Cell-Imprinted Substrates Modulate Differentiation ... - ACS Publications

Subscriber access provided by UOW Library

Article

Cell Imprinted Substrates Modulate the Differentiation, Redifferentiation, and Transdifferentiation Shahin Bonakdar, Morteza Mahmoudi, Leila Montazeri, Mojtaba Taghipoor, Arnaud Bertsch, Mohammad Ali Shokrgozar, Shahriar Sharifi, Mohammad Majidi, Omid Mashinchian, Mohammad Hamrang Sekachaei, Pegah Zolfaghari, and Philippe Renaud ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b03302 • Publication Date (Web): 19 May 2016 Downloaded from http://pubs.acs.org on May 20, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Cell Imprinted Substrates Modulate the Differentiation, Redifferentiation, and Transdifferentiation Shahin Bonakdar†, Morteza Mahmoudi‡,§*, Leila MontazeriI, Mojtaba Taghipoor⊥, Arnaud Bertsch⊥, Mohammad Ali Shokrgozar†, Shahriar Sharifi#, Mohammad Majidi†, Omid MashinchianII, Mohammad Hamrang Sekachaei†, Pegah Zolfaghari†, Philippe Renaud⊥*

†National

Cell Bank, Pasteur Institute of Iran, Tehran, Iran, P.O. Box 1316943551

‡Department

of Nanotechnology & Nanotechnology Research Center, Faculty of Pharmacy,

Tehran University of Medical Sciences, P.O. Box 14155-6451, Tehran, Iran §Department

of Anesthesiology, Brigham and Women's Hospital, Harvard Medical School,

Boston, MA, USA IDepartment

of Stem Cells and Developmental Biology, Cell Science Research Center, Royan

Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran #MIRA

Institute for Biomedical Technology and Technical Medicine, Department of Biomaterials

Science and Technology, University of Twente, P.O. Box 217, 7500 AE, Enschede, The Netherlands ⊥

Laboratory of Microsystems (LMIS4), École Polytechnique Fédérale de Lausanne, Station 17,

CH-1015 Lausanne, Switzerland IIInstitute

of Bioengineering, School of Life Sciences, École Polytechnique Fédérale de Lausanne

(EPFL), Station 17, CH-1015 Lausanne, Switzerland

*Corresponding

Authors:

(MM) E-mail:

[email protected];

[email protected]

ACS Paragon Plus Environment

(PR)

E-mail:


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 28

ABSTRACT Differentiation of stem cells into mature cells, using physical approaches, is of quite interest. Here, we prepared smart nanoenvironments by cell-imprinted substrates based on chondrocytes, tenocyte, and semi-fibroblasts as templates and demonstrated their potential for differentiation,

re-differentiation,

and

trans-differentiation.

Analysis

of

shape

and

upregulation/downregulation of specific genes of stem cells, which were seeded on these cellimprinted substrates, confirmed that imprinted substrates have the capability to induce specific shape and molecular characteristics of the cell types which had been used as a template for the cell-imprinting. Interestingly, immuno-fluorescence staining of specific protein in chondrocytes (i.e., collagen type II) confirmed that ADSCs, semi-fibroblasts, and tenocyte can acquire the chondrocyte phenotype after a 14-days culturing on chondrocyte imprinted substrates. In summary, we propose that common polystyrene tissue culture plates can be replaced by this imprinting technique as an effective promising way to regulate any cell phenotype in vitro with significant potential applications in regenerative medicine and cell-based therapies. KEYWORDS: cell imprinting, ADSCs, trans-differentiation, re-differentiation, tenogenic differentiation, chondrogenic differentiation


Page 3 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION In the human body, the extracellular matrix (ECM) is considered as a supporting structure which can provide the required physical, mechanical, and chemical cues for proper cell functions including adhesion, migration, proliferation and differentiation 1. It is now believed that morphological structures, as well as mechanical loadings, direct the cell fate during embryonic developments 2. Although many researches have been conducted on cell-substrate interactions, we are still far away from making an efficient artificial ECM with the appropriate function. Potential therapeutic application of an adult or embryonic stem cells in regenerative medicine (e.g., in the restoration of heart tissue after myocardial infarction3), is a compelling field of interest, which forces scientists to discover/propose new approaches for regulation of cell biology. In the literature, inductive molecules such as growth factors have been known for a long time and have been suggested to control cell behavior, reprogram the cells and direct their differentiation in both in vitro and in vivo environments 4, 5. Although these approaches showed promising results, both artificial matrix and inductive medium are cell specific and must be precisely customized for each cell types to provide the best differentiation condition. These conditions are mimetically correlated to the chemical-, physical-, and mechanical-properties of the natural environment 6, 7. It is well understood that cells lose their original expected phenotype after isolation from their natural environment and culture in vitro 8. The cell membrane has complex chemical and topographical cues which are mostly recognized as flexible and textured structures. However, smooth and rigid transparent polystyrene (PS) tissue culture plates are widely used for cell culture in vitro 9. In spite of many attempts conducted on improving cell attachment to PS plates (such as by introduction of carboxyl and amine functional groups), the rigidity of these substrates (elastic modulus of ~3 GPa, more than five times of magnitude stiffer than skeletal muscle) may induce hard tissue (like bone) properties and osteogenic induction 10. In addition to mechanosensing aspect of cells such as elasticity and rigidity, the dimensionality sensing of the cells, which relates to the topography and geometry of the substrate, can also induce substantial effects on cell functions 11. Cells in their natural environment face various ranges of



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 28

dimensions, ranging from macro topographies such as the shape of muscles, tendons to microtopographies such as morphology or projections of adjacent cells and finally nano features such as protein conformation. Accumulating evidence now suggests that substrate topography can be manipulated to induce diverse effects with the cell such as alignment, polarization, elongation, migration, proliferation, gene expression which final results in differentiation or development of stem cells 12

. Surface topographies can be classified into different kinds of gratings, posts and pits from

nano to micro scales

13

. Also the geometry of the printed nano- and micro-patterns (e.g.

triangle, square, pentagon, hexagon, and circular shapes) plays a crucial role in the cytoskeletal tension of the cultured stem cells, which in turn has a significant influence on their differentiations 14, 15. As a growing number of precision nanofabrication techniques become available to the stem cell biologist such as lithography, micro-SLA etc., it is getting possible to begin to make various precise nanotopography and use noninvasive tools to investigate cellular functioning. For example, Unadkat et al. 16 introduced a method to create 2176 different surface topographies with varying height, size and shape (circle, triangle, rectangle). Markert et al.

17

examined the

potential of 504 distinct topographical microstructures on embryonic stem cells differentiation and stated that some sort of these structures can be substituted for feeder cells. Despite the intense scientific efforts for precise controlling of stem cell fates with engineered patterned substrates, reliable and cheap controlling of stem cell behavior outside the body is still a great challenge. Firstly, ECM has a complex hierarchy structure and fabrication of simple geometries consisting of grooves, ridges, dots or pits may not be sufficient to recapitulate ECM architecture. Also, designing an optimal topography for each cell type requires many trial and error attempts 18. In a recent report by Mahmoudi et al.

19

, cell imprinted substrates were manufactured to

induce required cues for chondrogenesis. Smart nano-environments were fabricated by cellimprinted substrates based on chondrocyte shapes as a template. This nano-imprinted topography derived from natural chondrocyte shapes acts as a shape cue and physical confining driving force which stimulates differentiation of stem cells to chondrocytes. The same results


Page 5 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were obtained from cell-imprinted substrates as morphological templates based on mature human keratinocyte

20

. The data acquired from atomic force microscopy and field emission

scanning electron microscopy revealed that the chondrocyte (or keratinocyte)-cell-imprinted PDMS casting procedure could imitate the surface morphology of the plasma membrane, at typical dimensions ranging from the nanoscale to the macroscale, which may provide the required topographical cell fingerprints to induce differentiation. Besides to morphological changes of the, targeted genotypic changes in the studied cell also supported the capability of the cell-imprinted substrates to differentiate the adipose-derived stem cells into keratinocyte and create a stratified epidermis-like structure. In another study, myoblast differentiation in mesenchymal stem cells was stimulated by myoblast imprinted substrates 21. Results showed that human embryonic stem cel followed the underlying myoblast pattern and more efficiently committed to myogenic fate. This might pave the way to fabricate a reliable, efficient and cheap substrate, specific for any kind of cells. In this research, the cell imprinted strategy was employed to probe the stem cell differentiation in particular to evaluate the commitment of stem cell differentiation to desired phenotypes. To show the potential of cell imprinting to recapitulate the ECM architecture, chondrogenic and tenogenic differentiation, as well as teno-chondro trans-differentiation on PDMS cast of corresponding cells, were evaluated. The performance of cells on these biomimetic surfaces was further evaluated by gene expression and the corresponding protein production.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

2. EXPERIMENTAL METHODS 2.1. Cell Isolation and Culture In this study, adipose derived stem cells (ADSCs), tenocytes and chondrocyte isolated from bovine tissue were used. All the cells were freshly isolated based on Iran National Cell Bank protocols and previously published reports (see S1 and S2 for more details) 22. The cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM), and Ham’s F12 (Gibco, Switzerland) supplemented with 10% fetal bovine serum (FBS, Gibco) and penicillin (100 IU/ml)streptomycin (100 μg/ml) (Sigma, USA).

2.2. Fabrication Procedure of Cell-imprinted Substrates All the cells were freshly cultured and fixed in 4% glutaraldehyde (GLA, Sigma, USA) solution in phosphate buffer solution (PBS) at 4 °C for 24 h. It is noteworthy that the original phenotype of chondrocytes was changed after the second passage and considered as semi-fibroblast phenotype. The imprinting procedure was performed using silicon elastomer kit (PDMS, SYLGARD® 184, RTV, Dow Corning, USA) according to the manufacture protocols. The two parts of PDMS kit were mixed, poured on fixed cells and stored at 37 °C. After 24 hours, the cured PDMS was peeled off from the cells and washed two times in NaOH solution (1 M) at 100 °C. The total mass of imprinted PDMS, temperature and curing time were the same for all the samples. In addition, cell imprinted substrates were prepared to be fitted in 12-well plate. The imprinted substrates were observed by scanning electron microscopy (SEM, Zeiss LEO) and characterized by optical profiler (Veeco Wyko NT1100)


Page 6 of 28

Page 7 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.3. Cell Seeding on imprinted Substrates and characterizations The cells (1× 104) in 50 μl of culture medium were seeded on each imprinted sample and incubated at 37 °C. After 3 h, 1 ml culture medium was added to cover the cells and incubation maintained for 2 weeks with medium exchange every 4 days. Gene expression analysis and immuno-staining were conducted in the same way as previously published

20

. Tables 1 and 2

show the list of primer sequences and antibodies, respectively. For electron microscopy observations, the cells were fixed in 4% GLA and washed with deionized water (DI). The samples were gold coated and visualized by SEM. Table 1. The sequences of primers used in real-time PCR Primer GAPDH Collagen I Collagen II Aggrecan Sox9 Tenomodulin Decorin Tenascin

Sequence F: 5’- GGCACAGTCAAGGCAGAGAAC -3’ R: 5’- CCACATACTCAGCACCAGCATC -3’ F: 5’- GTCCTTCTGGTCCTCGTGGTC -3’ R: 5’- CTTCGCCATCATCTCCGTTC -3’ F: 5’- GGAGCAGCAAGAGCAAGGAC -3’ R: 5’- TGAGAGCCCTCGGTGGAC -3’ F: 5’- CACCACGCCTTCTGCTTCC -3’ R: 5’- TGTCACCATCCACTCCTCCAC -3’ F: 5’- GCTGGACTGGGAGTTGGAGAG -3’ R: 5’- AAGGCGAATTGGAGAGGAGG -3’ F: 5’- CCAGACAAGCAGCAAGTGAGG -3’ R: 5’- CGGCGACAGTAGCGGTTG -3’ F: 5’- TTGAACCAGATGATCGTCGTAGA -3’ R: 5’- GTGTCAGCAATGCGGATGTAG -3’ F: 5’- GTGGCACGGCAGGTGACT -3’ R: 5’- GGTTGACACGGTGGCAGTTC -3’

Length 115bp 159bp 151bp 105bp 179bp 133bp 113bp 141bp

Fw: Forward; Re: Reverse

Table 2. The employed antibodies for staining with their descriptions Product Type Phalloidin, FITC conjugated Primary antibody Primary antibody Primary antibody Secondary Antibody Secondary Antibody

Description Actin staining Mouse monoclonal Collagen II Rabbit polyclonal Collagen I Rabbit monoclonal Tenomodulin Goat polyclonal to Mouse IgG - H&L (Rhodamine) Goat polyclonal to Rabbit IgG - H&L (FITC)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3. RESULTS 3.1. Microscopy observations Figure 1 shows the SEM images of the cells and their imprinted PDMS substrates. This figure confirms that the spindle morphology of ADSCs, as well as the spherical morphology of chondrocytes, can be successfully transferred to the PDMS by the imprinting method. Figure 2 shows the profilemetry images and the corresponding power spectra of the cells and their imprinted PDMS substrates. Colors represent a relative thickness change over the lateral dimensions of the substrate, i.e., red represents thicker regions, while blue – thinner ones. As demonstrated in Figure 2, each surface has its own distinct features. For example, spherical morphology of chondrocytes and spindle morphology of the two other cells (tenocytes or ADSCs) are clearly visible in the pictures. The results obtained also showed that induction of specific cell shapes onto cells can result in their shape adaptation according to substrate profile. For example it was found that when cells with spindle morphology (semi-fibroblasts or ADSCs) cultured in chondrocytes imprint obtained from spherical shaped cell, the spindle morphology changed to spherical morphology (see Figure S1).

3.2. Gene expression analysis Figure 3 (a-d) shows the gene expression analysis of the cultured cells on imprinted patterns. It can be observed that the expression of decorin, tenascin and tenomodulin were increased in ADSCs cultured on tenocyte imprinted substrate (Figure 3-a). In addition, collagen II, aggrecan and SOX9 were upregulated for ADSCs cultured on chondrocyte imprinted substrate (Figure 3b). These two results confirm that differentiation of ADSCs can be regulated by cell shape


Page 8 of 28

Page 9 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


effect. Moreover, in order to examine the potential of re-differentiation and transdifferentiation of such cell imprinted substrates, semi-fibroblasts and tenocytes were cultured on chondrocyte imprinted substrates. Surprisingly, it was found that semi-fibroblasts can be redifferentiated to chondrocytes after seeding on chondrocyte imprinted substrate (Figure 3-c). Furthermore, the chondrogenic specific gene (collagen II) was upregulated, and tenogenic specific markers (decorin and tenomodulin) were down-regulated in tenocytes cultured on chondrocyte imprinted substrate (Figure 3-d). Collagen I is considered as the main component of tenocyte extracellular matrix

23

. Therefore, the higher ratio of collagen II to collagen I

expressions in tenocytes cultured on chondrocyte imprinted substrates may indicate the chondrogenic potential of the substrates. Since the expression of collagen I have been reported for ADSCs and de-differentiated chondrocytes 24, 25, it can be considered as relative criteria for comparison of other expressions. For ADSCs cultured on imprinted substrates in comparison with PDMS, the expression of collagen I decreased while other specific genes increased. For semi-fibroblasts, we can see 9 fold increase in the level of collagen I expression. However, the expression of collagen II and the ratio of collagen II to collagen I were increased, significantly which proves the imprinted substrates for re-differentiation.

3.3. Immuno-fluorescence staining Figure 4 (a-f) shows the actin cytoskeleton staining of semi-fibroblasts, tenocytes and ADSCs cultured on PS and imprinted substrates. The spindle morphology of all samples can be



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 28

observed. In fact, the spherical morphology of fresh chondrocytes changed to the spindle one in mono-layer culture. In Figure S2, the cells seeded on PS were stained with their specific antigens as a control. Tenomodulin and collagen II were selected for tenocytes and chondrocytes, respectively. It was found that tenocytes, ADSCs, and semi-fibroblasts were all stained with collagen I. Moreover, no staining was detected in ADSCs and semi-fibroblasts for collagen II. Therefore, detection of collagen II is considered as a specific indication for chondrogenic differentiation. The impact of cell imprinted topography on cell functions can be observed in Figure 5 (a-d). The actin cytoskeleton and nucleus compactness in spindle semi-fibroblasts entrapped in chondrocyte topography are totally different with the cells attached to the planar part of the substrates (figure 5-a2 and 5-a4). Moreover, staining of semi-fibroblasts with collagen II antibody demonstrated that these cells re-differentiate to chondrocyte phenotype when cultured on chondrocyte imprinted substrate (Figure 5-a3) compared to the semi-fibroblast imprinted substrate (Figure 5-b3). The same results were obtained for the ADSCs cultured on chondrocyte imprinted substrate (Figure 5-c3 and 5d3). Pellet culture of ADSCs for 21 days under differentiation medium (see S2) and immuno-staining of collagen II confirmed the potency of these cells for chondrogenic differentiation (figure S3). Furthermore, ADSCs cultured on imprinted substrates showed spherical morphologies on chondrocyte and spindle morphologies on semi-fibroblasts ones (figure S4). In Figure 6 (a-c), tenomodulin staining of the cultured ADSCs on tenocyte imprinted substrate can be observed which proved the expression of tenomodulin by ADSCs (figure 6-b2). In order to examine the potential of the cell imprinting method for trans-differentiation, tenocytes were


Page 11 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cultured on chondrocyte and tenocyte imprinted substrates and stained with collagen II. Figures 6-a and 6-b confirmed the anticipated gene expression profiles. It seems that tenocytes were stained with collagen type II and although the amount of collagen II expression in tenocytes was lower than semi-fibroblasts or ADSCs, chondrocyte topography can induce the chondrogenicity in tenocytes. Further information about the staining of controls such as collagen I in ADSCs and semi-fibroblasts was provided in figure S2.

4. DISCUSSION Despite the fact that surface topography and elasticity affect cell fate 26-28, the most prevalent containers for in vitro cell cultures are still fabricated from rigid transparent polystyrene (PS). However, growing cells in flat layers on plastic surfaces does not accurately model the in vivo state. Therefore, reverse engineering of cell surface patterns by the imprinting method can be considered as a promising technique for substrate fabrication. In this method, the mature cells are fixed and used as a template for PDMS imprinting. The imprinted patterns are utilized as a substrate to manipulate the cell phenotype and regulate the cell function. The differences between chondrocytes, tenocytes and ADSCs patterns can be observed by microscopy and profilometry analysis. The same observations were reported by Bruder et al. in their replication procedure from Schwann cells 29. With this simple imprinting method, the nano and micro scale features of the cells as well as their original phenotypes are transferred to the substrate. It can be seen from SEM images (figure S1) that spindle morphologies of semifibroblasts and ADSCs were turned into a spherical morphology when cultured on chondrocyte imprinted substrates. This result is also supported by phalloidin staining of actins where the spindle morphology of semi- fibroblasts is converted to a spherical one after culture on



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 28

chondrocytes imprinted substrates (figure 5-a2). The same results were also previously reported for rabbit stem cells 19. In addition, the spindle morphology of tenocytes (as observed in figure 6-a2) was converted to spherical morphology (in figure 6-c2) when tenocytes were cultured on chondrocyte imprinted substrates. Semi-fibroblasts and also ADSCs with spindle morphologies obtained spherical morphologies when cultured on the imprinted topographies of chondrocytes compared to the ADSCs or semifibroblast ones. On the other hand, the relative similarity of morphologies in tenocytes and ADSCs makes it difficult to discriminate the differences between these two types of cells. These findings declared the power of imprinted features to influence on cell morphologies. The results obtained in the gene expression analysis were further confirmed by immunostaining of cells. The analysis of the gene expressions showed that the specific genes can be upregulated when cells are cultured on imprinted substrates. Significant increase in expression of collagen type II (as a hallmark of chondrogenic differentiation) in both ADSCs and semifibroblast cells demonstrate the potency of the imprinting method. The same outcome was obtained for tenogenic differentiation. In fact, the tenocyte specific genes including tenascin, decorin and tenomodulin were upregulated for ADSCs cultured on tenocyte imprinted substrate. Immuno-staining of tenomodulin also confirmed the tenogenicity of tenocyte imprinted substrates. The cell imprinting method can be used in cell therapy and tissue engineering procedures in order to expand the cells up to adequate number before transplantation (figure 7). The expansion of chondrocytes in vitro in monolayer cultures leads to dedifferentiation of these cells toward semi-fibroblast phenotype

30, 31

. The presence of collagen type II in gene and


Page 13 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


protein expressions confirmed that imprinted substrates prepared from freshly isolated chondrocyte can stimulate semi-fibroblasts to re-differentiate into the chondrocyte phenotype. Other researchers reported this phenomenon by pellet culture 32. It is noteworthy that chemical growth factors should be combined with three-dimensional cultures (such as alginate microcapsules) to preserve the chondrocyte phenotype in vitro

33, 34

. Therefore, the cell

imprinted technique provides a monolayer structure that the cells can expand on while keeping their original phenotype. Moreover, this biomimetic architecture can stimulate chondrogenic either re-differentiation in semi-fibroblasts or differentiation in ADSCs with no chemical growth factor. At least, we can expect that this method may reduce the usage of chemically stimulating factors such as TGF-β, FGF, BMP, and IGF which are suggested for chondrogenesis

35

. In

contrast, the chemical inducers may show inhibitory effects instead of stimulation. For example, synovial fibrosis, osteophyte formation, cartilage degeneration or bone remodeling has been previously reported for altered signaling in TGF-β concentration

36

. Furthermore, it

has been reported that degeneration of cartilage in osteoarthritis cases can be reduced by inhibition of TGF-β signaling in subchondral bone reported to induce tenogenic differentiation

38

37

. Different growth factors were also

. However, the molecular signals for tenogenic

differentiation of stem cells still require additional investigations 39. Although BMP12, BMP13, and BMP14 have been introduced as potent factors for tenogenic differentiation, they might induce some osteogenic or chondrogenic signals 39. For this reason, we again hypothesized that imprinting can enhance the efficiency of tenogenic differentiation signals. The results from induction of chondrogenicity in tenocytes can support this claim. To the best of our knowledge, this is the first study on chondrocyte- tenocyte trans-differentiation using topography.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 28

Takimoto et al. reported the conversion of tenocyte into chondrocyte through Sox9 activations 40

. Also, the chondrogenic phenotype can be induced in pellet cultured tendon cells treated

with chondrogenic medium 41. We can suggest that the main effect of this differentiation is probably due to both nano and micro patterns. However, further study is required to identify the criteria for dimensions. Moreover, the synergistic effect of elasticity and imprinted topography can be considered by using other materials instead of PDMS. Taking together, the advantages of the imprinting method in differentiation might be summarized as follows: 1. Mechanical properties of PDMS including elastic modulus or toughness are much more similar to soft tissues than rigid polystyrene plates. 2. The cost of differentiation is reduced since the imprinted PDMS substrates are reusable and autoclavable. 3. No chemical induction method has been developed for chondrogenicity or tenogenicity in monolayer cultures. Therefore, imprinted PDMS substrates may trigger the induction and improve the efficiency of differentiation with no or a smaller amount of chemical growth factors.

5. CONCLUSIONS In this study, differentiation, re-differentiation, and trans-differentiation of three different models were analyzed by gene and protein expression. The results confirmed that cell imprinted topography can be applied to the cell substrate to control their fate. Differentiation of ADSCs to chondrocytes and tenocytes, re-differentiation of semi-fibroblasts to chondrocytes and trans-differentiation of tenocytes to chondrocytes were observed by immunocyto chemistry staining. This research offers new insight into the fabrication of culture plates to


Page 15 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


control cell function and phenotype regulation in-vitro for regenerative medicine and tissue engineering application.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Supporting Information. Additional information with regards to the cell, isolation, culturing, and morphologies are provided in the Supporting Information. The Supporting Information is available free of charge on the ACS Publications website


Page 16 of 28

Page 17 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ACKNOWLEDGMENTS The authors would like to express their appreciation to the Center of Micro-nano engineering (CMI), Bioimaging and optics platform (BIOP) and Histology Core Facility (HCF) at EPFL. This study was supported by Iran Pasteur Institute research grant No. 753 and Iranian National Science Foundation, INSF (43151).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 28

REFERENCES 1. Place, E. S.; Evans, N. D.; Stevens, M. M. Complexity in Biomaterials for Tissue Engineering. Nat. Mater. 2009, 8, 457-470. 2. Lofberg, J.; Ebendal, T. Substrate Topography and Shape of Motile Cells. Experientia 1980, 36, 508-510. 3. Kim, P. J.; Mahmoudi, M.; Ge, X.; Matsuura, Y.; Toma, I.; Metzler, S.; Kooreman, N. G.; Ramunas, J.; Holbrook, C.; McConnell, M. V. Direct Evaluation of Myocardial Viability and Stem Cell Engraftment Demonstrates Salvage of the Injured Myocardium. Circulation research 2015, 116, e40-e50. 4. Cha, C.; Liechty, W. B.; Khademhosseini, A.; Peppas, N. A. Designing Biomaterials to Direct Stem Cell Fate. ACS Nano 2012, 6, 9353-9358. 5. Lyssiotis, C. A.; Lairson, L. L.; Boitano, A. E.; Wurdak, H.; Zhu, S.; Schultz, P. G. Chemical Control of Stem Cell Fate and Developmental Potential. Angew. Chem., Int. Ed. 2011, 50, 200-242. 6. Fisher, O. Z.; Khademhosseini, A.; Langer, R.; Peppas, N. A. Bioinspired Materials for Controlling Stem Cell Fate. Acc Chem Res 2010, 43, 419-428. 7. Murphy, W. L.; McDevitt, T. C.; Engler, A. J. Materials as Stem Cell Regulators. Nat. Mater. 2014, 13, 547-557. 8. Dalby, M. J.; Gadegaard, N.; Oreffo, R. O. C. Harnessing Nanotopography and Integrin-Matrix Interactions to Influence Stem Cell Fate. Nat. Mater. 2014, 13, 558-569. 9. Lowry, E. R.; Henderson, C. E. Stem Cell Differentiation: Yielding Substrates for Neurons. Nat. Mater. 2014, 13, 543-544. 10. Engler, A. J.; Sen, S.; Sweeney, H. L.; Discher, D. E. Matrix Elasticity Directs Stem Cell Lineage Specification. Cell 2006, 126, 677-689. 11. Fischer, R. S.; Myers, K. A.; Gardel, M. L.; Waterman, C. M. Stiffness-Controlled Three-Dimensional Extracellular Matrices for High-Resolution Imaging of Cell Behavior. Nat. Protoc. 2012, 7, 2056-2066. 12. Guilak, F.; Cohen, D. M.; Estes, B. T.; Gimble, J. M.; Liedtke, W.; Chen, C. S. Control of Stem Cell Fate by Physical Interactions with the Extracellular Matrix. Cell stem cell 2009, 5, 17-26. 13. Bettinger, C. J.; Langer, R.; Borenstein, J. T. Engineering Substrate Topography at the Micro and Nanoscale to Control Cell Function. Angew. Chem., Int. Ed. 2009, 48, 5406-5415. 14. Song, W.; Lu, H.; Kawazoe, N.; Chen, G. Adipogenic Differentiation of Individual Mesenchymal Stem Cell on Different Geometric Micropatterns. Langmuir 2011, 27, 6155-6162. 15. Ruiz, S. A.; Chen, C. S. Emergence of Patterned Stem Cell Differentiation within Multicellular Structures. Stem cells 2008, 26, 2921-2927. 16. Unadkat, H. V.; Hulsman, M.; Cornelissen, K.; Papenburg, B. J.; Truckenmler, R. K.; Carpenter, A. E.; Wessling, M.; Post, G. F.; Uetz, M.; Reinders, M. J. T. An Algorithm-Based Topographical Biomaterials Library to Instruct Cell Fate. Proc. Natl. Acad. Sci. U. S. A. 2011, 108, 16565-16570. 17. Markert, L. D.; Lovmand, J.; Foss, M.; Lauridsen, R. H.; Lovmand, M.; Fuchtbauer, E. M.; Fuchtbauer, A.; Wertz, K.; Besenbacher, F.; Pedersen, F. S.; Duch, M. Identification of Distinct Topographical Surface Microstructures Favoring Either Undifferentiated Expansion or Differentiation of Murine Embryonic Stem Cells. Stem Cells Dev. 2009, 18, 1331-1342. 18. Kim, H. N.; Jiao, A.; Hwang, N. S.; Kim, M. S.; Kim, D.-H.; Suh, K.-Y. NanotopographyGuided Tissue Engineering and Regenerative Medicine. Adv. Drug Delivery Rev. 2013, 65, 536558. 19. Mahmoudi, M.; Bonakdar, S.; Shokrgozar, M. A.; Aghaverdi, H.; Hartmann, R.; Pick, A.; Witte, G.; Parak, W. J. Cell-Imprinted Substrates Direct the Fate of Stem Cells. ACS Nano 2013, 7, 8379-8384.


Page 19 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


20. Mashinchian, O.; Bonakdar, S.; Taghinejad, H.; Satarifard, V.; Heidari, M.; Majidi, M.; Sharifi, S.; Peirovi, A.; Saffar, S.; Taghinejad, M. Cell-Imprinted Substrates Act as Artificial Niche for Skin Regeneration. ACS Appl. Mater. Interfaces 2014, 6, 13280-13292. 21. Lee, E. A.; Im, S. G.; Hwang, N. S. Efficient Myogenic Commitment of Human Mesenchymal Stem Cells on Biomimetic Materials Replicating Myoblast Topography. Biotechnol. J. 2014, 9, 1604-1612. 22. Bonakdar, S.; Emami, S. H.; Shokrgozar, M. A.; Farhadi, A.; Ahmadi, S. A. H.; Amanzadeh, A. Preparation and Characterization of Polyvinyl Alcohol Hydrogels Crosslinked by Biodegradable Polyurethane for Tissue Engineering of Cartilage. Mater. Sci. Eng., C 2010, 30, 636-643. 23. Pauly, S.; Klatte, F.; Strobel, C.; Schmidmaier, G.; Greiner, S.; Scheibel, M.; Wildemann, B. Characterization of Tendon Cell Cultures of the Human Rotator Cuff. Eur. Cells Mater. 2010, 20, 84-97. 24. Alexeev, V.; Arita, M.; Donahue, A.; Bonaldo, P.; Chu, M.-L.; Igoucheva, O. Human Adipose-Derived Stem Cell Transplantation as a Potential Therapy for Collagen Vi-Related Congenital Muscular Dystrophy. Stem Cell Res. Ther. 2014, 5, 21. 25. Karkhaneh, A.; Naghizadeh, Z.; Shokrgozar, M. A.; Bonakdar, S. Evaluation of the Chondrogenic Differentiation of Mesenchymal Stem Cells on Hybrid Biomimetic Scaffolds. J. Appl. Polym. Sci. 2014, 131, 40635. 26. Dalby, M. J.; Gadegaard, N.; Tare, R.; Andar, A.; Riehle, M. O.; Herzyk, P.; Wilkinson, C. D. W.; Oreffo, R. O. C. The Control of Human Mesenchymal Cell Differentiation Using Nanoscale Symmetry and Disorder. Nat. Mater. 2007, 6, 997-1003. 27. Ross, A. M.; Jiang, Z.; Bastmeyer, M.; Lahann, J. Physical Aspects of Cell Culture Substrates: Topography, Roughness, and Elasticity. Small 2012, 8, 336-355. 28. Mashinchian, O.; Turner, L.-A.; Dalby, M. J.; Laurent, S.; Shokrgozar, M. A.; Bonakdar, S.; Imani, M.; Mahmoudi, M. Regulation of Stem Cell Fate by Nanomaterial Substrates. Nanomedicine 2015, 10, 829-847. 29. Bruder, J. M.; Monu, N. C.; Harrison, M. W.; Hoffman-Kim, D. Fabrication of Polymeric Replicas of Cell Surfaces with Nanoscale Resolution. Langmuir 2006, 22, 8266-8270. 30. Hong, E.; Reddi, A. H. Dedifferentiation and Redifferentiation of Articular Chondrocytes from Surface and Middle Zones: Changes in Micrornas-221/-222,-140, and143/145 Expression. Tissue Eng., Part A 2013, 19, 1015-1022. 31. von der Mark, K.; Gauss, V.; von der Mark, H.; Muller, P. Relationship between Cell Shape and Type of Collagen Synthesised as Chondrocytes Lose Their Cartilage Phenotype in Culture. Nature 1977, 267, 531 - 532. 32. Tallheden, T.; Karlsson, C.; Brunner, A.; Van Der Lee, J.; Hagg, R.; Tommasini, R.; Lindahl, A. Gene Expression During Redifferentiation of Human Articular Chondrocytes. Osteoarthritis and cartilage 2004, 12, 525-535. 33. Bian, L.; Zhai, D. Y.; Tous, E.; Rai, R.; Mauck, R. L.; Burdick, J. A. Enhanced Msc Chondrogenesis Following Delivery of Tgf-Beta3 from Alginate Microspheres within Hyaluronic Acid Hydrogels in Vitro and in Vivo. Biomaterials 2011, 32, 6425-6434. 34. Wang, W.; Li, B.; Yang, J.; Xin, L.; Li, Y.; Yin, H.; Qi, Y.; Jiang, Y.; Ouyang, H.; Gao, C. The Restoration of Full-Thickness Cartilage Defects with Bmscs and Tgf-Beta 1 Loaded Plga/Fibrin Gel Constructs. Biomaterials 2010, 31, 8964-8973. 35. Chung, C.; Burdick, J. A. Engineering Cartilage Tissue. Adv. Drug Delivery Rev. 2008, 60, 243-262. 36. Zhao, W.; Wang, T.; Luo, Q.; Chen, Y.; Leung, V. Y.; Wen, C.; Shah, M. F.; Pan, H.; Chiu, K.; Cao, X. Cartilage Degeneration and Excessive Subchondral Bone Formation in Spontaneous Osteoarthritis Involves Altered Tgf-Beta Signaling. J. Orthop. Res. 2016, 34, 763770. 37. Zhen, G.; Wen, C.; Jia, X.; Li, Y.; Crane, J. L.; Mears, S. C.; Askin, F. B.; Frassica, F. J.; Chang, W.; Yao, J. Inhibition of Tgf–Beta Signaling in Subchondral Bone Mesenchymal Stem Cells Attenuates Osteoarthritis. Nat. Med. 2013, 19, 704-712.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

38. Lui, P.; Rui, Y.; Ni, M.; Chan, K. Tenogenic Differentiation of Stem Cells for Tendon Repair—What Is the Current Evidence? J. Tissue Eng. Regener. Med. 2011, 5, e144-e163. 39. Shen, H.; Gelberman, R. H.; Silva, M. J.; Sakiyama-Elbert, S. E.; Thomopoulos, S. Bmp12 Induces Tenogenic Differentiation of Adipose-Derived Stromal Cells. PloS one 2013, 8, e77613. 40. Takimoto, A.; Oro, M.; Hiraki, Y.; Shukunami, C. Direct Conversion of Tenocytes into Chondrocytes by Sox9. Exp. Cell Res. 2012, 318, 1492-1507. 41. Funakoshi, T.; Spector, M. Chondrogenic Differentiation and Lubricin Expression of Caprine Infraspinatus Tendon Cells. J. Orthop. Res. 2010, 28, 716-725.


Page 20 of 28

Page 21 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. SEM micrograph of cells and imprinted PDMS. a) ADSCs, b) imprinted ADSCs, c) chondrocytes, d) imprinted chondrocytes (bar=10 µm)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. Optical profilometer of imprinted PDMS, a, b) chondrocytes, c, d) tenocytes, e, f) ADSCs


Page 22 of 28

Page 23 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Gene expression of cells in different condition. a) ADSCs cultured on PDMS and tenocyte imprinted substrate, b) ADSCs cultured on PDMS and chondrocyte imprinted substrate, c) semi-fibroblast cultured on PDMS and chondrocyte imprinted substrate, d) tenocytes cultured on PDMS and chondrocyte imprinted substrate.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4. Phalloidin staining of actins in cells cultured on a different substrate. a) tenocytes on PS, b) ADSCs on PS, c) semi-fibroblasts on PS, d) Tenocytes on tenocyte imprinted substrate, e) Tenocytes on ADSC imprinted substrate and f) ADSCs on tenocyte imprinted substrate (bar = 50 µm).


Page 24 of 28

Page 25 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Staining the cells cultured on different substrates for the nucleus (Hoechst, blue), actin fibers (phalloidin, green) and collagen II (red). a1-a4) semi- fibroblasts cultured on chondrocyte imprinted substrates, b1-b4) semi- fibroblasts cultured on semi-fibroblast imprinted substrates, c1-c4) ADSCs on chondrocyte imprinted substrates, d1-d4) ADSCs cultured on ADSC imprinted substrates, (bar = 50 µm)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 6. Staining the cells cultured on different substrates for the nucleus (Hoechst, blue), tenomodulin (green) and collagen II (red). a1-a4) Tenocytes cultured on tenocyte imprinted substrates, b1-b4) ADSCs cultured on tenocyte imprinted substrates, c1-c4) Tenocytes cultured on chondrocyte imprinted substrates, (bar = 50 µm)


Page 26 of 28

Page 27 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. The regulation of cell phenotypes by imprinted substrates can be further used in seeding cells for tissue engineering purposes to stimulate the cell regulatory signals during cell proliferation. Imprinted substrate can substitute the parts specified with the yellow star.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

TOC 56x24mm (300 x 300 DPI)


Page 28 of 28

Cell-Imprinted Substrates Modulate Differentiation ... - ACS Publications

Recommend Documents