs, S.; Riisager, A. Effect of Support in Heterogeneous Ruthenium Catalysts Used for the Selective Aerobic Oxidation of HMF in Water. Top. Catal. 2011, 54, 1318−1324. (327) Sobhani, S.; Ramezani, Z. Synthesis of Arylphosphonates Catalyzed by Pd-Imino-Py-γ-Fe2O3 as a New Magnetically Recyclable Heterogeneous Catalyst in Pure Water without Requiring Any Additive. RSC Adv. 2016, 6, 29237−29244. (328) Mori, K.; Hara, T.; Mizugaki, T.; Ebitani, K.; Kaneda, K. Hydroxyapatite-Bound Cationic Ruthenium Complexes as Novel Heterogeneous Lewis Acid Catalysts for Diels−Alder and Aldol Reactions. J. Am. Chem. Soc. 2003, 125, 11460−11461. (329) Xu, G.; Zhang, Y.; Fu, Y.; Guo, Q. Efficient Hydrogenation of Various Renewable Oils over Ru-HAP Catalyst in Water. ACS Catal. 2017, 7, 1158−1169. (330) Masuyama, Y.; Nakajima, Y.; Okabe, J. EnvironmentallyBenign palladium(II)-Exchanged Hydroxyapatite-Catalyzed Allylic Alkylation of Allyl Methyl Carbonate in Water. Appl. Catal., A 2010, 387, 107−112. (331) Masuyama, Y.; Yoshikawa, K.; Suzuki, N.; Hara, K.; Fukuoka, A. Hydroxyapatite-Supported copper(II)-Catalyzed Azide−alkyne [3 + 2] Cycloaddition with Neither Reducing Agents nor Bases in Water. Tetrahedron Lett. 2011, 52, 6916−6918. (332) Indra, A.; Greiner, M.; Gericke, A. K.; Schlögl, R.; Avnir, D.; Driess, M. High Catalytic Synergism between the Components of the Rhenium Complex@silver Hybrid Material in Alkene Epoxidations. ChemCatChem 2014, 6, 1935−1939. (333) Leadbeater, N. E.; Marco, M. Preparation of PolymerSupported Ligands and Metal Complexes for Use in Catalysis. Chem. Rev. 2002, 102, 3217−3274. (334) Guinó, M.; Hii, K. K. M. Applications of PhosphineFunctionalised Polymers in Organic Synthesis. Chem. Soc. Rev. 2007, 36, 608−617. (335) Madhavan, N.; Jones, C. W.; Weck, M. Rational Approach to Polymer-Supported Catalysts: Synergy between Catalytic Reaction Mechanism and Polymer Design. Acc. Chem. Res. 2008, 41, 1153− 1165. (336) Lu, J.; Toy, P. H. Organic Polymer Supports for Synthesis and for Reagent and Catalyst Immobilization. Chem. Rev. 2009, 109, 815− 838. (337) Buchmeiser, M. R. Polymer-Supported Well-Defined Metathesis Catalysts. Chem. Rev. 2009, 109, 303−321. (338) Kann, N. Recent Applications of Polymer Supported Organometallic Catalysts in Organic Synthesis. Molecules 2010, 15, 6306−6331.

(339) Climent, M. J.; Corma, A.; Iborra, S. Heterogeneous Catalysts for the One-Pot Synthesis of Chemicals and Fine Chemicals. Chem. Rev. 2011, 111, 1072−1133. (340) Itsuno, S.; Hassan, M. M. Polymer-Immobilized Chiral Catalysts. RSC Adv. 2014, 4, 52023−52043. (341) Paul, S.; Islam, M. M.; Islam, S. M. Suzuki−Miyaura Reaction by Heterogeneously Supported Pd in Water: Recent Studies. RSC Adv. 2015, 5, 42193−42221. (342) Uozumi, Y. Palladium Catalysis in Water: Design, Preparation, and Use of Amphiphilic Resin-Supported Palladium-Phosphine Complexes. Yuki Gosei Kagaku Kyokaishi 2002, 60, 1063−1068. (343) Uozumi, Y. Heterogeneous Asymmetric Catalysis in Water with Amphiphilic Polymer-Supported Homochiral Palladium Complexes. Bull. Chem. Soc. Jpn. 2008, 81, 1183−1195. (344) Miyamura, H.; Sonoyama, A.; Hayrapetyan, D.; Kobayashi, S. Self-Assembled Nanocomposite Organic Polymers with Aluminum and Scandium as Heterogeneous Water-Compatible Lewis Acid Catalysts. Angew. Chem., Int. Ed. 2015, 54, 10559−10563. (345) Chen, M.; Liang, C.; Zhang, F.; Li, H. Periodic Mesoporous Silica-Supported Scandium Triflate as a Robust and Reusable Lewis Acid Catalyst for Carbon−Carbon Coupling Reactions in Water. ACS Sustainable Chem. Eng. 2014, 2, 486−492. (346) Kantam, M. L.; Ramani, T.; Chakrapani, L.; Choudary, B. M. Oxidative Kinetic Resolution of Racemic Secondary Alcohols Catalyzed by Resin Supported Sulfonato-Mn(salen) Complex in Water. J. Mol. Catal. A: Chem. 2007, 274, 11−15. (347) Islam, S. M.; Ghosh, K.; Roy, A. S.; Salam, N.; Chatterjee, T. Oxidation and Oxidative Bromination Reactions Catalyzed By a Reusable Polymer-Anchored Iron(III) Complex in Water at Room Temperature. J. Inorg. Organomet. Polym. Mater. 2014, 24, 457−467. (348) Prasanth, K. L.; Maheswaran, H. Selective Oxidation of Sulfides to Sulfoxides in Water Using 30% Hydrogen Peroxide Catalyzed with a Recoverable VO(acac)2 Exchanged Sulfonic Acid Resin Catalyst. J. Mol. Catal. A: Chem. 2007, 268, 45−49. (349) Hsiao, M.-C.; Liu, S.-T. Polymer Supported Vanadium Complexes as Catalysts for the Oxidation of Alkenes in Water. Catal. Lett. 2010, 139, 61−66. (350) Wang, Y.; Liu, J.; Xia, C. Insights into Supported Copper(II)Catalyzed Azide-Alkyne Cycloaddition in Water. Adv. Synth. Catal. 2011, 353, 1534−1542. (351) Wang, Y.; Liu, J.; Xia, C. Cross-Linked Polymer Supported Palladium Catalyzed Carbonylative Sonogashira Coupling Reaction in Water. Tetrahedron Lett. 2011, 52, 1587−1591. (352) He, Y.; Cai, C. Heterogeneous Copper-Free Sonogashira Coupling Reaction Catalyzed by a Reusable Palladium Schiff Base Complex in Water. J. Organomet. Chem. 2011, 696, 2689−2692. (353) Hu, Z.; Leung, C.-F.; Tsang, Y.-K.; Du, H.; Liang, H.; Qiu, Y.; Lau, T.-C. A Recyclable Polymer-Supported Ruthenium Catalyst for the Oxidative Degradation of Bisphenol A in Water Using Hydrogen Peroxide. New J. Chem. 2011, 35, 149−155. (354) Arakawa, Y.; Haraguchi, N.; Itsuno, S. Design of Novel Polymer-Supported Chiral Catalyst for Asymmetric Transfer Hydrogenation in Water. Tetrahedron Lett. 2006, 47, 3239−3243. (355) Arakawa, Y.; Chiba, A.; Haraguchi, N.; Itsuno, S. Asymmetric Transfer Hydrogenation of Aromatic Ketones in Water Using a Polymer-Supported Chiral Catalyst Containing a Hydrophilic Pendant Group. Adv. Synth. Catal. 2008, 350, 2295−2304. (356) Dimroth, J.; Keilitz, J.; Schedler, U.; Schomäcker, R.; Haag, R. Immobilization of a Modified Tethered rhodium(III)-p-Toluenesulfonyl-1,2- Diphenylethylenediamine Catalyst on Soluble and Solid Polymeric Supports and Successful Application to Asymmetric Transfer Hydrogenation of Ketones. Adv. Synth. Catal. 2010, 352, 2497−2506. (357) Dimroth, J.; Schedler, U.; Keilitz, J.; Haag, R.; Schomäcker, R. New Polymer-Supported Catalysts for the Asymmetric Transfer Hydrogenation of Acetophenone in Water - Kinetic and Mechanistic Investigations. Adv. Synth. Catal. 2011, 353, 1335−1344. (358) Matharu, D. S.; Morris, D. J.; Kawamoto, A. M.; Clarkson, G. J.; Wills, M. A Stereochemically Well-Defined rhodium(III) Catalyst 737


Chemical Reviews

Review

for Asymmetric Transfer Hydrogenation of Ketones. Org. Lett. 2005, 7, 5489−5491. (359) Wu, X.; Liu, J.; Di Tommaso, D.; Iggo, J. A.; Catlow, C. R. A.; Bacsa, J.; Xiao, J. A Multilateral Mechanistic Study into Asymmetric Transfer Hydrogenation in Water. Chem. - Eur. J. 2008, 14, 7699− 7715. (360) Wang, Z.; Chen, G.; Ding, K. Self-Supported Catalysts. Chem. Rev. 2009, 109, 322−359. (361) Dhakshinamoorthy, A.; Asiri, A. M.; Garcia, H. Catalysis by Metal−organic Frameworks in Water. Chem. Commun. 2014, 50, 12800−12814. (362) Murase, T.; Nishijima, Y.; Fujita, M. Cage-Catalyzed Knoevenagel Condensation under Neutral Conditions in Water. J. Am. Chem. Soc. 2012, 134, 162−164. (363) Zeeland, R. V.; Li, X.; Huang, W.; Stanley, L. M. MOF-253Pd(OAc)2: a recyclable MOF for transition-metal catalysis in water. RSC Adv. 2016, 6, 56330−56334. (364) Lin, S.; Diercks, C. S.; Zhang, Y.-B.; Kornienko, N.; Nichols, E. M.; Zhao, Y.; Paris, A. R.; Kim, D.; Yang, P.; Yaghi, O. M.; Chang, C. J. Covalent Organic Frameworks Comprising Cobalt Porphyrins for Catalytic CO2 Reduction in Water. Science 2015, 349, 1208−1213. (365) Liu, L.-L.; Yu, C.-X.; Zhou, W.; Zhang, Q.-G.; Liu, S.-M.; Shi, Y.-F. Construction of Four Zn(II) Coordination Polymers Used as Catalysts for the Photodegradation of Organic Dyes in Water. Polymers 2016, 8, 3. (366) Andrew Lin, K.-Y.; Hsu, F.-K. Magnetic Iron/carbon Nanorods Derived from a Metal Organic Framework as an Efficient Heterogeneous Catalyst for the Chemical Oxidation Process in Water. RSC Adv. 2015, 5, 50790−50800. (367) Zeeland, R. V.; Li, X.; Huang, W.; Stanley, L. M. MOF-253Pd(OAc)2: a recyclable MOF for transition-metal catalysis in water. RSC Adv. 2016, 6, 56330−56334. (368) Schwizer, F.; Okamoto, Y.; Heinisch, T.; Gu, Y.; Pellizzoni, M. M.; Lebrun, V.; Reuter, R.; Köhler, V.; Lewis, J. C.; Ward, T. R. Artificial Metalloenzymes: Reaction Scope and Optimization Strategies. Chem. Rev. 2017, DOI: 10.1021/acs.chemrev.7b00014. (369) van Dun, S.; Ottmann, C.; Milroy, L.-G.; Brunsveld, L. Supramolecular Chemistry Targeting Proteins. J. Am. Chem. Soc. 2017, 139, 13960. (370) Bos, J.; Fusetti, F.; Driessen, A. J. M.; Roelfes, G. Enantioselective Artificial Metalloenzymes by Creation of a Novel Active Site at the Protein Dimer Interface. Angew. Chem., Int. Ed. 2012, 51, 7472−7475. (371) Bos, J.; García Herraiz, A.; Roelfes, G. An enantioselective artificial metallo-hydratase. Chem. Sci. 2013, 4, 3578−3582. (372) Drienovská, I.; Rioz-Martínez, A.; Draksharapu, A.; Roelfes, G. Novel artificial metalloenzymes by in vivo incorporation of metalbinding unnatural amino acids. Chem. Sci. 2015, 6, 770−776. (373) Bos, J.; Browne, W. R.; Driessen, A. J. M.; Roelfes, G. Supramolecular Assembly of Artificial Metalloenzymes Based on the Dimeric Protein LmrR as Promiscuous Scaffold. J. Am. Chem. Soc. 2015, 137, 9796−9799. (374) Bersellini, M.; Roelfes, G. A metal ion regulated artificial metalloenzyme. Dalton Trans. 2017, 46, 4325−4330. (375) Pordea, A.; Creus, M.; Panek, J.; Duboc, C.; Mathis, D.; Novic, M.; Ward, T. R. Artificial Metalloenzyme for Enantioselective Sulfoxidation Based on Vanadyl-Loaded Streptavidin. J. Am. Chem. Soc. 2008, 130, 8085−8088. (376) Köhler, V.; Mao, J.; Heinisch, T.; Pordea, A.; Sardo, A.; Wilson, Y. M.; Knörr, L.; Creus, M.; Prost, J.-C.; Schirmer, T.; Ward, T. R. OsO4·Streptavidin: a Tunable Hybrid Catalyst for the Enantioselective cis-Dihydroxylation of Olefins. Angew. Chem., Int. Ed. 2011, 50, 10863−10866. (377) Creus, M.; Pordea, A.; Rossel, T.; Sardo, A.; Letondor, C.; Ivanova, A.; Letrong, I.; Stenkamp, R. E.; Ward, T. R. X-ray Structure and Designed Evolution of an Artificial Transfer Hydrogenase. Angew. Chem., Int. Ed. 2008, 47, 1400−1404. (378) Heinisch, T.; Langowska, K.; Tanner, P.; Reymond, J.-L.; Meier, W.; Palivan, C.; Ward, T. R. Fluorescence-Based Assay for the

Optimization of the Activity of Artificial Transfer Hydrogenase within a Biocompatible Compartment. ChemCatChem 2013, 5, 720−723. (379) Dürrenberger, M.; Heinisch, T.; Wilson, Y. M.; Rossel, T.; Nogueira, E.; Knörr, L.; Mutschler, A.; Kersten, K.; Zimbron, M. J.; Pierron, J.; Schirmer, T.; Ward, T. R. Artificial Transfer Hydrogenases for the Enantioselective Reduction of Cyclic Imines. Angew. Chem., Int. Ed. 2011, 50, 3026−3029. (380) Köhler, V.; Wilson, Y. M.; Dürrenberger, M.; Ghislieri, D.; Churakova, E.; Quinto, T.; Knörr, L.; Häussinger, D.; Hollmann, F.; Turner, N. J.; Ward, T. R. Synthetic Cascades are Enabled by Combining Biocatalysts with Artificial Metalloenzymes. Nat. Chem. 2013, 5, 93−99. (381) Quinto, T.; Schwizer, F.; Zimbron, J. M.; Morina, A.; Köhler, V.; Ward, T. R. Expanding the Chemical Diversity in Artificial Imine Reductases Based on the Biotin-Streptavidin Technology. ChemCatChem 2014, 6, 1010−1014. (382) Schwizer, F.; Köhler, V.; Dürrenberger, M.; Knörr, L.; Ward, T. R. Genetic Optimization of the Catalytic Efficiency of Artificial Imine Reductases Based on Biotin−Streptavidin Technology. ACS Catal. 2013, 3, 1752−1755. (383) Wilson, Y. M.; Dürrenberger, M.; Nogueira, E. S.; Ward, T. R. Neutralizing the Detrimental Effect of Glutathione on Precious Metal Catalysts. J. Am. Chem. Soc. 2014, 136, 8928−8932. (384) Zimbron, J. M.; Heinisch, T.; Schmid, M.; Hamels, D.; Nogueira, E. S.; Schirmer, T.; Ward, T. R. A Dual Anchoring Strategy for the Localization and Activation of Artificial Metalloenzymes Based on the Biotin−Streptavidin Technology. J. Am. Chem. Soc. 2013, 135, 5384−5388. (385) Robles, V. M.; Dürrenberger, M.; Heinisch, T.; Lledós, A.; Schirmer, T.; Ward, T. R.; Maréchal, J.-D. Structural, Kinetic, and Docking Studies of Artificial Imine Reductases Based on BiotinStreptavidin Technology: An Induced Lock-and-Key Hypothesis. J. Am. Chem. Soc. 2014, 136, 15676−15683. (386) Quinto, T.; Häussinger, D.; Köhler, V.; Ward, T. R. Artificial metalloenzymes for the diastereoselective reduction of NAD+ to NAD2H. Org. Biomol. Chem. 2015, 13, 357−360. (387) Monnard, F. W.; Nogueira, E. S.; Heinisch, T.; Schirmer, T.; Ward, T. R. Human carbonic anhydrase II as host protein for the creation of artificial metalloenzymes: the asymmetric transfer hydrogenation of imines. Chem. Sci. 2013, 4, 3269−3274. (388) Sauer, D. F.; Himiyama, T.; Tachikawa, K.; Fukumoto, K.; Onoda, A.; Mizohata, E.; Inoue, T.; Bocola, M.; Schwaneberg, U.; Hayashi, T.; Okuda, J. A Highly Active Biohybrid Catalyst for Olefin Metathesis in Water: Impact of a Hydrophobic Cavity in a β-Barrel Protein. ACS Catal. 2015, 5, 7519−7522. (389) Okamoto, Y.; Köhler, V.; Ward, T. R. An NAD(P)HDependent Artificial Transfer Hydrogenase for Multienzymatic Cascades. J. Am. Chem. Soc. 2016, 138, 5781−5784. (390) Okamoto, Y.; Köhler, V.; Paul, C. E.; Hollmann, F.; Ward, T. R. Efficient In Situ Regeneration of NADH Mimics by an Artificial Metalloenzyme. ACS Catal. 2016, 6, 3553−3557. (391) Okamoto, Y.; Ward, T. R. Cross-Regulation of an Artificial Metalloenzyme. Angew. Chem., Int. Ed. 2017, 56, 10156. (392) Jeschek, M.; Reuter, R.; Heinisch, T.; Trindler, C.; Klehr, J.; Panke, S.; Ward, T. R. Directed evolution of artificial metalloenzymes for in vivo metathesis. Nature 2016, 537, 661−665. (393) Liu, Z.; Lebrun, V.; Kitanosono, T.; Mallin, H.; Köhler, V.; Häussinger, D.; Hilvert, D.; Kobayashi, S.; Ward, T. R. Upregulation of an Artificial Zymogen by Proteolysis. Angew. Chem., Int. Ed. 2016, 55, 11587−11590. (394) Hestericová, M.; Correro, M. R.; Lenz, M.; Corvini, P. F.; Shahgaldian, P.; Ward, T. R. Immobilization of an artificial imine reductase within silica nanoparticles improves its performance. Chem. Commun. 2016, 52, 9462−9465. (395) Boersma, A. J.; Feringa, B. L.; Roelfes, G. α,β-Unsaturated 2Acyl Imidazoles as a Practical Class of Dienophiles for the DNA-Based Catalytic Asymmetric Diels−Alder Reaction in Water. Org. Lett. 2007, 9, 3647−3650. 738


Chemical Reviews

Review

(396) Boersma, A. J.; Klijn, J. E.; Feringa, B. L.; Roelfes, G. DNABased Asymmetric Catalysis: Sequence-Dependent Rate Acceleration and Enantioselectivity. J. Am. Chem. Soc. 2008, 130, 11783−11790. (397) Rosati, F.; Roelfes, G. A Ligand Structure-Activity Study of DNA-Based Catalytic Asymmetric Hydration and Diels-Alder Reactions. ChemCatChem 2011, 3, 973−977. (398) Boersma, A. J.; Coquière, D.; Geerdink, D.; Rosati, F.; Feringa, B. L.; Roelfes, G. Catalytic enantioselective syn hydration of enones in water using a DNA-based catalyst. Nat. Chem. 2010, 2, 991−995. (399) Coquière, D.; Feringa, B. L.; Roelfes, G. DNA-Based Catalytic Enantioselective Michael Reactions in Water. Angew. Chem., Int. Ed. 2007, 46, 9308−9311. (400) Li, Y.; Wang, C.; Jia, G.; Lu, S.; Li, C. Enantioselective Michael addition reactions in water using a DNA-based catalyst. Tetrahedron 2013, 69, 6585−6590. (401) Boersma, A. J.; Feringa, B. L.; Roelfes, G. Enantioselective Friedel-Crafts Reactions in Water Using a DNA-Based Catalyst. Angew. Chem., Int. Ed. 2009, 48, 3346−3348. (402) Draksharapu, A.; Boersma, A. J.; Vrowne, W. R.; Roelfes, G. Binding of Copper(II) Polypyridyl Complexes to DNA and Consequences for DNA-based Asymmetric Catalysis. Dalton Trans. 2015, 44, 3656−3663. (403) Petrova, G. P.; Ke, Z.; Park, S.; Sugiyama, H.; Morokuma, K. The origin of enantioselectivity for intramolecular Friedel-Crafts reaction catalyzed by supramolecular Cu/DNA catalyst complex. Chem. Phys. Lett. 2014, 600, 87−95. (404) Amirbekyan, K.; Duchemin, N.; Benedetti, E.; Joseph, R.; Colon, A.; Markarian, S. A.; Bethge, L.; Vonhoff, S.; Klussmann, S.; Cossy, J.; Vasseur, J.-J.; Arseniyadis, S.; Smietana, M. Design, Synthesis, and Binding Affinity Evaluation of Hoechst 33258 Derivatives for the Development of Sequence-Specific DNA-Based Asymmetric Catalysts. ACS Catal. 2016, 6, 3096−3105. (405) Marek, J. J.; Singh, R. P.; Heuer, A.; Hennecke, U. Enantioselective Catalysis by Using Short, Structurally Defined DNA Hairpins as Scaffold for Hybrid Catalysts. Chem. - Eur. J. 2017, 23, 6004−6008. (406) Wang, J.; Benedetti, E.; Bethge, L.; Vonhoff, S.; Klussmann, S.; Vasseur, J.-J.; Cossy, J.; Smietana, M.; Arseniyadis, S. DNA vs. MirrorImage DNA: A Universal Approach to Tune the Absolute Configuration in DNA-Based Symmetric Catalysis. Angew. Chem., Int. Ed. 2013, 52, 11546−11549. (407) Duchemin, N.; Benedetti, E.; Bethge, L.; Vonhoff, S.; Klussmann, S.; Vasseur, J.-J.; Cossy, J.; Smietana, M.; Arseniyadis, S. Expandiing biohybrid-mediated asymmetric catalysis into the realm of RNA. Chem. Commun. 2016, 52, 8604−8607. (408) Park, S.; Ikehata, K.; Watanabe, R.; Hidaka, Y.; Rajendran, A.; Sugiyama, H. Deciphering DNA-based asymmetric catalysis through intramolecular Friedel-Crafts alkylations. Chem. Commun. 2012, 48, 10398−10400. (409) Shibata, N.; Yasui, H.; Nakamura, S.; Toru, T. DNA-Mediated Enantioselective Carbon-Fluorine Bond Formation. Synlett 2007, 1153−1157. (410) Dijk, E. W.; Feringa, B. L.; Roelfes, G. DNA-based hydrolytic kinetic resolution of epoxides. Tetrahedron: Asymmetry 2008, 19, 2374−2377. (411) García-Fernández, A.; Megens, R. P.; Villarino, L.; Roelfes, G. DNA-Accelerated Copper Catalysis of Friedel-Crafts Conjugate Addition/Enantioselective Protonation Reactions in Water. J. Am. Chem. Soc. 2016, 138, 16308−16314. (412) Oelerich, J.; Roelfes, G. DNA-based asymmetric organometallic catalysis in water. Chem. Sci. 2013, 4, 2013−2017. (413) Benedetti, E.; Duchemin, N.; Bethge, L.; Vonhoff, S.; Klussmann, S.; Vasseur, J.-J.; Cossy, J.; Smietana, M.; Arseniyadis, S. DNA-cellulose: an economical, fully recyclable and highly effective chiral biomaterial for asymmetric catalysis. Chem. Commun. 2015, 51, 6076−6079. (414) Willemsen, J. S.; Megens, R. P.; Roelfes, G.; van Hest, J. C. M.; Rutjes, F. P. J. T. A One-Pot Oxidation/Enantioselective Oxa-Michael Cascade. Eur. J. Org. Chem. 2014, 2892−2898.

(415) Oltra, N. S.; Roelfes, G. Modular assembly of novel DNAbased catalysts. Chem. Commun. 2008, 6039−6041. (416) Gjonaj, L.; Roelfes, G. Novel Catalyst Design by using Cisplatin To Covalently Anchor Catalytically Active Copper Complexes to DNA. ChemCatChem 2013, 5, 1718−1721. (417) Park, S.; Zheng, L.; Kumakiri, S.; Sakashita, S.; Otomo, H.; Ikehata, K.; Sugiyama, H. Development of DNA-Based Hybrid Catalysts through Direct Ligand Incorporation: Toward Understanding of DNA-Based Asymmetric Catalysis. ACS Catal. 2014, 4, 4070−4073. (418) Park, S.; Okamura, I.; Sakashita, S.; Yum, J. H.; Acharya, C.; Gao, L.; Sugiyama, H. Development of DNA Metalloenzymes Using a Rational Design Approach and Application in the Asymmetric DielsAlder Reaction. ACS Catal. 2015, 5, 4708−4712. (419) Su, M.; Tomás-Gamasa, M.; Carell, T. DNA based multicopper ions assembly using combined pyrazole and salen ligandosides. Chem. Sci. 2015, 6, 632−638. (420) Mohan, U.; Burai, R.; McNaughton, B. R. In Vitro evolution of a Friedel-Crafts deoxyribozyme. Org. Biomol. Chem. 2013, 11, 2241− 2244. (421) Rioz-Martínez, A.; Oelerich, J.; Ségaud, N.; Roelfes, G. DNAAccelerated Catalysis of Carbene-Transfer Reactions by a DNA/ Cationic Iron Porphyrin Hybrid. Angew. Chem., Int. Ed. 2016, 55, 14136−14140. (422) Wang, C.; Li, Y.; Jia, G.; Liu, Y.; Lu, S.; Li, C. Enantioselective Friedel-Crafts reactions in water catalyzed by a human telomeric Gquadruplex DNA metalloenzyme. Chem. Commun. 2012, 48, 6232− 6234. (423) Wang, C.; Jia, G.; Zhou, J.; Li, Y.; Liu, Y.; Lu, S.; Li, C. Enantioselective Diels-Alder Reactions with G-Quadruplex DNABased Catalysts. Angew. Chem., Int. Ed. 2012, 51, 9352−9355. (424) Li, Y.; Jia, G.; Wang, C.; Cheng, M.; Li, C. Higher-Order Human Telomeric G-Quadruplex DNA Metalloenzymes Enhance Enantioselectivity in the Diels-Alder Reaction. ChemBioChem 2015, 16, 618−624. (425) Wang, C.; Jia, G.; Li, Y.; Zhang, S.; Li, C. Na+/K+ switch of enantioselectivity in G-quadruplex DNA-based catalysis. Chem. Commun. 2013, 49, 11161−11163. (426) Li, Y.; Wang, C.; Hao, J.; Cheng, M.; Jia, G.; Li, C. Higherorder human telomeric G-quadruplex DNA metalloenzyme catalyzed Diels-Alder reaction: an unexpected inversion of enantioselectivity modulated by K+ and NH4+ ions. Chem. Commun. 2015, 51, 13174− 13177. (427) Cheng, M.; Li, Y.; Zhou, J.; Jia, G.; Lu, S.-M.; Yang, Y.; Li, C. Enantioselective sulfoxidation reaction catalyzed by a G-quadruplex DNA metalloenzyme. Chem. Commun. 2016, 52, 9644−9647. (428) Li, Y.; Cheng, M.; Hao, J.; Wang, C.; Jia, G.; Li, C. Terpyridine-Cu(II) targeting human telomeric DNA to produce highly stereospecific G-quadruplex DNA metalloenzyme. Chem. Sci. 2015, 6, 5578−5585. (429) Wilking, M.; Hennecke, U. The influence of G-quadruplex structure on DNA-based asymmetric catalysis using the G-quadruplexbound cationic porphyrin TMPyP4•Cu. Org. Biomol. Chem. 2013, 11, 6940−6945. (430) Dey, S.; Jäschke, A. Tuning the Stereoselectivity of a DNACatalyzed Michael Addition through Covalent Modification. Angew. Chem., Int. Ed. 2015, 54, 11279−11282. (431) Baig, R. B. N.; Varma, R. S. Copper on chitosan: a recyclable heterogeneous catalyst for azide-alkyne cycloaddtion reactions in water. Green Chem. 2013, 15, 1839−1843. (432) Zheng, L.; Sonzini, S.; Ambarwati, M.; Rosta, E.; Scherman, O. A.; Herrmann, A. Tuning Cucurbit[8]uril into a Supramolecular Nanoreactor for Asymmetric Catalysis. Angew. Chem., Int. Ed. 2015, 54, 13007−13011. (433) Jiang, J.; Meng, Y.; Zhang, L.; Liu, M. Self-Assembled SingleWalled Metal-Helical Nanotube (M-HN): Creation of Efficient Supramolecular Catalysts for Asymmetric Reaction. J. Am. Chem. Soc. 2016, 138, 15629−15635. 739


Chemical Reviews

Review

Aryl Halides with Amines in Pure Water. Eur. J. Org. Chem. 2010, 3219−3223. (453) Meng, F.; Wang, C.; Xie, J.; Zhu, X.; Wan, Y. N2,N2′disubstituted oxalic acid bishydrazides: novel ligands for coppercaatalyzed C-N coupling reactions in water. Appl. Organomet. Chem. 2011, 25, 341−347. (454) Wu, F.-T.; Yan, N.-N.; Liu, P.; Xie, J.-W.; Liu, Y.; Dai, B. Copper powder-catalyzed N-arylation of imidazoles in water using 2(hydrazinecarbonyl)pyridine N-oxides as the new ligands. Tetrahedron Lett. 2014, 55, 3249−32351. (455) Kantam, M. L.; Balasubrahmanyam, V.; Kumar, K. B. S.; Venkanna, G. T.; Figueras, F. Catalysis in Water: Aldol-Type Reaction of Aldehydes and Imines with Ethyl Diazoacetate Catalyzed by Highly Basic Magnesium/Lanthanum Mixed Oxide. Adv. Synth. Catal. 2007, 349, 1887−1890. (456) Hadjiivanov, K.; Klissurski, D.; Davydov, A. Effect of the Surface Structure of Metal Oxides on their Adsorption Properties. J. Chem. Soc., Faraday Trans. 1 1988, 84, 37−40. (457) Hara, M. Heterogeneous Lewis Acid Catalysts Workable in Water. Bull. Chem. Soc. Jpn. 2014, 87, 931−941. (458) Nakajima, K.; Noma, R.; Kitano, M.; Hara, M. Titania as an Early Transition Metal Oxide with a High Density of Lewis Acid Sites Workable in Water. J. Phys. Chem. C 2013, 117, 16028−16033. (459) Thirupathi, B.; Srinivas, R.; Prasad, A. N.; Kumar, J. K. P.; Reddy, B. M. Green Progression for Synthesis of Regioselective βAmino Alcohols and Chemoselective Alkylated Indoles. Org. Process Res. Dev. 2010, 14, 1457−1463. (460) Koito, Y.; Nakajima, K.; Kitano, M.; Hara, M. Efficient Conversion of Pyruvic Aldehyde into Lactic Acid by Lewis Acid Catalyst in Water. Chem. Lett. 2013, 42, 873−875. (461) Nakajima, K.; Baba, Y.; Noma, R.; Kitano, M.; Kondo, J. N.; Hayashi, S.; Hara, M. Nb2O5•nH2O as a Heterogeneous Catalyst with Water-Tolerant Lewis Acid Sites. J. Am. Chem. Soc. 2011, 133, 4224− 4227. (462) Noma, R.; Nakajima, K.; Kamata, K.; Kitano, M.; Hayashi, S.; Hara, M. Formation of 5-(Hydroxymethyl)furfural by Stepwise Dehydration over TiO2 with Water-Tolerant Lewis Acid Sites. J. Phys. Chem. C 2015, 119, 17117−17125. (463) Khalafi-Nezhad, A.; Haghighi, S. M.; Panahi, F. Nano-TiO2 on Dodecyl-Sulfated Silica: as an Efficient Heterogeneous Lewis Acid− Surfactant-Combined Catalyst (HLASC) for Reaction in Aqueous Media. ACS Sustainable Chem. Eng. 2013, 1, 1015−1023. (464) Kobayashi, S.; Kitanosono, T.; Ueno, M. Copper(II) and Bismuth(III) Hydroxide Catalyzed Addition Reaction of Hydrazonoester with Allenylboronate in Aqueous Media. Synlett 2010, 2033− 2036. (465) Morita, Y.; Furusato, S.; Takagaki, A.; Hayashi, S.; Kikuchi, R.; Oyama, S. T. Intercalation-Controlled Cyclodehydration of Sorbitol in Water over Layered-Niobium-Molybdate Solid Acid. ChemSusChem 2014, 7, 748−752. (466) Fujita, M.; Nagano, T.; Schneider, U.; Hamada, T.; Ogawa, C.; Kobayashi, S. Zn-Catalyzed Asymmetric Allylation for the Synthesis of Optically Active Allylglycine Derivatives. Regio- and Stereoselective Formal α-Addition of Allylboronates to Hydrazono Esters. J. Am. Chem. Soc. 2008, 130, 2914. (467) Schneider, U.; Ueno, M.; Kobayashi, S. Catalytic Use of Indium(0) for Carbon−Carbon Bond Transformations in Water: General Catalytic Allylations of Ketones with Allylboronates. J. Am. Chem. Soc. 2008, 130, 13824−13825. (468) Nakamura, S.; Hara, Y.; Furukawa, T.; Hirashita, T. Enantioselective Barbier-type allylation of ketones using allyl halide and indium in water. RSC Adv. 2017, 7, 15582−15585. (469) Kitanosono, T.; Xu, P.; Isshiki, S.; Zhu, L.; Kobayashi, S. Cu(II)-Catalyzed Asymmetric Boron Conjugate Addition to α,βUnsaturated Imines in Water. Chem. Commun. 2014, 50, 9336−9339. (470) Zhu, L.; Kitanosono, T.; Xu, P.; Kobayashi, S. Chiral Cu(II)catalyzed enantioselective β-borylation of α,β-unsaturated nitriles in water. Beilstein J. Org. Chem. 2015, 11, 2007−2011.

(434) Alagiri, K.; Prabhu, K. R. Efficient synthesis of carbonyl compounds: oxidation of azides and alcohols catalyzed by vanadium pentoxide in water using tert-butylhydroperoxide. Tetrahedron 2011, 67, 8544−8551. (435) Song, Q.; Feng, Q.; Yang, K. Synthesis of Primary Amides via Copper-Catalyzed Aerobic Decarboxylative Ammoxidation of Phenylacetic Acids and α-Hydroxyphenylacetic Acids with Ammonia in Water. Org. Lett. 2014, 16, 624−627. (436) Hayashi, E.; Komanoya, T.; Kamata, K.; Hara, M. Heterogeneously-Catalyzed Aerobic Oxidation of 5-Hydroxymethylfurfural to 2,5-Furandicarboxylic Acid with MnO2. ChemSusChem 2017, 10, 654−658. (437) Ramos, R.; Grigoropoulos, A.; Perret, N.; Zanella, M.; Katsoulidis, A. P.; Manning, T. D.; Claridge, J. B.; Rosseinsky, M. J. Selective conversion of 5-hydroxymethylfurfural to cyclopentanone derivatives over Cu-Al2O3 and Co-Al2O3 catalysts in water. Green Chem. 2017, 19, 1701−1713. (438) Heravi, M. M.; Fard, M. V.; Faghihi, Z. Heteropoly acidscatalyzed organic reactions in water: doubly green reactions. Green Chem. Lett. Rev. 2013, 6, 282−300. (439) Zhao, W.; Zhang, Y.; Ma, B.; Qiu, W. Oxidation of alcohols with hydrogen peroxide in water catalyzed by recyclable keggin-type tungstoborate catalyst. Catal. Commun. 2010, 11, 527−531. (440) Azizi, N.; Saidi, M. R. Highly efficient ring opening reactions of epoxides with deactivated aromatic amines catalyzed by heteropoly acids in water. Tetrahedron 2007, 63, 888−891. (441) Rafiee, E.; Eavani, S.; Nejad, F. K.; Joshaghani. Cs2.5H0.5PW12O40 catalyzed diastereoselective synthesis of β-amino ketones via three component Mannich-type reaction in water. Tetrahedron 2010, 66, 6858−6863. (442) Thakur, A.; Sharma, A.; Sharma, A. Efficient synthesis of xanthenedione derivatives using cesium salt of phosphotungstic acid as a heterogeneous and reusable catalyst in water. Synth. Commun. 2016, 46, 1766−1771. (443) Yu, H.; Ru, S.; Dai, G.; Zhai, Y.; Lin, H.; Han, S.; Wei, Y. An Efficient Iron(III)-Catalyzed Aerobic Oxidation of Aldehydes in Water for the Green Preparation of Carboxylic Acids. Angew. Chem., Int. Ed. 2017, 56, 3867−3871. (444) Shao, C.; Zhu, R.; Luo, S.; Zhang, Q.; Wang, X.; Hu, Y. Copper(I) oxide and benzoic acid ‘on water’: a highly practical and efficient catalytic system for copper(I)-catalyzed azide-alkyne cylcoaddition. Tetrahedron Lett. 2011, 52, 3782−3785. (445) Meng, F.; Zhu, X.; Lig, Li. Y.; Xie, J.; Wang, B.; Yao, J.; Wan, Y. Efficient Copper-Catalyzed Direct Amination of Aryl Halides Using Aqueous Ammonia in Water. Eur. J. Org. Chem. 2010, 6149−6152. (446) Yong, F.-F.; Teo, Y.-C.; Tay, S.-H.; Tan, B. Y.-H.; Lim, K.-H. A ligand-free copper(I) oxide catalyzed strategy for the N-arylation of azoles in water. Tetrahedron Lett. 2011, 52, 1161−1164. (447) Malakar, C. C.; Baskakova, A.; Conrad, J.; Beifuss, U. CopperCatalyzed Synthesis of Quinazolines in Water Starting from oBromobenzylbromides and Benzamidines. Chem. - Eur. J. 2012, 18, 8882−8885. (448) Peng, J.; Ye, Min.; Zong, C.; Hu, F.; Feng, L.; Wang, X.; Wang, Y.; Chen, C. Copper-Catalyzed Intramolecular C-N bond formation: A Straightforward Synthesis of Benzimidazole Derivatives in Water. J. Org. Chem. 2011, 76, 716−719. (449) Wang, Y.; Zhou, C.; Wang, R. Copper-catalyzed hydroxylation of aryl halides: efficient synthesis of phenols, alkyl aryl ethers and benzofuran derivatives in neat water. Green Chem. 2015, 17, 3910− 3915. (450) Bharate, J. B.; Guru, S. K.; Jain, S. K.; Meena, S.; Singh, P. P.; Bhushan, S.; Singh, B.; Bharate, S. B.; Vishwakarma, R. A. RSC Adv. 2013, 3, 20869−20876. (451) Yang, Q.; Wang, Y.; Lin, D.; Zhang, M. N-arylation of heterocycles catalyzed by activated-copper in pure water. Tetrahedron Lett. 2013, 54, 1994−1997. (452) Xie, J.; Zhu, X.; Huang, M.; Meng, F.; Chen, W.; Wan, Y. Pyrrole-2-carbohydrazides as Ligands for Cu-Catalyzed Amination of 740


Chemical Reviews

Review

(471) Stavber, G.; Č asar, Z. Basic CuCO3/ligand as a new catalyst for ‘on water’ borylation of Michael acceptors, alkenes and alkynes: application to the efficient asymmetric synthesis of β-alcohol type sitagliptin side chain. Appl. Organomet. Chem. 2013, 27, 159−165. (472) Kitanosono, T.; Kobayashi, S. Asymmetric Boron Conjugate Additions to Enones in Water Catalyzed by Copper(0). Asian J. Org. Chem. 2013, 2, 961−966. (473) Ueno, M.; Tanoue, A.; Kobayashi, S. Silver Oxide as a Novel Catalyst for Carbon−Carbon Bond-Forming Reactions in Aqueous Media. Chem. Lett. 2010, 39, 652−653. (474) Ueno, M.; Tanoue, A.; Kobayashi, S. Catalytic Organic Reactions on the Surface of Silver(I) Oxide in Water. Chem. Lett. 2014, 43, 1867−1869. (475) Eremin, D. B.; Ananikov, V. P. Understanding active species in catalytic transformations: From molecular catalysis to nanoparticles, leaching, “Cocktails” of ctalysts and dynamic systems. Coord. Chem. Rev. 2017, 346, 2−19. (476) Ogasawara, S.; Kato, S. Palladium Nanoparticles Captured in Microporous Polymers: A Tailor-Made Catalyst for Heterogeneous Carbon Cross-Coupling Reactions. J. Am. Chem. Soc. 2010, 132, 4608−4613. (477) Bernechea, M.; de Jesus, E.; Lopez-Mardomingo, C.; Terreros, P. Dendrimer-Encapsulated Pd Nanoparticles versus Palladium Acetate as Catalytic Precursors in the Stille Reaction in Water. Inorg. Chem. 2009, 48, 4491−4496. (478) Yu, Y.; Hu, T.; Chen, X.; Xu, K.; Zhang, J.; Huang, J. Pd nanoparticles on a porous ionic copolymer: a high active and recyclable catalyst for Suzuki-Miyaura reaction under air in water. Chem. Commun. 2011, 47, 3592−3594. (479) Zhou, C.; Wang, J.; Li, L.; Wang, R.; Hong, M. A palladium chelating complex of ionic water-soluble nitrogen-containing ligand: the efficient precatalyst for Suzuki-Miyaura reaction in water. Green Chem. 2011, 13, 2100−2106. (480) Yamada, Y. M. A.; Sarkar, S. M.; Uozumi, Y. Self-Assembled Poly(imidazole-palladium): Highly Active, Reusable Catalyst at Parts per Million to Parts per Billion Levels. J. Am. Chem. Soc. 2012, 134, 3190−3198. (481) Yuan, B.; Pan, Y.; Li, Y.; Yin, B.; Jiang, H. A Highly Active Heterogeneous Palladium Catalyst for the Suzuki-Miyaura and Ullmann Coupling Reactions of Aryl Chlorides in Aqueous Media. Angew. Chem., Int. Ed. 2010, 49, 4054−4058. (482) Pascanu, V.; Yao, Q.; Gómez, A. B.; Gustafsson, M.; Yun, Y.; Wan, W.; Samain, L.; Zou, X.; Martín-Matute, B. Sustainable Catalysis: Rational Pd Loading on MIL-101Cr-NH2 for More Efficient and Recyclable Suzuki-Miyaura Reactions. Chem. - Eur. J. 2013, 19, 17483−17493. (483) Wang, F.; Mielby, J.; Richter, F. H.; Wang, G.; Prieto, G.; Kasama, T.; Weidenthaler, C.; Bongard, H.-J.; Kegnæs, S.; Fürstner, A.; Schüth, F. A Polyphenylene Support for Pd Catalysts with Exceptional Catalytic Activity. Angew. Chem., Int. Ed. 2014, 53, 8645−8648. (484) Li, L.; Chen, Z.; Zhong, H.; Wang, R. Urea-Based Porous Organic Frameworks: Effective Supports for Catalysis in Neat Water. Chem. - Eur. J. 2014, 20, 3050−3060. (485) Zhi, J.; Song, D.; Li, Z.; Lei, X.; Hu, A. Palladium nanoparticles in carbon thin film-lined SBA-15 nanoreactors: efficient heterogeneous catalysts for Suzuki-Miyaura cross coupling reaction in aqueous media. Chem. Commun. 2011, 47, 10707−10709. (486) Putta, C.; Sharavath, V.; Sarkar, S.; Ghosh, S. Palladium nanoparticles on β-cyclodextrin functionalized graphene nanosheets: a supramolecular based heterogeneous catalyst for C-C coupling reactions under green reaction conditions. RSC Adv. 2015, 5, 6652− 6660. (487) Wan, Y.; Wang, H.; Zhao, Q.; Klingstedt, M.; Terasaki, O.; Zhao, D. Ordered Mesoporous Pd/Silica-Carbon as a Highly Active Heterogeneous Catalyst for Coupling Reaction of Chlorobenzene in Aqueous Media. J. Am. Chem. Soc. 2009, 131, 4541−4550. (488) Handa, S.; Wang, Y.; Gallou, F.; Lipshutz, B. H. Sustainable Feppm Pd nanoparticle catalysis of Suzuki-Miyaura cross-couplings in water. Science 2015, 349, 1087−1091.

(489) Handa, S.; Andersson, M. P.; Gallou, F.; Reilly, J.; Lipshutz, B. H. HandaPhos: A General Ligand Enabling Sustainable ppm Levels of Palladium-Catalyzed Cross-Couplings in Water at Room Temperature. Angew. Chem., Int. Ed. 2016, 55, 4914−4918. (490) Handa, S.; Smith, J. D.; Hageman, M. S.; Gonzalez, M.; Lipshutz, B. H. Synergistic and Selective Copper/ppm Pd-Catalyzed Suzuki-Miyaura Couplings: In Water, Mild Conditions, with Recycling. ACS Catal. 2016, 6, 8179−8183. (491) Sokolov, V. I.; Rakov, E. G.; Bumagin, N. A.; Vinogradov, M. G. New Method to Prepare Nanopalladium Clusters Immobilized on Carbon Nanotubes: A Very Efficient Catalyst for Forming CarbonCarbon Bonds and Hydrogenation. Fullerenes, Nanotubes, Carbon Nanostruct. 2010, 18, 558−563. (492) Park, G.; Lee, S.; Son, S. J.; Shin, S. Pd nanoparticle-silica nanotubes (Pd@SNTs) as an efficient catalyst for Suzuki-Miyaura coupling and sp2 C-H arylation in water. Green Chem. 2013, 15, 3468− 3473. (493) Boffi, A.; Cacchi, S.; Ceci, P.; Cirilli, R.; Fabrizi, G.; Prastaro, A.; Niembro, S.; Shafir, A.; Vallribera, A. The Heck Reaction of Allylic Alcohols Catalyzed by Palladium Nanoparticles in Water: Chemoenzymatic Synthesis of (R)-(−)-Rhododendrol. ChemCatChem 2011, 3, 347−353. (494) Sasmal, P. K.; Streu, C. N.; Meggers, E. Metal complex catalysis in living biological systems. Chem. Commun. 2013, 49, 1581−1587. (495) Saha, A.; Laezer, J.; Varma, R. S. O-Allylation of phenols with allylic acetates in aqueous media using a magnetically separable catalytic system. Green Chem. 2012, 14, 67−71. (496) Liu, J.; Hu, G.; Yang, Y.; Zhang, H.; Zuo, W.; Liu, W.; Wang, B. Rational synthesis of Pd nanoparticle-embedded reduced graphene oxide frameworks with enhanced selective catalysis in water. Nanoscale 2016, 8, 2787−2794. (497) Ranu, B. C.; Chattopadhyay, K. A New Route to the Synthesis of (E)- and (Z)-2-Alkene-4-ynoates and Nitriles from vic-Diiodo-(E)alkenes Catalyzed by Pd(0) Nanoparticles in Water. Org. Lett. 2007, 9, 2409−2412. (498) Zhao, J.; Ye, J.; Zhang, Y. J. Stereospecific Allyl-Aryl Coupling Catalyzed by in situ Generated Palladium Nanoparticles in Water under Ambient Conditions. Adv. Synth. Catal. 2013, 355, 491−498. (499) Llevot, A.; Monney, B.; Sehlinger, A.; Behrens, S.; Meier, M. A. R. Highly efficient Tsuji-Trost allylation in water catalyzed by Pdnanoparticles. Chem. Commun. 2017, 53, 5175−5178. (500) Malmgren, J.; Nagendiran, A.; Tai, C.-W.; Bäckvall, J.-E.; Olofsson, B. C-2 Selective Arylation of Indoles with Heterogeneous Nanopalladium and Diaryliodonium Salts. Chem. - Eur. J. 2014, 20, 13531−13535. (501) Rummelt, S. M.; Rranocchiari, M.; von Bokhoven, J. A. Synthesis of Water-Soluble Phosphine Oxides by Pd/C-Catalyzed P-C Coupling in Water. Org. Lett. 2012, 14, 2188−2190. (502) Liu, B.; Ren, Y.; Zhang, Z. Aerobic oxidation of 5hydroxymethylfurfural into 2,5-furandicarboxylic acid in water under mild conditions. Green Chem. 2015, 17, 1610−1617. (503) Slack, E. D.; Gabriel, C. M.; Lipshutz, B. H. A Palladium Nanoparticle-Nanomicelle Combination for the Stereoselective Semihydrogenation of Alkynes in Water at Room Temperature. Angew. Chem., Int. Ed. 2014, 53, 14051−14054. (504) Feng, J.; Handa, S.; Gallou, F.; Lipshutz, B. H. Safe and Selective Nitro Group Reductions Catalyzed by Sustainable and Recyclable Fe/ppm Pd Nanoparticles in Water at Room Temperature. Angew. Chem., Int. Ed. 2016, 55, 8979−8983. (505) Gabriel, C. M.; Parmentier, M.; Riegert, C.; Lanz, M.; Handa, S.; Lipshutz, B. H.; Gallou, F. Sustainable and Scalable Fe/ppm Pd Nanoparticle Nitro Group Reductions in Water at Room Temperature. Org. Process Res. Dev. 2017, 21, 247−252. (506) Ferry, A.; Schaepe, K.; Tegeder, P.; Richter, C.; Chepiga, K. M.; Ravoo, B. J.; Glorius, F. Negatively Charged N-Heterocyclic Carbene-Stabilized Pd and Au Nanoparticles and Efficient Catalysis in Water. ACS Catal. 2015, 5, 5414−5420. (507) Zhang, F.; Zheng, S.; Xiao, Q.; Zhong, Y.; Zhu, W.; Lin, A.; ElShall, M. S. Synergetic catalysis of palladium nanoparticles encaged 741


Chemical Reviews

Review

within amine-functionalized UiO-66 in the hydrodeoxygenation of vanillin in water. Green Chem. 2016, 18, 2900−2908. (508) Haruta, M.; Kobayashi, T.; Sano, H.; Yamada, N. Novel Gold Catalysts for the Oxidation of Carbon Monoxide at a Temperature far Below 0 °C. Chem. Lett. 1987, 16, 405−408. (509) Han, J.; Liu, Y.; Guo, R. Facile Synthesis of Highly Stable Gold Nanoparticles and Their Unexpected Excellent Catalytic Activity for Suzuki-Miyaura Cross-Coupling Reaction in Water. J. Am. Chem. Soc. 2009, 131, 2060−2061. (510) Tsunoyama, H.; Ichikuni, N.; Sakurai, H.; Tsukuda, T. Effect of Electronic Structures of Au Clusters Stabilized by Poly(N-Vinyl-2pyrrolidone) on Aerobic Oxidation Catalysis. J. Am. Chem. Soc. 2009, 131, 7086−7093. (511) Takei, T.; Suenaga, J.; Ishida, T.; Haruta, M. Ethanol Oxidation in Water Catalyzed by Gold Nanoparticles Supported on NiO Doped with Cu. Top. Catal. 2015, 58, 295−301. (512) Yoshii, D.; Jin, X.; Yatabe, T.; Hasegawa, J.; Yamaguchi, K.; Mizuno, N. Gold nanoparticle on OMS-2 for heterogeneously catalyzed aerobic oxidative α,β-dehydrogenation of b-heteroatomsubstituted ketones. Chem. Commun. 2016, 52, 14314−14317. (513) Ke, Z.; Zhang, Y.; Cui, X.; Shi, F. Supported nano-goldcatalyzed N-formylation of amines with paraformaldehyde in water under ambient conditions. Green Chem. 2016, 18, 808−816. (514) Lin, F.-H.; Doong, R.-A. Bifunctional Au-Fe3O4 Heterostrctures for Magnetically Recyclable Catalysis of Nitrophenol Reduction. J. Phys. Chem. C 2011, 115, 6591−6598. (515) Li, H.; Meng, B.; Chai, S.-H.; Liu, H.; Dai, S. Hypercrosslinked β-cyclodextrin porous polymer: an adsorption-facilitated molecular catalyst support for transformation of water-soluble aromatic molecules. Chem. Sci. 2016, 7, 905−909. (516) Guo, W.; Pleixats, R.; Shafir, A. Water-Soluble Gold Nanoparticles: From Catalytic Selective Nitroarene Reduction in Water to Refractive Index Sensing. Chem. - Asian J. 2015, 10, 2437− 2443. (517) Liu, Y.-M.; He, L.; Wang, M.-M.; Cao, Y.; He, H.-Y.; Fan, K.-N. A General and Efficient Heterogeneous Gold-Catalyzed Hydration of Nitriles in Neat Water under Mild Atmospheric Conditions. ChemSusChem 2012, 5, 1392−1396. (518) Zhu, F.-X.; Wang, W.; Li, H.-X. Water-Medium and SolventFree Organic Reactions over a Bifunctional Catalyst with Au Nanoparticles Covalently Bonded to HS/SO3H Functionalized Periodic Mesoporous Organosilica. J. Am. Chem. Soc. 2011, 133, 11632−11640. (519) Zang, X.; Corma, A. Supported Gold(III) Catalysts for Highly Efficient Three-Component Coupling Reactions. Angew. Chem., Int. Ed. 2008, 47, 4358−4361. (520) Chang, L. L.; Yang, J.; Wei, Y.; Ying, J. Y. Semiconductor-Gold Nanocomposite Catalysts for the Efficient Three-Component Coupling of Aldehyde, Amine and Alkyne in Water. Adv. Synth. Catal. 2009, 351, 2887−2896. (521) Zhao, X.-B.; Ha, W.; Jiang, K.; Chen, J.; Yang, J.-L.; Shi, Y.-P. Efficient synthesis of camptothecin propargylamine derivatives in water catalyzed by macroporous adsorption resin-supported gold ananoparticles. Green Chem. 2017, 19, 1399−1406. (522) Liu, S.-S.; Sun, K.-Q.; Xu, B.-Q. Specific Selectivity of AuCatalyzed Oxidation of Glycerol and Other C3-Polyols in Water without the Presence of a Base. ACS Catal. 2014, 4, 2226−2230. (523) Takagaki, A.; Tsuji, A.; Nishimura, S.; Ebitani, K. Genesis of Catalytically Active Gold Nanoparticles Supported on Hydrotalcite for Base-free Selective Oxidation of Glycerol in Water with Molecular Oxygen. Chem. Lett. 2011, 40, 150−152. (524) Gupta, N. K.; Nishimura, S.; Takagaki, A.; Ebitani, K. Hydrotalcite-supported gold-nanoparticle-catalyzed highly efficient base-free aqueous oxidation of 5-hydroxymethylfurfural into 2,5furandicarboxylic acid under atmospheric oxygen pressure. Green Chem. 2011, 13, 824−827. (525) Ohmi, Y.; Nishimura, S.; Ebitani, K. Synthesis of a-Amino Acids from Glucosamine-HCl and its Derivatives by Aerobic Oxidation

in Water Catalyzed by Au Nanoparticles on Basic Supports. ChemSusChem 2013, 6, 2259−22262. (526) Tomar, R.; Sharma, J.; Nishimura, S.; Ebitani, K. Aqueous Oxidation of Sugars into Sugar Acids Using Hydrotalcite-supported Gold Nanoparticle Catalyst under Atmospheric Molecular Oxygen. Chem. Lett. 2016, 45, 843−845. (527) An, D.; Ye, A.; Deng, W.; Zhang, Q.; Wang, Y. Selective Conversion of Cellobiose and Cellulose into Gluconic Acid in Water in the Presence of Oxygen, Catalyzed by Polyoxometalate-Supported Gold Nanoparticles. Chem. - Eur. J. 2012, 18, 2938−2947. (528) Verduyckt, J.; De Vos, D. E. Highly selective one-step dehydration, decarboxylation and hydrogenation of citric acid to methylsuccinic acid. Chem. Sci. 2017, 8, 2616−2620. (529) Mitsudome, T.; Arita, S.; Mori, H.; Mizugaki, T.; Jitsukawa, K.; Kaneda, K. Supported Silver-Nanoparticle-Catalyzed Highly Efficient Aqueous Oxidation of Phenylsilanes to Silanols. Angew. Chem., Int. Ed. 2008, 47, 7938−7940. (530) Mitsudome, T.; Mikami, Y.; Mori, H.; Arita, S.; Mizugaki, T.; Jitsukawa, K.; Kaneda, K. Supported silver nanoparticle catalyst for selective hydration of nitriles to amides in water. Chem. Commun. 2009, 3258−3260. (531) Shimizu, K.; Imaiida, N.; Sawabe, K. Satsuma, A. Hydration of nitriles to amides in water by SiO2-supported Ag catalysts promoted by adsorbed oxygen atoms. Appl. Catal., A 2012, 421−422, 114−120. (532) Shimizu, K.; Kubo, T.; Satsuma, A.; Kamachi, T.; Yoshizawa, K. Surface Oxygen Atom as a Cooperative Ligand in Pd Nanoparticle Catalysis for Selective Hydration of Nitriles to Amides in Water: Experimental and Theoretical Studies. ACS Catal. 2012, 2, 2467− 2474. (533) Morioka, Y.; Matsuoka, A.; Binder, K.; Knappett, B. R.; Wheatley, A. E. H.; Naka, H. Selective hydrogenation of arenes to cyclohexanes in water catalyzed by chitin-supported ruthenium nanoparticles. Catal. Sci. Technol. 2016, 6, 5801−5805. (534) Hubert, C.; Bilé, E. G.; Denicourt-Nowicki, A.; Roucoux, A. Rh(0) colloids supported on TiO2: a highly active and pertinent tandem in neat water for the hydrogenation of aromatics. Green Chem. 2011, 13, 1766−1771. (535) Liu, D.; Chen, X.; Xu, G.; Guan, J.; Cao, Q.; Dong, B.; Qi, Y.; Li, C.; Mu, X. Iridium nanoparticles supported on hierarchical porous N-doped carbon: an efficient water-tolerant catalyst for bio-alcohol condensation in water. Sci. Rep. 2016, 6, 21365−21377. (536) Chen, X.; Zhang, L.; Zhang, B.; Guo, X.; Mu, X. Highly selective hydrogenation of furfural to furfuryl alcohol over Pt nanoparticles supported on g-C3N4 nanosheets catalysts in water. Sci. Rep. 2016, 6, 28558−28569. (537) Liu, K.; Litke, A.; Su, Y.; van Campenhout, B. G.; Pidko, E. A.; Hensen, E. J. M. Photocatalytic decarboxylation of lactic acid by Pt/ TiO2. Chem. Commun. 2016, 52, 11634−11637. (538) Ohtaka, A.; Kozono, M.; Takahashi, K.; Hamasaka, G.; Uozumi, Y.; Shinagawa, T.; Shimomura, O.; Nomura, R. Linear Polystyrene-stabilized Pt Nanoparticles Catalyzed Indole Synthesis in Water via Aerobic Alcohol Oxidation. Chem. Lett. 2016, 45, 758−760. (539) Glöggler, S.; Grunfeld, A. M.; Ertas, Y. N.; McCormick, J.; Wagner, S.; Schleker, P. P. M.; Bouchard, L.-S. A Nanoparticle Catalyst for Heterogeneous Phase Para-Hydrogen-Induced Polarization in Water. Angew. Chem., Int. Ed. 2015, 54, 2452−2456. (540) Hudson, R.; Hamasaka, G.; Osako, T.; Yamada, Y. M. A.; Li, C.-J.; Uozumi, Y.; Moores, A. Highly efficient iron(0) nanoparticlecatalyzed hydrogenation in water in flow. Green Chem. 2013, 15, 2141−2148. (541) Lin, W.; Cheng, H.; Ming, J.; Yu, Y.; Zhao, F. Deactivation of Ni/TiO2 catalyst in the hydrogenation of nitrobenzene in water and imporvement in its stability by coating a layer of hydrophobic carbon. J. Catal. 2012, 291, 149−154. (542) Handa, S.; Slack, E. D.; Lipshutz, B. H. Nanonickel-Catalyzed Suzuki-Miyaura Cross-Couplings in Water. Angew. Chem., Int. Ed. 2015, 54, 1−6. 742


Chemical Reviews

Review

(543) Wang, T.; Ren, D.; Huo, Z.; Song, Z.; Jin, F.; Chen, M.; Chen, L. A nanoporous nickel catalyst for selective hydrogenation of carbonates into formic acid in water. Green Chem. 2017, 19, 716−721. (544) Bhadra, S.; Saha, A.; Ranu, B. C. One-pot copper nanoparticlecatalyzed synthesis of S-aryl- and S-vinyl dithiocarbamates in water: high diastereoselectivity achieved for vinyl dithiocarbamates. Green Chem. 2008, 10, 1224−1230. (545) Saha, A.; Saha, D.; Ranu, B. C. Copper nano-catalyst: sustainable phenyl-selenylation of aryl iodides and vinyl bromides in water under ligand free conditions. Org. Biomol. Chem. 2009, 7, 1652− 1657. (546) Ahammed, S.; Saha, A.; Ranu, B. C. Hydrogenation of Azides over Copper Nanoparticle Surface Using Ammonium Formate in Water. J. Org. Chem. 2011, 76, 7235−7239. (547) Alonso, F.; Moglie, Y.; Radivoy, G.; Yus, M. Click chemistry from organic halides, diazonium salts and anilines in water catalyzed by copper nanoparticles on activated carbon. Org. Biomol. Chem. 2011, 9, 6385−6395. (548) Nasir Baig, R. B.; Varma, R. S. A highly active magnetically recoverable nano ferrite-glutathione-copper (nano-FGT-Cu) catalyst for Huisgen 1,3-dipolar cycloadditions. Green Chem. 2012, 14, 625− 632. (549) Wang, C.; Ciganda, R.; Salmon, L.; Gregurec, D.; Irigoyen, J.; Moya, S.; Ruiz, J.; Astruc, D. Highly Efficient Transition Metal Nanoparticle Catalysts in Aqueous Solutions. Angew. Chem., Int. Ed. 2016, 55, 3091−3095. (550) Gayen, K. S.; Sengupta, T.; Saima, Y.; Das, A.; Maiti, D. K.; Mitra, A. Cu(0) nanoparticle catalyzed efficient reductive cleavage of isoxazoline, carbonyl azide and domino cyclization in water medium. Green Chem. 2012, 14, 1589−1592. (551) Xu, H.-J.; Liang, Y.-F.; Cai, Z.-Y.; Qi, H.-X.; Yang, C.-Y.; Feng, Y.-S. CuI-Nanoparticle-Catalyzed Selective Synthesis of Phenols, Anilines, and Thiophenols from Aryl Halides in Aqueous Solution. J. Org. Chem. 2011, 76, 2296−2300. (552) Mou, J.; Gao, G.; Chen, C.; Liu, J.; Gao, J.; Liu, Y.; Pei, D. Highly efficient one-pot three-component Betti reaction in water using reverse zinc oxide micelles as a recoverable and reusable catalyst. RSC Adv. 2016, 6, 95951−95956. (553) Hossaini, Z.; Zareyee, D.; Sheikholeslami-Farahani, F.; Vaseghi, S.; Zamani, A. ZnO-NR as the efficient catalyst for the synthesis of new thiazole and cyclopentadienone phosphonate derivatives in water. Heteroat. Chem. 2017, 28, e21362. (554) Payra, S.; Saha, A.; Banerjee, S. On-water magnetic NiFe2O4 nanoparticle-catalyzed Michael additions of active methylene compounds, aromatic/aliphatic amines, alcohols and thiols to conjugate alkenes. RSC Adv. 2017, 7, 13868−13875. (555) Naik, T. R. R.; Shivashankar, S. A. Heterogeneous bimetallic ZnFe2O4 nanopowder catalyzed synthesis of Hantzsch 1,4-dihydropyridines in water. Tetrahedron Lett. 2016, 57, 4046−4049. (556) Kundu, D.; Chatterjee, T.; Ranu, B. C. Magnetically Separable CuFe2O4 Nanoparticles Catalyzed Ligand-Free C-S Coupling in Water: Access to (E)- and (Z)-Styrenyl-, Heteroaryl and Sterically Hindered Aryl Sulfides. Adv. Synth. Catal. 2013, 355, 2285−2296. (557) Ohtaka, A.; Yamaguchi, T.; Nishikiori, R.; Shimomura, O.; Nomura, R. One-pot Synthesis of Dibenzyls and 3-Arylpropionic Acids Catalyzed by Linear Polystyrene-Stabilized Palladium Oxide Nanoparticles in Water. Asian J. Org. Chem. 2013, 2, 399−402. (558) Ohtaka, A.; Sakaguchi, E.; Yamaguchi, T.; Hamasaka, G.; Uozumi, Y.; Shimomura, O.; Nomura, R. A Recyclable “Boomerang” Linear Polystyrene-Stabilized Pd Nanoparticles for the Suzuki Coupling Reaction of Aryl Chlorides in Water. ChemCatChem 2013, 5, 2167−2169. (559) Ohtaka, A.; Okagaki, T.; Hamasaka, G.; Uozumi, Y.; Shinagawa, T.; Shimomura, O.; Nomura, R. Application of “Boomerang” Linear Polystyrene-Stabilized Pd Nanoparticles to a Series of C-C coupling Reactions in Water. Catalysts 2015, 5, 106− 118. (560) Sakon, A.; Ii, R.; Hamasaka, G.; Uozumi, Y.; Shinagawa, T.; Shimomura, O.; Nomura, R.; Ohtaka, A. Detailed Mechanism for

Hiyama Coupling Reaction in Water Catalyzed by Linear PolystyreneStabilized PdO Nanoparticles. Organometallics 2017, 36, 1618−1622. (561) Polshettiwar, V.; Varma, R. S. Nanoparticle-Supported and Magnetically Recoverable Ruthenium Hydroxide Catalyst: Efficient Hydration of Nitriles to Amides in Aqueous Medium. Chem. - Eur. J. 2009, 15, 1582−1586. (562) Khoshnavazi, R.; Bahrami, L.; Havasi, F.; Naseri, E. H3PW12O40 supported on functionalized polyoxometalate organicinorganic hybrid nanoparticles as efficient catalysts for threecomponent Mannich-type reactions in water. RSC Adv. 2017, 7, 11510−11521. (563) Shrestha, R.; Sharma, K.; Lee, Y. R.; Wee, Y.-J. Cerium oxidecatalyzed multicomponent condensation approach to spirooxindoles in water. Mol. Diversity 2016, 20, 847−858. (564) Edayadulla, N.; Lee, Y. R. Cerium oxide nanoparticle-catalyzed three-component protocol for the synthesis of highly substituted novel quinoxalin-2-amine derivatives and 3,4-dihydroquinoxalin-2-amines in water. RSC Adv. 2014, 4, 11459−11468. (565) Saha, A.; Payra, S.; Banerjee, S. On water synthesis of pyranchromenes via a multicomponent reactions catalyzed by fluorescent tZrO2 nanoparticles. RSC Adv. 2015, 5, 101664−101671. (566) Miyamura, H.; Matsubara, R.; Kobayashi, S. Gold-platinum bimetallic clusters for aerobic oxidation of alcohols under ambient conditions. Chem. Commun. 2008, 2031. (567) Miyamura, H.; Suzuki, A.; Yasukawa, T.; Kobayashi, S. Integrated Process of Aerobic Oxidation-Olefination-Asymmetric C-C Bond Formation Catalyzed by Robust Heterogeneous Gold/Palladium and Chirally Modified Rhodium Nanoparticles. Adv. Synth. Catal. 2015, 357, 3815−3819. (568) Zhang, H.; Watanabe, T.; Okumura, M.; Haruta, M.; Toshima, N. Catalytically high active top gold atom on palladium nanocluster. Nat. Mater. 2012, 11, 49−52. (569) Wan, X.; Zhou, C.; Chen, J.; Deng, W.; Zhang, Q.; Yang, Y.; Wang, Y. Base-Free Aerobic Oxidation of 5-Hydroxymethyl-furfural to 2,5-Furandicarboxylic Acid in Water Catalyzed by Functionalized Carbon Nanotube-Supported Au-Pd Alloy Nanoparticles. ACS Catal. 2014, 4, 2175−2185. (570) Choudhary, H.; Ebitani, K. Hydrotalcite-supported PdPtcatalyzed Aerobic Oxidation of 5-Hydroxymethylfurfural to 2,5Furandicarboxylic Acid in Water. Chem. Lett. 2016, 45, 613−615. (571) Nabid, M. R.; Bide, Y.; Abuali, M. Coppercoresilvershell nanoparticle-yolk/shell Fe3O4@chitosan-derived carbon nanoparticle composite as an efficient catalyst for catalytic epoxidation in water. RSC Adv. 2014, 4, 35844−35851. (572) Mizugaki, T.; Togo, K.; Maeno, Z.; Mitsudome, T.; Jistukawa, K.; Kaneda, K. One-Pot Transformation of Levulinic Acid to 2Methyltetrahydrofuran Catalyzed by Pt-Mo/H-β in Water. ACS Sustainable Chem. Eng. 2016, 4, 682−685. (573) Takanashi, T.; Nakagawa, Y.; Tomishige, K. Amination of Alcohols with Ammonia in Water over Rh-In Catalyst. Chem. Lett. 2014, 43, 822−824. (574) Albadi, J.; Alihoseinzadeh, A.; Mansournezhad, A.; Kaveiani, L. Novel Metal Oxide of CuO-ZnO Nanocatalyst Efficiently Catalyzed the Synthesis of 2-Amino-4H-chromenes in Water. Synth. Commun. 2015, 45, 485−493. (575) Yang, J.; Shen, X.; Li, Y.; Bian, L.; Dai, J.; Yuan, D. Bismuth Tungstate-Reduced Graphene Oxide Self-Assembled Nanocomposites for the Selective Photocatalytic Oxidation of Alcohols in Water. ChemCatChem 2016, 8, 1399−1409. (576) Li, X.-B.; Li, Z.-J.; Gao, Y.-J.; Meng, Q.-Y.; Yu, S.; Weiss, R. G.; Tung, C.-H.; Wu, L.-Z. Mechanistic Insights into the InterfaceDirected Transformation of Thiols into Disulfides and Molecular Hydrogen by Visible-Light Irradiation of Quantum Dots. Angew. Chem., Int. Ed. 2014, 53, 2085−2089. (577) Zhao, L.-M.; Meng, Q.-Y.; Fan, X.-B.; Ye, C.; Li, X.-B.; Chen, B.; Ramamurthy, V.; Tung, C.-H.; Wu, L.-Z. Photocatalysis with Quantum Dots and Visible Light: Selective and Efficient Oxidation of Alcohols to Carbonyl Compounds through a Radical Relay Process in Water. Angew. Chem., Int. Ed. 2017, 56, 3020−3024. 743


Chemical Reviews

Review

(578) Orito, Y.; Imai, S.; Niwa, S.; Nguyen, G. H. Asymmetric hydrogenation of methyl benzoylformate using platinum-carbon catalysts modified with cinchonidine. J. Synth. Org. Chem. Jpn. 1979, 37, 173−174. (579) Felföldi, K.; Szön, K.; Bartók, M. Heterogeneous asymmetric reaction: Part 35. Enantioselective hydrogenation of 2-oxoglutaric acid over cinchona modified Pt/Al2O3 catalysts. Appl. Catal., A 2003, 251, 457−460. (580) Mévellec, V.; Mattioda, C.; Schulz, J.; Rolland, J.-P.; Roucoux, A. Enantioselective hydrogenation of ethyl pyruvate in biphasic liquidliquid media by reusable surfactant-stabilized aqueous suspensions of platinum nanoparticles. J. Catal. 2004, 225, 1−6. (581) Bilé, E. G.; Cortelazzo-Polisini, E.; Denicourt-Nowicki, A.; Sassine, R.; Launay, F.; Roucoux, A. Chiral Ammonium-Capped Rhodium(0) Nanocatalysts: Synthesis, Characterization, and Advances in Asymmetric Hydrogenation in Neat Water. ChemSusChem 2012, 5, 91−101. (582) Sugimura, T.; Kim, T. Y. Enantioselective Hydrogenation in Water Over Chiral Modified Heterogeneous Catalyst Admixed With Organic Solvent. Catal. Lett. 2009, 130, 564−567. (583) Mora, M.; Jiménez-Sanchidrián, C.; Ruiz, J. R. Suzuki CrossCoupling Reactions Over Pd(II)-Hydrotalcite Catalysts in Water. J. Mol. Catal. A: Chem. 2008, 285, 79−83. (584) Bhonde, V. R.; O’Neill, B. T.; Buchwald, S. L. An Improved System for the Aqueous Lipshutz-Negishi Cross-Coupling of Alkyl Halides with Aryl Electrophiles. Angew. Chem., Int. Ed. 2016, 55, 1849−1853. (585) Cavarzan, A.; Bianchini, G.; Sgarbossa, P.; Lefort, L.; Gladiali, S.; Scarso, A.; Strukul, G. Catalytic Asymmetric Baeyer-Villiger Oxidation in Water by Using PtII Catalysts and Hydrogen Peroxide: Supramolecular Control of Enantioselectivity. Chem. - Eur. J. 2009, 15, 7930−7939. (586) Trentin, F.; Chapman, A. M.; Scarso, A.; Sgarbossa, P.; Michelin, R. A.; Strukul, G.; Wass, D. F. Platinum(II) Diphosphinamine Complexes for the Efficient Hydration of Alkynes in Micellar Media. Adv. Synth. Catal. 2012, 354, 1095−1104. (587) Kitanosono, T.; Miyo, M.; Kobayashi, S. The Combined Use of Cationic Palladium(II) with a Surfactant for the C−H Functionalization of Indoles and Pyrroles in Water. Tetrahedron 2015, 71, 7739− 7744. (588) Kitanosono, T.; Miyo, M.; Kobayashi, S. Surfactant-Aided Chiral Palladium(II) Catalysis Exerted Exclusively in Water for the C− H Functionalization of Indoles. ACS Sustainable Chem. Eng. 2016, 4, 6101−6106. (589) Deraedt, C.; Astruc, D. “Homeopathic” Palladium Nanoparticle Catalysis of Cross Carbon−Carbon Coupling Reactions. Acc. Chem. Res. 2014, 47, 494−503. (590) Kobayashi, S.; Wakabayashi, T.; Nagayama, S.; Oyamada, H. Lewis Acid Catalysis in Micellar Systems. Sc(OTf)3-Catalyzed Aqueous Aldol Reactions of Silyl Enol Ethers with Aldehydes in the Presence of a Surfactant. Tetrahedron Lett. 1997, 38, 4559−4562. (591) Kobayashi, S.; Wakabayashi, T.; Oyamada, H. Use of an Organometallic Reagent in Water: Sc(OTf)3-Catalyzed Allylation Reactions of Aldehydes in Micellar Systems. Chem. Lett. 1997, 26, 831−832. (592) Ollevier, T.; Lavie-Compin, G. Bismuth Triflate-Catalyzed Mild and Efficient Epoxide Opening by Aromatic Amines Under Aqueous Conditions. Tetrahedron Lett. 2004, 45, 49−52. (593) Ogawa, C.; Azoulay, S.; Kobayashi, S. Bismuth Triflate-Chiral Bipyridine Complex Catalyzed Asymmetric Ring Opening Reactions of Meso-Epoxide in Water. Heterocycles 2005, 66, 201−206. (594) Wang, S.; William, R.; Georgina Estelle Seah, K. K.; Liu, X.-W. Lewis Acid−Surfactant-Combined Catalyzed Synthesis of 4-Aminocyclopentenones From Glycals in Water. Green Chem. 2013, 15, 3180−3184. (595) Ohara, M.; Hara, Y.; Ohnuki, T.; Nakamura, S. Direct Enantioselective Three-Component Synthesis of Optically Active Propargylamines in Water. Chem. - Eur. J. 2014, 20, 8848−8851.

(596) Kraïem, J.; Ollevier, T. Atom Economical Synthesis of N -Alkylbenzamides via the Iron(III) Sulfate Catalyzed Rearrangement of 2-Alkyl-3-Aryloxaziridines in Water and in the Presence of a Surfactant. Green Chem. 2017, 19, 1263−1267. (597) Jeffery, T. Heck-Type Reactions in Water. Tetrahedron Lett. 1994, 35, 3051−3054. (598) Kitawat, B. S.; Singh, M.; Kale, R. K. Robust Cationic Quaternary Ammonium Surfactant-Catalyzed Condensation Reaction for (E)-3-Aryl-1-(3-Alkyl-2-Pyrazinyl)-2-Propenone Synthesis in Water at Room Temperature. ACS Sustainable Chem. Eng. 2013, 1, 1040−1044. (599) Ding, Q.; Cao, B.; Liu, X.; Zong, Z.; Peng, Y.-Y. Synthesis of 2Aminobenzothiazole via FeCl3-Catalyzed Tandem Reaction of 2Iodoaniline with Isothiocyanate in Water. Green Chem. 2010, 12, 1607−1614. (600) Shang, X.; Zhao, S.; Chen, W.; Chen, C.; Qiu, H. CopperCatalyzed Cascade Cyclization Reaction of 2-Haloaryltriazenes and Sodium Azide: Selective Synthesis of 2 H-Benzotriazoles in Water. Chem. - Eur. J. 2014, 20, 1825−1828. (601) Colladon, M.; Scarso, A.; Strukul, G. Towards a Greener Epoxidation Method: Use of Water-Surfactant Media and Catalyst Recycling in the Platinum-Catalyzed Asymmetric Epoxidation of Terminal Alkenes with Hydrogen Peroxide. Adv. Synth. Catal. 2007, 349, 797−801. (602) Duplais, C.; Krasovskiy, A.; Lipshutz, B. H. Organozinc Chemistry Enabled by Micellar Catalysis. Palladium-Catalyzed CrossCouplings between Alkyl and Aryl Bromides in Water at Room Temperature. Organometallics 2011, 30, 6090−6097. (603) Ding, X.; Bai, J.; Wang, H.; Zhao, B.; Li, J.; Ren, F. A Mild and Regioselective Ullmann Reaction of Indazoles with Aryliodides in Water. Tetrahedron 2017, 73, 172−178. (604) Mattiello, S.; Rooney, M.; Sanzone, A.; Brazzo, P.; Sassi, M.; Beverina, L. Suzuki−Miyaura Micellar Cross-Coupling in Water, at Room Temperature, and Under Aerobic Atmosphere. Org. Lett. 2017, 19, 654−657. (605) Lipshutz, B. H.; Taft, B. R. Heck Couplings at Room Temperature in Nanometer Aqueous Micelles†. Org. Lett. 2008, 10, 1329−1332. (606) Lipshutz, B. H.; Ghorai, S. Designer-Surfactant-Enabled CrossCouplings in Water at Room Temperature. Aldrichimica Acta 2012, 45, 3−16. (607) Lipshutz, B. H.; Ghorai, S.; Abela, A. R.; Moser, R.; Nishikata, T.; Duplais, C.; Krasovskiy, A.; Gaston, R. D.; Gadwood, R. C. TPGS750-M: a Second-Generation Amphiphile for Metal-Catalyzed CrossCouplings in Water at Room Temperature. J. Org. Chem. 2011, 76, 4379−4391. (608) Lipshutz, B. H.; Huang, S.; Leong, W. W. Y.; Zhong, G.; Isley, N. A. C−C Bond Formation via Copper-Catalyzed Conjugate Addition Reactions to Enones in Water at Room Temperature. J. Am. Chem. Soc. 2012, 134, 19985−19988. (609) Lu, G.-P.; Cai, C.; Lipshutz, B. H. Stille Couplings in Water at Room Temperature. Green Chem. 2013, 15, 105−109. (610) Isley, N. A.; Gallou, F.; Lipshutz, B. H. Transforming Suzuki− Miyaura Cross-Couplings of MIDA Boronates Into a Green Technology: No Organic Solvents. J. Am. Chem. Soc. 2013, 135, 17707−17710. (611) Kelly, S. M.; Lipshutz, B. H. Chemoselective Reductions of Nitroaromatics in Water at Room Temperature. Org. Lett. 2013, 16, 98−101. (612) Fennewald, J. C.; Lipshutz, B. H. Trifluoromethylation of Heterocycles in Water at Room Temperature. Green Chem. 2014, 16, 1097−1100. (613) Isley, N. A.; Linstadt, R. T. H.; Slack, E. D.; Lipshutz, B. H. Copper-Catalyzed Hydrophosphinations of Styrenes in Water at Room Temperature. Dalton Trans. 2014, 43, 13196−13200. (614) Minkler, S. R. K.; Isley, N. A.; Lippincott, D. J.; Krause, N.; Lipshutz, B. H. Leveraging the Micellar Effect: Gold-Catalyzed Dehydrative Cyclizations in Water at Room Temperature. Org. Lett. 2014, 16, 724−726. 744


Chemical Reviews

Review

Heterocycle, Alcohol and Thiol Derivatives in Water. Adv. Synth. Catal. 2006, 348, 2585−2589. (635) Ogawa, C.; Wangang, N.; Boudou, M.; AzoulayAzoulay, S.; Manabe, K.; Kobayashi, S. Scandium-Catalyzed Ring-Opening Desymmetrization of Meso-Eoxides. Heterocycles 2007, 72, 589−598. (636) Kokubo, M.; Ogawa, C.; Kobayashi, S. Lewis Acid Catalysis in Water with a Hydrophilic Substrate: Scandium-Catalyzed Hydroxymethylation with Aqueous Formaldehyde in Water. Angew. Chem., Int. Ed. 2008, 47, 6909−6911. (637) Kokubo, M.; Kobayashi, S. Nazarov-Type Reactions in Water. Chem. - Asian J. 2009, 4, 526−528. (638) Zhang, L.; Wu, J. Friedländer Synthesis of Quinolines Using a Lewis Acid-Surfactant-Combined Catalyst in Water. Adv. Synth. Catal. 2007, 349, 1047−1051. (639) Kobayashi, S.; Mori, Y.; Nagayama, S.; Manabe, K. Catalytic Asymmetric Aldol Reactions in Water. Using a Chiral Lewis Acid− Surfactant-Combined Catalyst. Green Chem. 1999, 1, 175−177. (640) Lafantaisie, M.; Mirabaud, A.; Plancq, B.; Ollevier, T. Iron(II)Derived Lewis Acid/Surfactant Combined Catalysis for the Enantioselective Mukaiyama Aldol Reaction in Pure Water. ChemCatChem 2014, 6, 2244−2247. (641) Kokubo, M.; Naito, T.; Kobayashi, S. Chiral Zinc(II) and Copper(II)-Catalyzed Asymmetric Ring-Opening Reactions of MesoEpoxides with Aniline and Indole Derivatives. Tetrahedron 2010, 66, 1111−1118. (642) Pradhan, K.; Paul, S.; Das, A. R. Fe(DS)3, an Efficient Lewis Acid-Surfactant-Combined Catalyst (LASC) for the One Pot Synthesis of Chromeno[4,3-B]Chromene Derivatives by Assembling the Basic Building Blocks. Tetrahedron Lett. 2013, 54, 3105−3110. (643) Nagano, T. T.; Kobayashi, S. Iron Catalyst for Oxidation in Water: Surfactant-Type Iron Complex-Catalyzed Mild and Efficient Oxidation of Aryl Alkanes Using Aqueous TBHP as Oxidant in Water. Chem. Lett. 2008, 37, 1042−1043. (644) Firouzabadi, H.; Iranpoor, N.; Khoshnood, A. Aluminum Tris (Dodecyl Sulfate) Trihydrate Al(DS)3·3H2O as an Efficient Lewis Acid−Surfactant-Combined Catalyst for Organic Reactions in Water. J. Mol. Catal. A: Chem. 2007, 274, 109−115. (645) Jafarpour, M.; Rezaeifard, A.; Aliabadi, M. An Environmentally Benign Catalytic Method for Efficient and Selective Nucleophilic Ring Opening of Oxiranes by Zirconium Tetrakis(Dodecyl Sulfate). Helv. Chim. Acta 2010, 93, 405−413. (646) Jafarpour, M.; Rezaeifard, A.; Aliabadi, M. Zirconium Tetrakis(Dodecylsulfate) as an Efficient and Recyclable Lewis AcidSurfactant-Combined Catalyzed C-C and C-N Bond Forming Under Mild and Environmentally Benign Conditions. Lett. Org. Chem. 2009, 6, 94−99. (647) Zolfigol, M. A.; Salehi, P.; Ghaderi, A.; Shiri, M.; Tanbakouchian, Z. An Eco-Friendly Procedure for the Synthesis of Polysubstituted Quinolines Under Aqueous Media. J. Mol. Catal. A: Chem. 2006, 259, 253−258. (648) Safaei, H. R.; Shekouhy, M.; Khademi, S.; Rahmanian, V.; Safaei, M. Diversity-Oriented Synthesis of Quinazoline Derivatives Using Zirconium Tetrakis(Dodecylsulfate) [Zr(DS)4] as a Reusable Lewis Acid-Surfactant-Combined Catalyst in Tap Water. J. Ind. Eng. Chem. 2014, 20, 3019−3024. (649) Zolfigol, M. A.; Salehi, P.; Shiri, M.; Tanbakouchian, Z. A New Catalytic Method for the Preparation of Bis-Indolyl and Tris-Indolyl Methanes in Aqueous Media. Catal. Commun. 2007, 8, 173−178. (650) Tang, Q.; Quan, H.-J.; Liu, S.; Liu, L.-T.; Chow, C.-F.; Gong, C.-B. An Environmentally Friendly, Photocontrollable and Highly Recyclable Catalyst for Use in a One-Pot Three-Component Mannich Reaction. J. Mol. Catal. A: Chem. 2016, 421, 37−44. (651) Nagayama, S.; Kobayashi, S. A Novel Polymer-Supported Scandium Catalyst Which Shows High Activity in Water. Angew. Chem., Int. Ed. 2000, 39, 567−569. (652) Zhao, S.; Cheng, M.; Li, J.; Tian, J.; Wang, X. One pot production of 5-hydroxymethylfurfural with high yield from cellulose by a Brønsted−Lewis−surfactant-combined heteropolyacid catalyst. Chem. Commun. 2011, 47, 2176−2178.

(615) Handa, S.; Lippincott, D. J.; Aue, D. H.; Lipshutz, B. H. Asymmetric Gold-Catalyzed Lactonizations in Water at Room Temperature. Angew. Chem., Int. Ed. 2014, 53, 10658−10662. (616) Isley, N. A.; Hageman, M. S.; Lipshutz, B. H. Dehalogenation of Functionalized Alkyl Halides in Water at Room Temperature. Green Chem. 2015, 17, 893−897. (617) Isley, N. A.; Linstadt, R. T. H.; Kelly, S. M.; Gallou, F.; Lipshutz, B. H. Nucleophilic Aromatic Substitution Reactions in Water Enabled by Micellar Catalysis. Org. Lett. 2015, 17, 4734−4737. (618) Cortes-Clerget, M.; Berthon, J.-Y.; Krolikiewicz-Renimel, I.; Chaisemartin, L.; Lipshutz, B. H. Tandem deprotection/coupling for peptide synthesis in water at room temperature. Green Chem. 2017, 19, 4263−4267. (619) Klumphu, P.; Lipshutz, B. H. “Nok”: a Phytosterol-Based Amphiphile Enabling Transition-Metal-Catalyzed Couplings in Water at Room Temperature. J. Org. Chem. 2014, 79, 888−900. (620) Fennewald, J. C.; Landstrom, E. B.; Lipshutz, B. H. Reductions of Aryl Bromides in Water at Room Temperature. Tetrahedron Lett. 2015, 56, 3608−3611. (621) Daniels, M. H.; Armand, J. R.; Tan, K. L. Sequential Regioselective C−H Functionalization of Thiophenes. Org. Lett. 2016, 18, 3310−3313. (622) da Costa, J. S.; Braun, R. K.; Horn, P. A.; Lüdtke, D. S.; Moro, A. V. Copper-Catalyzed Hydroboration of Propargyl-Functionalized Alkynes in Water. RSC Adv. 2016, 6, 59935−59938. (623) Klumphu, P.; Desfeux, C.; Zhang, Y.; Handa, S.; Gallou, F.; Lipshutz, B. H. Micellar catalysis-enabled sustainable ppm Aucatlayzed reactions in water at room temperature. Chem. Sci. 2017, 8, 6354−6358. (624) Billamboz, M.; Mangin, F.; Drillaud, N.; Chevrin-Villette, C.; Banaszak-Léonard, E.; Len, C. Micellar Catalysis Using a Photochromic Surfactant: Application to the Pd-Catalyzed Tsuji−Trost Reaction in Water. J. Org. Chem. 2013, 79, 493−500. (625) Ballistreri, F.; Gangemi, C.; Pappalardo, A.; Tomaselli, G.; Toscano, R.; Sfrazzetto, G. T. (Salen)Mn(III) Catalyzed Asymmetric Epoxidation Reactions by Hydrogen Peroxide in Water: a Green Protocol. Int. J. Mol. Sci. 2016, 17, 1112. (626) Kobayashi, S.; Wakabayashi, T. Scandium Trisdodecylsulfate (STDS). a New Type of Lewis Acid That Forms Stable Dispersion Systems with Organic Substrates in Water and Accelerates Aldol Reactions Much Faster in Water Than in Organic Solvents. Tetrahedron Lett. 1998, 39, 5389−5392. (627) Manabe, K.; Mori, Y.; Kobayashi, S. Effects of Lewis AcidSurfactant-Combined Catalysts on Aldol and Diels-Alder Reactions in Water. Tetrahedron 1999, 55, 11203−11208. (628) Manabe, K.; Mori, Y.; Nagayama, S.; Odashima, K.; Kobayashi, S. Synthetic Reactions Using Organometallics in Water. Aldol and Allylation Reactions Catalyzed by Lewis Acid−Surfactant-Combined Catalysts/Brønsted Acids Systems. Inorg. Chim. Acta 1999, 296, 158− 163. (629) Manabe, Kei; Mori, Yuichiro; Wakabayashi, Takeshi; Satoshi Nagayama, A.; Kobayashi, S. Organic Synthesis Inside Particles in Water: Lewis Acid−Surfactant-Combined Catalysts for Organic Reactions in Water Using Colloidal Dispersions as Reaction Media. J. Am. Chem. Soc. 2000, 122, 7202−7207. (630) Manabe, K.; Kobayashi, S. Facile Synthesis of A-Amino Phosphonates in Water Using a Lewis Acid−Surfactant-Combined Catalyst. Chem. Commun. 2000, 669−670. (631) Mori, Y.; Kakumoto, K.; Manabe, K.; Kobayashi, S. Michael Reactions in Water Using Lewis Acid−Surfactant-Combined Catalysts. Tetrahedron Lett. 2000, 41, 3107−3111. (632) Manabe, K.; Aoyama, N.; Kobayashi, S. Friedel−Crafts-Type Conjugate Addition of Indoles Using a Lewis Acid−SurfactantCombined Catalyst in Water. Adv. Synth. Catal. 2001, 343, 174−176. (633) Azoulay, S.; Manabe, K. K.; Kobayashi, S. Catalytic Asymmetric Ring Opening of Meso-Epoxides with Aromatic Amines in Water. Org. Lett. 2005, 7, 4593−4595. (634) Boudou, M.; Ogawa, C.; Kobayashi, S. Chiral ScandiumCatalysed Enantioselective Ring-Opening of Meso-Epoxides with N745


Chemical Reviews

Review

(653) Yang, W.; Yang, Z.; Xu, L.; Zhang, L.; Xu, X.; Miao, M.; Ren, H. Surfactant-Type Brønsted Acid Catalyzed Stereoselective Synthesis of Trans-3-Alkenyl Indazoles From Triazenylaryl Allylic Alcohols in Water. Angew. Chem., Int. Ed. 2013, 52, 14135−14139. (654) Sharma, S. D.; Gogoi, P.; Konwar, D. A Highly Efficient and Green Method for the Synthesis of 3,4-Dihydropyrimidin-2-Ones and 1,5-Benzodiazepines Catalyzed by Dodecyl Sulfonic Acid in Water. Green Chem. 2007, 9, 153−157. (655) Liu, Y.-L.; Liu, L.; Wang, Y.-L.; Han, Y.-C.; Wang, D.; Chen, Y.-J. Calix[ N ]Arene Sulfonic Acids Bearing Pendant Aliphatic Chains as Recyclable Surfactant -Type Brønsted Acid Catalysts for Allylic Alkylation with Allyl Alcohols in Water. Green Chem. 2008, 10, 635− 640. (656) Kumar, A.; Gupta, M. K.; Kumar, M. Micelle Promoted Supramolecular Carbohydrate Scaffold-Catalyzed Multicomponent Synthesis of 1,2-Dihydro-1-Aryl-3 H -Naphth[1,2-E][1,3]Oxazin-3One and Amidoalkyl Naphthols Derivatives in Aqueous Medium. RSC Adv. 2012, 2, 7371−7376. (657) Shekouhy, M. Sulfuric Acid-Modified PEG-6000 (PEG-OSO 3 H): an Efficient Brönsted Acid− Surfactant Combined Catalyst for the One-Pot Three Component Synthesis of A-Aminonitriles in Water. Catal. Sci. Technol. 2012, 2, 1010−1020. (658) Azoui, H.; Baczko, K.; Cassel, S.; Larpent, C. Thermoregulated Aqueous Biphasic Catalysis of Heck Reactions Using an Amphiphilic Dipyridyl-Based Ligand. Green Chem. 2008, 10, 1197−1197. (659) Lipshutz, B. H.; Ghorai, S. PQS: a New Platform for Micellar Catalysis. RCM Reactions in Water, with Catalyst Recycling. Org. Lett. 2009, 11, 705−708. (660) Lipshutz, B. H.; Ghorai, S. PQS-2: Ring-Closing- and CrossMetathesis Reactions on Lipophilic Substrates; in Water Only at Room Temperature, with in-Flask Catalyst Recycling. Tetrahedron 2010, 66, 1057−1063. (661) Lipshutz, B. H.; Isley, N. A.; Moser, R.; Ghorai, S.; Leuser, H.; Taft, B. R. Rhodium-Catalyzed Asymmetric 1,4-Additions, in Water at Room Temperature, with In-Flask Catalyst Recycling. Adv. Synth. Catal. 2012, 354, 3175−3179. (662) Monnereau, L.; Sémeril, D.; Matt, D.; Toupet, L. Micellar Effects in Olefin Hydroformylation Catalysed by Neutral, Calix[4]Arene-Diphosphite Rhodium Complexes. Adv. Synth. Catal. 2009, 351, 1629−1636. (663) Terashima, T.; Mes, T.; De Greef, T. F. A.; Gillissen, M. A. J.; Besenius, P.; Palmans, A. R. A.; Meijer, E. W. Single-Chain Folding of Polymers for Catalytic Systems in Water. J. Am. Chem. Soc. 2011, 133, 4742−4745. (664) Li, J.; Tang, Y.; Wang, Q.; Li, X.; Cun, L.; Zhang, X.; Zhu, J.; Li, L.; Deng, J. Chiral Surfactant-Type Catalyst for Asymmetric Reduction of Aliphatic Ketones in Water. J. Am. Chem. Soc. 2012, 134, 18522−18525. (665) Lin, Z.; Li, J.; Huang, Q.; Huang, Q.; Wang, Q.; Tang, L.; Gong, D.; Yang, J.; Zhu, J.; Deng, J. Chiral Surfactant-Type Catalyst: Enantioselective Reduction of Long-Chain Aliphatic Ketoesters in Water. J. Org. Chem. 2015, 80, 4419−4429. (666) Drinkel, E. E.; Campedelli, R. R.; Manfredi, A. M.; Fiedler, H. D.; Nome, F. Zwitterionic-Surfactant-Stabilized Palladium Nanoparticles as Catalysts in the Hydrogen Transfer Reductive Amination of Benzaldehydes. J. Org. Chem. 2014, 79, 2574−2579. (667) Mase, N.; Nakai, Y.; Ohara, N.; Yoda, H.; Takabe, K.; Tanaka, F.; Barbas, C. F., III Organocatalytic Direct Asymmetric Aldol Reactions in Water. J. Am. Chem. Soc. 2006, 128, 734−735. (668) Luo, S.; Mi, X.; Liu, S.; Xu, H.; Cheng, J.-P. Surfactant-Type Asymmetric Organocatalyst: Organocatalytic Asymmetric Michael Addition to Nitrostyrenes in Water. Chem. Commun. 2006, 3687− 3689. (669) Hayashi, Y.; Aratake, S.; Okano, T.; Takahashi, J.; Sumiya, T.; Shoji, M. Combined Proline-surfactant Organocatalyst for the Highly Diastereo- and Enantioselective Aqueous Direct Cross-Aldol Reaction of Aldehydes. Angew. Chem., Int. Ed. 2006, 45, 5527−5529.

(670) Zhong, L.; Gao, Q.; Gao, J.; Xiao, J.; Li, C. Direct Catalytic Asymmetric Aldol Reactions on Chiral Catalysts Assembled in the Interface of Emulsion Droplets. J. Catal. 2007, 250, 360−364. (671) Lo, C.-M.; Chow, H.-F. Structural Effects on the Catalytic, Emulsifying, and Recycling Properties of Chiral Amphiphilic Dendritic Organocatalysts. J. Org. Chem. 2009, 74, 5181−5191. (672) Lipshutz, B. H.; Ghorai, S. Organocatalysis in Water at Room Temperature with in-Flask Catalyst Recycling. Org. Lett. 2012, 14, 422−425. (673) Shekouhy, M.; Khalafi-Nezhad, A. Polyethylene GlycolBonded 1,8-Diazabicyclo[5.4.0]Undec-7-Ene (PEG−DBU) as a Surfactant-Combined Base Catalyst for the Application of Nucleosides as Reagents in Multi-Component Syntheses of 8-Substituted Pyrido[2,3-D]Pyrimidine-6-Carbonitriles in Water. Green Chem. 2015, 17, 4815−4829. (674) Duschmalé, J.; Kohrt, S.; Wennemers, H. Peptide catalysis in aqueous emulsions. Chem. Commun. 2014, 50, 8109−8112. (675) Soares, B. M.; Aguilar, A. M.; Silva, E. R.; Coutinho-Neto, M. D.; Hamley, I. W.; Reza, M.; Ruokolainen, J.; Alves, W. A. Chiral Organocatalysts Based on Lipopeptide Micelles for Aldol Reactions in Water. Phys. Chem. Chem. Phys. 2017, 19, 1181−1189. (676) Chen, B.-T.; Bukhryakov, K. V.; Sougrat, R.; Rodionov, V. O. Enzyme-Inspired Functional Surfactant for Aerobic Oxidation of Activated Alcohols to Aldehydes in Water. ACS Catal. 2015, 5, 1313− 1317.

746


Catalytic Organic Reactions in Water toward Sustainable Society

Recommend Documents