Chitosan-Modified Filter Paper for Nucleic Acid Extraction and “in Situ

Feb 23, 2017 - Technology Department of Chaoyang Sub-bureau, Beijing Public Security Bureau, Beijing 100102, China. § Key Laboratory of Forensic ...
0 downloads 0 Views 1MB Size
Download PDF
Subscriber access provided by UNIV OF CALIFORNIA SAN DIEGO LIBRARIES

Article

Chitosan-modified filter paper for nucleic acid extraction and “in situ PCR” on a thermoplastic microchip Wupeng Gan, Yin Gu, Junping Han, Caixia Li, Jing Sun, and Peng Liu Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.6b04882 • Publication Date (Web): 23 Feb 2017 Downloaded from http://pubs.acs.org on February 23, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 11

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

ChitosanChitosan-modified filter paper for nucleic acid extraction and “in situ PCR” on a thermoplastic microchip Wupeng Gan,1,ǂ Yin Gu,1,ǂ Junping Han,2 Cai-xia Li,3 Jing Sun,3 Peng Liu1,* 1

Department of Biomedical Engineering, School of Medicine, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Tsinghua University, Beijing, 100084, China 2 Technology Department of Chaoyang Sub-bureau, Beijing Public Security Bureau, Beijing, 100102, China 3 Key Laboratory of Forensic Genetics, Beijing Engineering Research Center of Crime Scene Evidence Examination, Institute of Forensic Science, Ministry of Public Security, Beijing 100038, China. ABSTRACT: Plastic microfluidic devices with embedded chitosanmodified Fusion 5 filter paper (unmodified one purchased from GE Healthcare) have been successfully developed for DNA extraction and concentration, utilizing two different mechanisms for DNA capture: the physical entanglement of long-chain DNA molecules with the fiber matrix of the filter paper and the electrostatic adsorption of DNA to the chitosanmodified filter fibers. This new method not only provided a high DNA extraction efficiency at a pH of 5 by synergistically combining these two capture mechanisms together, but also resisted the elution of DNA from filters at a pH >8 due to the entanglement of DNA with fibers. As a result, PCR buffers can be directly loaded into the extraction chamber for “in situ PCR”, in which the captured DNA were used for downstream analysis without any loss. We demonstrated that the capture efficiencies of a 3-mm-diameter filter disc in a microchip were 98% and 95% for K562 human genomic DNA and bacteriophage λ-DNA, respectively. The washes with DI water, PCR mixture, and TE buffer cannot elute the captured DNA. In addition, the filter disc can enrich 62% of λ-DNA from a diluted sample (0.05 ng/µL), providing a concentration factor more than 30 fold. Finally, a microdevice with a simple two-chamber structure was developed for on-chip cell lysis, DNA extraction, and 15-plex short tandem repeat amplification from blood. This DNA extraction coupled with “in situ PCR” has great potential to be utilized in fully integrated microsystems for rapid, near-patient nucleic acid testing.

In the quest to develop a micro total analysis system (µTAS) with the “sample-in-answer-out” capability for nucleic acid testing (NAT), the integration of nucleic acid extraction have been identified as one of the most challenging tasks.1-3 This is mainly because samples often come with a great disparity in type, quality, and quantity. In addition, the extraction process involves the precise manipulation of multiple reagents in a microliter scale. As a consequence, a microfluidic device for nucleic acid extraction usually has complicated microstructures including microvalves, pumps, and multiple chambers, and the operation of the device is often difficult to be automated completely. To overcome this challenge, not only do the design and the fabrication of the microfluidic devices require engineering improvements, but also the fundamental chemistry and materials for nucleic acid capture and extraction need profound innovations. Currently, the majority of nucleic acid extraction performed on a microchip is based on the mechanism of nucleic acid adsorption to silica surfaces with a high concentration of guanidinium or sodium iodide salts. As early as 1999, Christel et al. demonstrated a DNA extraction conducted on a

microfluidic chip, on which a silica micropillar array was microfabricated for DNA capture.4 Later, Tian et al. successfully packed silica beads into a capillary to form a solid phase for DNA extraction, demonstrating a DNA recovery efficiency of 70% from white blood cells.5 They also described the use of sol-gels as either a supporting matrix for bead packing or a standalone capture phase could improve the extraction efficiency and the reproducibility.6,7 Magnetic silica beads or dynamic bead beds were also successfully integrated into microdevices for DNA isolation.8,9 Although the silicabased extraction has achieved tremendous success, chaotropic salts and organic solvents used for DNA capture and washing are known inhibitors to PCR, frequently leading to compromised amplification efficiencies. To eliminate those PCR-unfriendly reagents, Cao et al. employed chitosan, a cationic polymer, as an electropositive layer on beads for retaining DNA at pH 5 and releasing DNA at pH 9.10 The entirely aqueous extraction method can provide an extraction efficiency of 75% from whole blood. Chitosan can also be coated onto both magnetic beads and microfabricated poly (methyl methacrylate) (PMMA) posts for DNA extraction.11,12

ACS Paragon Plus Environment

Analytical Chemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

More recently, Byrnes et al. have grafted chitosan onto porous nitrocellulose and glass fiber membranes for low-cost, pointof-care nucleic acid testing.13 Other surface modification methods, such as amine and carbonyl/carboxy groups, can also be used to extract DNA in a charge-switch manner.14,15 In parallel with the progress of solid phase extractions, more and more micro total analysis systems with integrated sample preparations have been developed for automated genetic analysis, while the complexity of these microsystems should be further reduced for convenient, near-patient nucleic acid testing.1,16,17 All the extraction methods mentioned above employed a bind-wash-elute protocol to extract nucleic acids from diverse sample types for downstream amplifications.3 This elution step demands two separate chambers for nucleic acid extraction and PCR, respectively, in an integrated genetic analysis system, resulting in dilution of extracted samples, complex microstructures, and the need for precise fluidic manipulations.1 To overcome these problems, many researchers proposed a concept of “in situ PCR”, in which PCR is directly performed in the extraction chamber following nucleic acid purification without elution.18-20 For instances, nanoporous aluminum oxide membranes (AOM) have been demonstrated to trap DNA molecules and to enable direct PCR in a single chamber.18,21,22 While the device structure was simplified, a special flow control system was required due to the AOM’s high resistance to liquid flow. Chitosan microparticles containing embedded magnetic nanoparticles have also been shown to allow the capture and amplification of nucleic acids in a single tube.23 Due to the presence of highly dense chitosan on these particles, DNA remained bounded at a pH higher than 8.5. However, the efficiency of direct qPCR with these chitosan particles was 67.6%, indicating the possible adsorption of polymerases, primers, or amplicons to the microparticles. Jangam et al. presented a filtration isolation method for rapid HIV proviral DNA extraction from whole blood using a piece of Fusion 5 filter paper.24-26 The filter with trapped nucleic acids can be directly put into a tube for amplification. By employing the same capture mechanism, our group successfully developed a filter paper-based DNA extraction microdevice, in which the DNA extraction and PCR were conducted in a single chamber without the elution step.27 We also demonstrated that the sample preparation based on this extraction method could be fully automated with the aid of microvalves and external pumps.28,29 This progress proved that the concept of “in situ PCR” is attractive to integrated microsystems because of simplified microstructures, reduced operation steps, and improved sensitivity and reproducibility. Although the filter paper-based nucleic acid extraction has been proved useful for “in situ PCR” by our group,27,28 the DNA capture efficiency was relative low due to the simple physical trapping of long DNA molecules by the matrix of filter fibers. For applications where available samples are limited, such as early detection of pathogens and forensic DNA typing of touch evidence, highly efficient nucleic acid extraction and concentration is indispensable. Here we presented a chitosan-modified Fusion 5 filter paper embedded into a thermoplastic microchip for highly efficient, rapid, and low-cost DNA extraction from whole blood and bloodstains. Due to the novel capture mechanism combining the entanglement of DNA with fibers and the electrostatic adsorption of DNA to chitosan polymers, DNA can be

Page 2 of 11

extracted out from raw samples at a pH around 5, and remain captured in the filter paper at a pH higher than 8. Since the bounded DNA molecules are still available for amplifications, all the extracted DNA can be concentrated into a single chamber for direction PCR without elution, leading to a high sensitivity as well as simple microchip structures. This new DNA extraction method together with the microchips for the integrated extraction and PCR is a critical step towards the development of fully integrated microsystems for near-patient or on-site nucleic acid testing.

EXPERIMENTAL SECTION Modification of Fusion 5 filter paper. Chitosan (medium molecular weight), MES (2-(N-Morpholino)ethanesulfonic acid), PEG (poly(ethylene glycol), molecular weight: 10,000), CTAB (cetyltrimethylammonium bromide), SDS (sodium dodecyl sulfonate), APTES (aminopropyltriethoxysilane), and GPTS (glycidoxypropyltrimethylsilane) were all purchased from Sigma-Aldrich (St.Louis, MO). Standard K562 human genomic DNA and bacteriophage λ-DNA were obtained from Promega (Madison, WI). Fusion 5 filter paper was from Whatman (GE Healthcare, Pittsburgh, PA). QIAamp® DNA Micro kits were obtained from Qiagen (Germantown, MD). PCR Mastermix was from Bioteke (Beijing, China). PCR buffer, dNTP, DNA polymerase, and MgCl2 for multiplex short tandem repeat (STR) analysis were purchased from Roche (Indianapolis, IN). All the primers were synthesized by Sangong (Beijing, China). All solutions were prepared in water purified to 18.0 MΩ·cm by Milli-Q Advantage A10 (Millipore, Massachusetts, MA).

Figure 1. Schematics of the thermoplastic microchips for sample preparation. (A) Exploded view of the microchip with a single reaction chamber for DNA capture. (B) Exploded view of the microchip with a sample loading and a reaction chambers for onchip cell lysis, DNA extraction, and PCR amplification. The microfluidic chips consist of an upper PMMA layer, a PDMS membrane, a lower PMMA layer, and a 3-mm-diameter disc of chitosan-modified Fusion 5 filter paper. (C) Expanded view of the filter disc and the lower round chamber for filter accommodation.

In the process of chitosan modification, a 10×2 cm large piece of Fusion 5 filter paper was first activated with oxygen plasma for 1 min (Femto-plasma surface generators, Diener, Germany). The treated paper was submersed into a chitosan

ACS Paragon Plus Environment

Page 3 of 11

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

solution (0.05% (w/v) in 0.1% acetic acid, pH 6.0) followed by an overnight incubation on a tube roller. Then, the filter paper was washed with deionized water (DI water) for three times and dried completely at 50 oC in a vacuum drying oven. After that, 3-mm-diameter discs of Fusion 5 filter paper were punched off from the large piece using a manual puncher and then stored in a sealed plastic bag at room temperature until use. Design and fabrication of microdevices. The thermoplastic microchips for DNA extraction and PCR with chitosan-modified filter paper are almost the same as those described before.27 Briefly, as illustrated in Figure 1A, the microchip for DNA capture consists of three layers (from top to bottom): a 2-mm-thick upper PMMA (poly(methyl methacrylate)) layer, a 0.2-mm-thick PDMS (polydimethylsiloxane) membrane (BISCO® HT-6240, Rogers, Woodstock, CT), and a 2-mm-thick lower PMMA layer. The main structure of this microchip is a 10-µL reaction chamber with an input and an output channels for extraction and amplification. A 3-mm-diameter chitosan-modified Fusion 5 filter disc is sandwiched between the PDMS membrane and the lower PMMA layer in the chamber (shown in Figure 1C). The microchip is reversibly assembled by the PDMS membrane so that the filter disc can be taken out for analysis. The microchip with two chambers (shown in Figure 1B) was designed for performing on-chip cell lysis, DNA extraction, and PCR altogether. A 5-mm-diameter nylon filter (Millipore, Billerica, MA) is embedded in the loading chamber for receiving raw samples. This chip is permanently bonded for on-chip PCR. The detailed fabrication procedure of these microchips can be found in the supporting information.27 Evaluation of DNA capture by chitosan-modified filter paper. Standard K562 human genomic DNA and bacteriophage λ-DNA, representing long and short DNA fragments, respectively, were employed to verify the DNA capture efficiency of the chitosan-modified Fusion 5 filter paper. DNA samples were prepared with MES (pH 5.0) to a concentration of 5 ng/µL. Five-µL DNA sample containing 25 ng of either K562 or λ-DNA was pipetted onto the surface of the filter paper disc embedded into the microchip (Figure 1A). Then, the reaction chamber was sealed with a piece of ARseal™ adhesive tape (Adhesives Research, Glenrock, PA). 200 µL of DI water was aspirated through the reaction chamber at a speed of 200 µL/min to wash the filter paper disc. Finally, the microchip was disassembled, and the disc was taken out for real-time PCR analysis in an Eppendorf tube. The same DNA samples prepared in a 1×TE buffer (TrisEDTA, pH 9.0) were also captured by the modified filter paper to verify the electrostatic capture mechanism. As a control, unmodified Fusion 5 filter paper was used to capture DNA at pH 5.0 in parallel. To evaluate the capture capacity of the chitosan-modified filter paper, a series of K562 or λ-DNA samples containing 25, 50, 100, 200, and 500 ng DNA were directly pipetted onto the filter surface. After washed with 200 µL DI water, the filter discs were taken out for quantifications. To test the DNA retention capability of the filter paper during elution, 50 ng K562 DNA was first captured on the filter discs and then washed with 200 µL DI water on the chip. After that, the filter discs were washed under different elution conditions, including 1-mL water, 100-µL PCR buffer (pH 8.5), and 100µL 1×TE (pH 9.0). After elution, both the eluants and the filter discs were quantified by real-time PCR. Finally, 25 ng λ-DNA samples diluted into a series of concentrations from 1, 0.5, 0.1,

down to 0.05 ng/µL continuously flowed through the filter discs at a speed of 200 µL/min. The captured DNA on the discs was then quantified to calculate the concentration factors. Real-time PCR for DNA quantification was performed on a Bio-Rad iQ5 system (Bio-Rad, Hercules, CA). A pair of primers (forward: 5’-CCCTGGGCTCTGTAAAGAA, reverse: 5′-ATCAGAGCTTAAACTGGGAAGCTG) which amplifies a 106-bp and a 112-bp fragments from the X and the Y chromosomes, respectively, was employed to assess the capture efficiency of human genomic DNA, while another pair of primers (forward: 5’CAAGCTTTGCCACACCACGGTATT, reverse: 5’TAAGCACGAACTCAGCCAGAACGA) amplifying a 101bp fragment was used for the analysis of λ-DNA. A 25-µL mixture for real-time PCR was composed of 0.425µL of each primer, 12.5 µL of Power 2× SYBR real-time PCR premix (Thermo Fisher, Waltham, MA), 11.65 µL of DI water, and the filter paper disc. The thermal cycling protocol included an initial activation of Taq polymerases at 95 oC for 5 min, followed by 35 cycles of 95 oC for 30 s, 60 oC for 30 s, and 72 o C for 30 s, and a final extension step for 10 min at 72 oC. Procedure of DNA extraction from blood samples. Human whole blood samples were obtained from healthy volunteers after informed consent for research and were anticoagulated in evacuated blood collection tubes. Dried bloodstains were prepared by pipetting 0.5 µL blood onto a 3mm-diameter piece of hydrophilic nylon filter with an 80-µm pore size. After air-drying, the stains were stored in an envelope at room temperature until use. The lysis of blood cells was first performed in an Eppendorf tube by mixing blood with 50-µL lysis buffer (0.1% CTAB, 1.5M NaCl, MES, pH 5.0) and incubating at room temperature for 15 minutes. The lysate was aspirated into the reaction chamber of the microchip (Figure 1A) for DNA capture at a speed of 200 µL/min, followed by washing with 50 µL 1% SDS and 200 µL DI water at the same flow rate. Finally, the microchip was disassembled, and the filter disc was taken out for real-time PCR analysis. DNA was quantitated with the aid of a calibration curve generated using serially diluted standard DNA added to the filter paper discs. Each data point was repeated at least three times to generate standard deviations. Conventional DNA extractions using QIAamp® DNA Micro kits were also conducted following the manual. Both the cell lysis and the extraction from blood and bloodstain samples can also be carried out on the microchip shown in Figure 1B. The sample and the 50-µL lysis buffer were pipetted into the loading chamber for 15-min incubation, followed by capture and washing using the same protocol shown above. Procedure of on-chip DNA extraction and PCR. Then on-chip PCR amplification was performed following the cell lysis and DNA extraction from 1-µL human whole blood in the microchip (Figure 1B). A 15-plex STR system, Typer™ 15 kit (Institute of Forensic Science, Beijing, China), including 14 STR loci (D6S1043, D3S1358, D5S818, D7S820, D8S1179, D13S317, D2S1338, CSF1PO, D16S539, D18S51, D21S11, FGA, vWA, Penta E) and a sex typing marker, Amelogenin, was employed to test the on-chip DNA extraction and PCR. A 25-µL PCR mixture consisted of 0.425 µL of each Amelogenin primer, 3 µL of polymerase, 12.5 µL of MaterMix, 7.525 µL of DI water, 0.625 µL of PEG (160 µg/µL), and 0.5 µL of bovine serum albumin (BSA, 50 µg/µL, Sigma-Aldrich). After the PCR mix was loaded into the

ACS Paragon Plus Environment

Analytical Chemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

permanently bonded microchip, the inlets and outlets of the microchip were sealed with ARseal™ tape, and the chip was placed upside down in a thermal cycler with a flat heating block (Mastercycler Nexus Flat, Eppendorf, Hamburg, Germany). A calibrated thermal cycling protocol was used for on-chip PCR, including an initial activation at 96 °C for 5 min, followed by 35 cycles of 97 °C for 45 s, 57 °C for 35 s and 72 °C for 30 s, and a final extension step for 10 min at 72 °C. After PCR, the products were pipetted out from the reaction chamber for microchip-based capillary electrophoresis.28,29

Figure 2. Chitosan-modified Fusion 5 filter paper and DNA capture mechanism. (A) 3-mm-diameter discs of chitosanmodified Fusion 5 filter paper. Schematic and scanning electron microscope image of the fiber matrix coated with chitosan polymers. (B) Schematic of the DNA capture mechanism. At a pH around 5, DNA molecules are “actively” adsorbed onto the chitosan-modified fibers. Once DNA is on the fibers, the physical entanglement of the long-chain molecules with the fiber matrix can also assist the capture. At a pH of 9, although DNA was not “actively” absorbed onto the fiber, DNA molecules remain bounded due to the physical trapping of these long-chain DNA molecules within the fiber matrix against washing and elution.

RESULTS AND DISCUSSION Mechanism of DNA capture with chitosan-modified Fusion 5 filter paper. Several groups including us have demonstrated that Fusion 5 filter paper can be used for DNA extraction from a variety of samples due to the physical entanglement of long-chain DNA fragments with the fiber matrix.24-27 PCR buffer can be directly loaded into the extraction chamber for PCR without the worry of losing captured DNA from the filter as well as the incomplete mixing of DNA template with the PCR buffer. As a result, the structures of the integrated DNA extraction and PCR microdevices were dramatically simplified, and the operation

Page 4 of 11

of this device can be fully automated.28,29 While significant progress has been achieved, an unaddressed critical issue that may hinder the broad application of this extraction method is the relative low capture efficiency of the filter paper: only ~10% for the capture of standard K562 human genomic DNA. In many applications, such as early clinical detection of pathogens or forensic typing of low copy number (LCN) DNA evidence, a high extraction efficiency is demanded. Actually, if we can improve the capture rate of this filter paper-based DNA extraction, the “in situ PCR” capability of this method should be able to provide an enhanced sensitivity for nucleic acid testing by concentrating DNA into a single chamber from a diluted sample. Here we for the first time combined the physical entanglement of DNA with the filter fibers and the electrostatic adsorption of DNA to chitosan together to develop a novel DNA extraction method utilizing a small piece of chitosan-modified Fusion 5 filter paper embedded into a simple microfluidic device. Chitosan, a cationic polysaccharide, has a large number of amine groups, the pKa of which is about 6.3. As a result, chitosan is cationic at pH below 6.3 and enables the extraction of anionic DNA from a complex biological background due to the high electrostatic adsorption. With the increase of pH, the positive charges of chitosan become less, and nearly neutral at a pH around 8.5, leading to the release of DNA.10,23,30 This means that the loading of a PCR buffer (pH 8.5) into this chitosan-capture system can elute DNA off and fail the “in situ PCR” concept. In our study, Fusion 5 filter paper manufactured by GE Healthcare was selected as the carrier of chitosan polymers for DNA extraction. The major components of the Fusion 5 filter paper are glass microfibers bound with organic binders. The oxygen plasma treatment can clean the filter paper and generate uniform net negative charges on the surface of the glass fibers,31 which can then effectively adsorb chitosan polymers from chitosan acetate solutions onto the surfaces via electrostatic interactions. This method has been widely adopted to stably coat chitosan onto various surfaces against the wash-off effect.32,33 As shown in Figure 2, by grafting chitosan polymers to the fibers of the Fusion 5 filter paper, we hypothesized that the capture mechanism of DNA to the filter can be summarized to two modes: during the capture mode (pH below 6.3), DNA molecules are “actively” adsorbed onto the chitosan-modified fibers. Once DNA is on the fibers, the physical entanglement of the long-chain molecules with the fiber networks can prevent the falloff of DNA. As a result, this combined capture efficiency should be higher than those provided by a single mechanism. During the wash and PCR loading mode (pH around 8.5), due to the deprotonation of chitosan, DNA was not “actively” absorbed onto the fibers any longer. However, the physical trapping of these long-chain DNA molecules within the fiber matrix could effectively prevent the release of DNA from the filter. Therefore, the PCR buffer can be directly loaded for “in situ PCR”. Evaluation of DNA capture. To prove our hypothesis about this combined capture mechanism, we first evaluated the DNA capture efficiencies of the chitosan-modified and unmodified Fusion 5 filter paper under the acidic condition. We directly pipetted 25 ng K562 DNA or λ-DNA, which represent long-chain and short-chain nucleic acids, respectively, onto the surface of the filter paper in a microchip, followed by washing with water. The pH of the loading solution was carefully adjusted to 5, so that chitosan becomes

ACS Paragon Plus Environment

Page 5 of 11

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

cationic for nucleic acid capture and DNA still remains intact from depurination.10,34 As shown in Figure 3A, the DNA capture efficiencies of the modified filter paper were 98% and 95% for K562 DNA and λ-DNA, respectively. In contrast, unmodified filter paper can only provide DNA capture rates of 9% and 7%. This sharp difference in the capture efficiency between the modified and the unmodified filters clearly illustrated the improvement of the DNA capture efficiency was indeed due to the grafting of chitosan. To further verify the capture mechanism, we tried the DNA capture with the modified filter paper at a pH of 9. The capture efficiencies of 15% and 3% obtained from the K562 DNA and the λ-DNA tests, respectively, were similar to those obtained with the unmodified paper, illustrating that DNA fragments were only trapped in the fiber matrix by the physical entanglement without the electrostatic adsorption under the alkaline condition. This experiment further validated the capture mechanism of the chitosan-modified Fusion 5 filter paper.

Figure 3. Evaluation of DNA capture by chitosan-modified filter paper. (A) Comparisons of capture efficiencies of K562 genomic DNA and λ-DNA among unmodified filter, chitosanmodified filter in an acidic condition, modified filter in an alkaline condition, and modified filter without the plasma treatment. (B) K562 DNA capture capacity of a 3-mmdiameter chitosan-modified filter disc. (C) λ-DNA capture capacity of the filter disc. Next, a batch of the Fusion 5 filter paper was modified with chitosan following the same protocol except that no plasma treatment was performed. As shown in Figure 3A, low capture efficiencies, 10% for K562 DNA and 6% for λ-DNA, were obtained with this modified filter paper, illustrating the indispensability of the plasma treatment for the successful chitosan modification. In addition, the chitosan concentration of the coating solution for the filter paper modification was optimized to be 0.05% (w/v) (Figure S1). We tested the capture capacity of a 3-mm-diameter disc of the filter paper embedded into the microdevice. A series of DNA samples containing 25, 50, 100, 200, 300, 400, and 500 ng K562 DNA or λ-DNA were directly loaded onto the surface of the filter in the chip, followed by water rinsing. For K562 human genomic DNA, Figure 3B shows that the capture efficiency remained above 90% when the input amount was between 25 and 300 ng, illustrating the filter paper was not saturated by the input DNA in this input range. However, when the input DNA was increased to 400 and 500 ng, the efficiencies were dropped to 89% and 77%, respectively. Assuming the capture capability of the filter paper was not changed, the decrease of the capture efficiency was then due to the saturation. Thus, we estimated that the capture capacity of the chitosan filter paper for K562 DNA is in the range of 350-390 ng. Similarly, Figure 3C demonstrates that the maximum capacity of the filter paper for λ-DNA is 240-320 ng. The lower capacity of λ-DNA might result from a weaker entanglement effect between the fibers and the short-fragment λ-DNA molecules than that of long-fragment K562 genomic DNA. “in situ PCR” and capture of diluted DNA samples. To enable the concept of “in situ PCR”, the filter paper should be able to withstand the elution at a pH higher than 8, so that the loading of PCR buffers can-not release any DNA off. Here we first captured 50 ng K562 DNA on the filter discs, and then used 1-mL DI water, 100-µL PCR mix (pH 8.5), and 100-µL TE buffer (pH 9.0) to dissociate DNA. Both the washed filter discs and the eluants were quantified by real-time PCR. As shown in Figure 4A, the elution with 1-mL DI water cannot release any DNA off, as no DNA was detected by PCR in the eluant and 98.6% of DNA were still left on the filter. When we washed the discs with either PCR mix or TE buffer, only 11.5% (5.77 ng) and 8.9% (4.43 ng) can be detected from the eluants, respectively, while over 80% were still trapped within the filter paper discs. These results validated that this novel extraction method could indeed enable the “in situ PCR” concept. We have proved that chitosan on the filter paper was not able to “actively” capture DNA under the alkaline condition (shown in Figure 3A). Other groups had also demonstrated the success of DNA elution from chitosancoated surfaces, such as silica beads.10,11 Therefore, DNA should be trapped within the filter by some other mechanisms during the alkaline elution in our study. Considering the dense glass microfiber matrix (Figure 2A) as well as the previous

ACS Paragon Plus Environment

Analytical Chemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

demonstration of DNA capture with the unmodified filter paper,27 we deduced that the resistance of our filter paper against elution is due to the physical entanglement of DNA with the fibers. One of the most valuable advantages provided by the “in situ PCR” is the enhanced sensitivity by concentrating DNA from a continuous flow of a diluted sample into a single reaction. To evaluate the concentration capability of the chitosan-modified filter paper, we diluted 25 ng of λ-DNA into a series of concentrations ranging from 1, 0.5, 0.1, down to 0.05 ng/µL. Then, these samples were captured by the filter discs and quantified to determine the concentration factors. Although a lower flow rate is preferred for higher capture efficiency, a slow flow may result in a too long loading process that cannot be accepted in reality. In our study, we chose the flow speed of 200 µL/min, with which 500 µL of samples can be loaded within 3 min. Figure 4B shows that the modified filter paper was capable of capturing 62% of the λDNA (15.5 ng) at a concentration as low as 0.05 ng/µL. Since the volume of the reaction chamber is 10 µL, the DNA concentration in the chamber for PCR is 1.55 ng/µL, which corresponds to a concentration factor of 31. In addition, since all the captured DNA within the filter disc can be used for amplification in our device and only a small portion of extracted DNA (usually about 10%) could be utilized in a conventional DNA extraction and PCR, the sensitivity of a nucleic acid testing on the chip could be 10-fold higher than the conventional. This result clearly proved that our chitosanmodified paper has the potential to be used for analyzing lowconcentration samples.

Figure 4. DNA Capture from diluted samples and anti-elution of the modified filter paper. (A) Elution of captured K562 DNA from filter paper in different conditions. No DNA was eluted with 1-mL DI water, while only 11.5% and 8.9% of the captured DNA were washed off with a PCR mixture (pH 8.5) and a 1×TE buffer

Page 6 of 11

(pH 9.0), respectively. (B) Capture of 25 ng λ-DNA samples diluted into a series of concentrations ranging from 1, 0.5, 0.1, down to 0.05 ng/µL. The chitosan-modified filter paper was able to capture 62% of the λ-DNA at a concentration as low as 0.05 ng/µL.

DNA extraction from whole blood and bloodstains. Since blood is one of the most common biological samples encountered in clinical diagnosis and forensic DNA typing, we chose human whole blood and bloodstains to test our DNA extraction method critically. In this experiment, we first conducted the cell lysis in Eppendorf tubes at room temperature, then aspirated the lysates into the microchip (shown in Figure 1A). After washing, the filter discs were taken out for quantifications. In the first test, we tried four different detergents for cell lysis, including SDS, Triton-100, NP-40, and CTAB, all of which were dissolved into MES solutions with 1.5 M NaCl at a pH of 5.0. We found that CTAB provided the fastest cell lysis (15 min) at room temperature (data not shown). Next, we tried two different washing protocols: one is just to wash the filter disc with 200 µL water at a speed of 200 µL/min, and the other is to wash with 50 µL 1% SDS followed by 200 µL water at the same speed. The purpose of the SDS wash is to remove any protein residues or cell debris as much as possible from the filter. In addition, conventional extractions using the QIAamp® DNA Micro kit were included as controls. As shown in Figure 5A, on-chip DNA extractions without the extra SDS wash produced 11.1±2.5, 11.8±3.8, 14.6±3.6, and 17.4±2.2 ng DNA from 0.25, 0.5, 1, and 2 µL of blood accordingly. Apparently, the extracted DNA did not increase linearly with blood volume due probably to the incomplete removal of cell residues that inhibit PCR amplifications. When an extra SDS wash was included, on-chip extractions could provide 12.1±4.5, 19.3±4.9, 36.7±16.9, and 53.3±18.1 ng of DNA from 0.25-2 µL of blood. As controls, conventional extractions using the Qiagen kit can provide 5.3±0.9, 11.7±1.5, 29.4±3.4, and 54.5±3.1 ng of DNA. These results clearly show that our on-chip extraction efficiencies are higher than or similar to those obtained with the conventional method. Additionally, since the entire filter disc with extracted DNA can be used directly for PCR, the template concentrations were much higher than those provided by the Qiagen kit. We observed that our DNA extraction method has much higher standard deviations than those in the capture of standard DNA using our device (Figure 3A) and in the conventional extraction using the Qiagen kit. This unstable performance is due to the use of detergents on the reversibly bonded device, leading to some flow shortcuts and leakages within the microchannels. Next, we performed on-chip cell lysis and DNA extraction on the microchips with two chambers (shown in Figure 1B) from either 0.5 µL whole blood or dried bloodstains prepared from 0.5 µL blood. First, whole blood and bloodstain samples were added to the loading chamber and then mixed with 50 µL cell lysis buffer in the chamber. After 15-min incubation, the lysates were aspirated through the filter disc, followed by the SDS and water washes. Figure 4B shows that the on-chip extraction produced 13.9±1.1 and 7.3±1.4 ng of DNA from whole blood and dried bloodstains, respectively. The extraction from whole blood with on-chip cell lysis has a similar efficiency to those with off-chip lysis, proving the effectiveness of the entire on-chip operations. The lower amounts of DNA obtained from the bloodstains were due partly to the degradation of blood cells on the paper after the

ACS Paragon Plus Environment

Page 7 of 11

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

stain preparation and the DNA capture effect of the bloodstain paper itself.

Figure 5. DNA extractions from human whole blood and dried bloodstain samples. (A) DNA extractions from blood using the chitosan-modified filter paper and the QIAamp® DNA Micro kit. Without an extra SDS wash, chitosan-modified filter paper produced 11.1±2.5, 11.8±3.8, 14.6±3.6, and 17.4±2.2 ng DNA from 0.25-2 µL of blood. With the SDS wash, on-chip extractions provided 12.1±4.5, 19.3±4.9, 36.7±16.9, and 53.3±18.1 ng of DNA. As a control, the Qiagen kit provided 5.3±0.9, 11.7±1.5, 29.4±3.4, and 54.5±3.1 ng of DNA. (B) Cell lysis and DNA extraction from whole blood and bloodstains performed on the microchip with a two-chamber structure. 13.9±1.1 and 7.3±1.4 ng of DNA were obtained from 0.5-µL whole blood and dried bloodstains, respectively.

On-chip DNA extraction and PCR for forensic STR typing. Finally, we tested the feasibility of performing the entire sample preparation including cell lysis, DNA extraction, and PCR on a single microchip for genetic analysis, such as forensic STR assay. In this experiment, we loaded 2 µL blood into the loading chamber, and then the rest operation was conducted on the chip. Since the PDMS and the PMMA layers were permanently bonded this time, the chip can be directly put into a thermal cycler with a flat heating block for thermal cycling. After that, the amplicons were pipetted out from the reaction chamber for downstream capillary electrophoresis. As shown in Figure 6, two blood samples from different donors were tested on the chips, and full STR profiles were obtained using our on-chip method with the DNA Typer™ 15 kit. All of the alleles were accurately resolved and called. The time of the entire sample preparation was about 2 hours, including 15 min for cell lysis, 5 min for DNA extraction, and 100 min for PCR. The experiment proved that the DNA extraction from 2 µL of blood could provide adequate DNA templates regarding

quantity and quality for downstream sophisticated genetic analyses. Because of the “in situ PCR” enabled by this filter paper, the structures of the device were greatly simplified, and the operation of the sample preparation process should be straightforward to automate.

Figure 6. On-chip cell lysis, DNA extraction, and 15-plex short tandem repeat amplification from human whole blood. Two-µL blood was pipetted into the loading chamber, and the rest operations were all conducted on the chip. Two blood samples (A and B) from different volunteers were successfully tested, and full STR profiles were well resolved and called.

CONCLUSION In this study, a novel DNA capture mechanism combining the entanglement of DNA with filter fibers and the electrostatic adsorption of DNA to chitosan-modified fibers has been successfully developed. This new filter paper-based method can be conveniently integrated into a plastic microfluidic device. Cell lysis, DNA extraction, and multiplex PCR amplification from blood samples can be achieved in a single chip with simplified structures and convenient operations. The key advantage provided by this method is the high capture efficiency coupled with the “in situ PCR” capability, because i) DNA extraction and PCR can be performed in a single chamber instead of two separate chambers. As a result, the structure of the microchip was

ACS Paragon Plus Environment

Analytical Chemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

greatly simplified and the loading of the PCR buffer in the reaction chamber became easy. ii) The high capture efficiency enables DNA extraction and concentration from a continuous flow of large-volume samples with minute amounts of DNA. iii) The “in situ PCR” facilitates the use of all the captured DNA for PCR without any loss, leading to an enhanced sensitivity. Other advantages of our method include low cost, automation, and easy integration with other function units. Therefore, we believe our method for DNA extraction is an ideal candidate to be integrated into a micro total analysis system for rapid nucleic acid testing in a near-patient or onsite setting.

ASSOCIATED CONTENT

Page 8 of 11

(12) Jiang, C.; Xu, S.; Zhang, S.; Jia, L. Anal. Biochem. 2012, 420, 20-25. (13) Byrnes, S. A.; Bishop, J. D.; Lafleur, L.; Buser, J. R.; Lutz, B.; Yager, P. Lab Chip 2015, 15, 2647-2659. (14) Nakagawa, T.; Tanaka, T.; Niwa, D.; Osaka, T.; Takeyama, H.; Matsunaga, T. J. Biotechnol. 2005, 116, 105-111. (15) Witek, M. A.; Llopis, S. D.; Wheatley, A.; McCarley, R. L.; Soper, S. A. Nucleic Acids Res. 2006, 34, e74-e74. (16) Kim, T. H.; Park, J.; Kim, C. J.; Cho, Y. K. Anal. Chem. 2014, 86, 3841-3848. (17) Le Roux, D.; Root, B. E.; Hickey, J. A.; Scott, O. N.; Tsuei, A.; Li, J. Y.; Saul, D. J.; Chassagne, L.; Landers, J. P.; de Mazancourt, P. Lab Chip 2014, 14, 4415-4425. (18) Kim, J.; Mauk, M.; Chen, D. F.; Qiu, X. B.; Kim, J.; Gale, B.; Bau, H. H. Analyst 2010, 135, 2408-2414.

Supporting Information Information Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author * Email: [email protected]. Phone: +86-10-62798732. Fax: +86-10-62798732.

Author Contributions ǂ W. G. and Y. G. contributed equally to this work.

Notes The authors declare no competing financial interest.

ACKNOWLEDGEMENTS Financial supports were provided by the National Instrumentation Program (No. 2013YQ190467) from Ministry of Science and Technology of China and by the Special Program for Basic Research (Grant No. 2015JB005) from the Central Public Welfare Research Institutes.

REFERENCES (1) Liu, P.; Mathies, R. A. Trends Biotechnol. 2009, 27, 572-581. (2) Price, C. W.; Leslie, D. C.; Landers, J. P. Lab Chip 2009, 9, 24842494. (3) Kim, J.; Johnson, M.; Hill, P.; Gale, B. K. Integr. Biol. 2009, 1, 574-586. (4) Christel, L. A.; Petersen, K.; McMillan, W.; Northrup, M. A. J. Biomech. Eng. 1999, 121, 22-27. (5) Tian, H. J.; Huhmer, A. F. R.; Landers, J. P. Anal. Biochem. 2000, 283, 175-191. (6) Breadmore, M. C.; Wolfe, K. A.; Arcibal, I. G.; Leung, W. K.; Dickson, D.; Giordano, B. C.; Mary, E.; Ferrance, J. P.; Feldman, S. H.; Norris, P. M. Anal. Chem. 2003, 75, 1880-1886.

(19) Liu, C.; Geva, E.; Mauk, M.; Qiu, X.; Abrams, W. R.; Malamud, D.; Curtis, K.; Owen, S. M.; Bau, H. H. Analyst 2011, 136, 20692076. (20) Sun, Y.; Quyen, T. L.; Hung, T. Q.; Chin, W. H.; Wolff, A.; Bang, D. D. Lab Chip 2015, 15, 1898-1904. (21) Dames, S.; Bromley, L. K.; Herrmann, M.; Elgort, M.; Erali, M.; Smith, R.; Voelkerding, K. V. J Mol Diagn 2006, 8, 16-21. (22) Kim, J.; Gale, B. K. Lab Chip 2008, 8, 1516-1523. (23) Pandit, K. R.; Nanayakkara, I. A.; Cao, W.; Raghavan, S. R.; White, I. M. Anal. Chem. 2015, 87, 11022-11029. (24) Jangam, S. R.; Yamada, D. H.; McFall, S. M.; Kelso, D. M. J. Clin. Microbiol. 2009, 47, 2363-2368. (25) Jangam, S. R.; Agarwal, A. K.; Sur, K.; Kelso, D. M. Biosens. Bioelectron. 2013, 42, 69-75. (26) McFall, S. M.; Wagner, R. L.; Jangam, S. R.; Yamada, D. H.; Hardie, D.; Kelso, D. M. J. Virol. Methods 2015, 214, 37-42. (27) Gan, W.; Zhuang, B.; Zhang, P.; Han, J.; Li, C. X.; Liu, P. Lab Chip 2014, 14, 3719-3728. (28) Zhuang, B.; Gan, W.; Wang, S.; Han, J.; Xiang, G.; Li, C. X.; Sun, J.; Liu, P. Anal. Chem. 2015, 87, 1202-1209. (29) Zhuang, B.; Han, J.; Xiang, G.; Gan, W.; Wang, S.; Wang, D.; Wang, L.; Sun, J.; Li, C. X.; Liu, P. Lab Chip 2016, 16, 86-95. (30) Kendall, E. L.; Wienhold, E.; DeVoe, D. L. Biomicrofluidics 2014, 8, 044109. (31) Bhattacharya, S.; Datta, A.; Berg, J. M.; Gangopadhyay, S. J. Microelectromech. S. 2005, 14, 590-597. (32) Bulwan, M.; Wojcik, K.; Zapotoczny, S.; Nowakowska, M. J. Biomater. Sci. Polym. Ed. 2012, 23, 1963-1980. (33) Theapsak, S.; Watthanaphanit, A.; Rujiravanit, R. ACS Appl. Mater. Interfaces 2012, 4, 2474-2482. (34) Gryson, N. Anal. Bioanal. Chem. 2010, 396, 2003-2022.

(7) Wu, Q.; Bienvenue, J. M.; Hassan, B. J.; Kwok, Y. C.; Giordano, B. C.; Norris, P. M.; Landers, J. P.; Ferrance, J. P. Anal. Chem. 2006, 78, 5704-5710. (8) Duarte, G. R.; Price, C. W.; Littlewood, J. L.; Haverstick, D. M.; Ferrance, J. P.; Carrilho, E.; Landers, J. P. Analyst 2010, 135, 531537. (9) Hwang, K. Y.; Kwon, S. H.; Jung, S. O.; Namkoong, K.; Jung, W. J.; Kim, J. H.; Suh, K. Y.; Huh, N. Anal. Chem. 2012, 84, 7912-7918. (10) Cao, W.; Easley, C. J.; Ferrance, J. P.; Landers, J. P. Anal. Chem. 2006, 78, 7222-7228. (11) Reedy, C. R.; Price, C. W.; Sniegowski, J.; Ferrance, J. P.; Begley, M.; Landers, J. P. Lab Chip 2011, 11, 1603-1611.

ACS Paragon Plus Environment

Page 9 of 11

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Figure 2 73x101mm (300 x 300 DPI)

ACS Paragon Plus Environment

Analytical Chemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3 78x163mm (300 x 300 DPI)

ACS Paragon Plus Environment

Page 10 of 11

Page 11 of 11

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Figure 5 75x105mm (300 x 300 DPI)

ACS Paragon Plus Environment