Anal. Chem. 1998, 70, 3818-3823
Combating PCR Bias in Bisulfite-Based Cytosine Methylation Analysis. Betaine-Modified Cytosine Deamination PCR Karl O. Voss, K. Pieter Roos, Randy L. Nonay, and Norman J. Dovichi*
Department of Chemistry, University of Alberta, Edmonton, Alberta T6G 2G2, Canada
Sodium bisulfite-induced cytosine deamination/PCR (CDPCR) is currently the most sensitive and robust method to determine the methylation status of all cytosines in a specific DNA sequence. The CDPCR products are directly sequenced with Thermosequenase and capillary electrophoresis; peak areas are then used to determine the mole fraction of methylated cytosines at each site in a single analysis. Here we show that, if the original DNA sample is a mixture of methylated and unmethylated DNA, conventional CDPCR discriminates against the sequence originating from the methylated DNA; CDPCR product does not accurately represent the methylation status of the original DNA sample. While CDPCR bias can lead to serious errors when determining methylation levels, the addition of betaine (N,N,N-trimethylglycine) to the PCR reaction buffer reduces this bias to less than 10%. While traditional Sanger DNA sequencing provides the sequence of every adenine, cytosine, guanine, and thymine in a DNA molecule, it is unable to uncover the positions of modified bases in a DNA molecule. One such base is 5-methylcytosine (5-Me-C). 5-Me-C is found in the genomes of most higher organisms and all vertebrates and is thought to be involved in the control of genetic expression, including cancer,1 genomic imprinting,2 cellular differentiation,2 and Alzheimer’s disease.3 5-Me-C is usually found in CG dinucleotides. The positions of 5-Me-C in a DNA sequence are consistent within a tissue but vary between tissues. Intermediate levels of methylation are expected during differentiation, as the methylation pattern of a stem cell is modified into the methylation pattern of the differentiated tissue. As an extreme example of differentiation, intermediate methylation levels are expected in cancer cells as clonal selection modifies the methylation content of the tumor. Therefore, a useful method for DNA methylation analysis not only must indicate positions of 5-Me-C in a DNA sequence but also must accurately determine the mole fraction of 5-Me-C for each cytosine in that sequence. Study of 5-Me-C’s role in genetic expression has proven difficult, mainly because no robust technology is available to analyze 5-Me-C in genomic DNA sequences. Restriction enzymes (1) Jones, P. A. Cancer Res. 1996, 56, 2463-2465. (2) Monk, M. Dev. Genet. 1995, 17, 188-197. (3) Ledoux, S.; Nalbantoglu, J.; Cashman, N. R. Mol. Brain Res. 1995, 24, 140144.
3818 Analytical Chemistry, Vol. 70, No. 18, September 15, 1998
Figure 1. Proposed mechanism for deamination of cytosine by sodium bisulfite.
are widely used to probe methylation patterns.4 Unfortunately, the entire arsenal of restriction enzymes cannot probe all possible DNA sequences that may contain 5-Me-C. Maxam-Gilbert chemical sequencing5 has been used to study methylation.6 The technique is qualitative, has very poor sensitivity, and requires the use of toxic reagents. Successful use of chemical sequencing for high-sensitivity methylation analysis has been accomplished by ligation-mediated PCR,7 but use of this technique has been rarely reported. Selective base conversion with sodium bisulfite appears to be the most promising method to probe cytosine methylation at all possible positions in a DNA sequence.8 The 5-6 double bond of cytosine (and 5-Me-C) is a target for many interesting chemical reactions.9 Under certain conditions, sodium bisulfite quantitatively adds across the 5-6 double bond of cytosine, while 5-Me-C remains unreacted (Figure 1).10 Bisulfite addition renders the cytosine susceptible to hydrolytic deamination; subsequent elimination of the bisulfite results in the formation of uracil. To determine the methylation status of a particular DNA sequence, (4) Bird, A. P.; Southern, E. M. J. Mol. Biol. 1978, 118, 27-47. (5) Maxam, A. M.; Gilbert W. Methods Enzymol. 1984, 65, 499-560. (6) Church, G. M.; Gilbert, W. Proc. Natl. Acad. Sci. U.S.A. 1984, 81, 19911995. (7) Pfeifer, G. P.; Steigerwald, S. D.; Mueller, P. R.; Wold, B.; Riggs, A. D. Science 1989, 246, 810-812. (8) Frommer, M.; McDonald, L. E.; Millar, D. S.; Collis, C. M.; Watt, F.; Grigg, G. W.; Molloy, P. L.; Paul, C. L. Proc. Natl. Acad. Sci. U.S.A. 1992, 89, 1827-1831. (9) Hayatsu, H. J. Biochem. 1996, 119, 391-395. (10) Wang, R. Y.; Gehrke, C. W.; Ehrlich, M. Nucleic Acids Res. 1980, 8, 47774790. S0003-2700(98)00067-5 CCC: $15.00
© 1998 American Chemical Society Published on Web 09/15/1998
the DNA is first denatured and then subjected to deamination with sodium bisulfite. A sequence from one strand of the deaminated DNA is then amplified using PCR with primers specific to that strand; this technique has been dubbed cytosine deamination PCR (CDPCR). 5-Me-C’s in the original DNA appear as the only remaining cytosines in the PCR product, while all unmethylated cytosines appear as thymine in the PCR product. CDPCR is simple and highly sensitive, can analyze individual strands of a duplex DNA molecule, and can generate quantitative data. To determine the positions and extent of methylation at each cytosine, the PCR products are usually cloned and then sequenced. However, cloning selects single PCR product molecules. Many clones need to be sequenced to obtain a statistically significant estimate of the methylation status of the genomic DNA. Let p be the probability that a particular cytosine is methylated. Let N be the number of clones that have been sequenced. The relative precision in the estimated methylation level is governed by the binomial distribution,
σrelative )
x1Np- p
(1)
In the case of half-methylated DNA (p ) 0.5), at least 100 clones must be sequenced to determine the methylation level with 10% relative precision. These results are a reflection of the unavoidable binomial statistics that describe the sampling process when sequencing clones. Rather than sequencing many clones, it is preferable to sequence the PCR products directly. The peak area from each CG site is then used to estimate the fraction of 5-Me-C in the genomic sample. Paul and Clark exploited this idea by generating sequencing fragments with Sequenase and measuring peak areas after electrophoresis with an automated sequencer.11 They performed CDPCR on two samples: a methylated standard and an unmethylated standard. The CDPCR products were mixed in specified ratios and sequenced. The ratio of peak heights in the C and T termination reaction was used to estimate the accuracy of the sequencing portion of the protocol; the authors reported that the peak heights had a precision of 10%. Unfortunately, this experiment provided no estimate of bias introduced by differential amplification of the deamination products from methylated and unmethylated DNA. Mixtures of methylated and unmethylated DNA generate different sequences in the deamination products. Subsequent PCR on these deamination products is an example of competitive PCR; the two sequences may not amplify at identical rates. In this paper, we simplify the CDPCR procedure by analyzing a single termination reaction and by using cycle sequencing. In the process of calibrating the procedure, we discovered that CDPCR suffers from significant bias and very poor accuracy. We report that this bias can be greatly reduced by addition of 2 M betaine (N,N,N-trimethylglycine) to the PCR buffer. EXPERIMENTAL SECTION Standard Preparation. A 30-µg aliquot of pUC19 plasmid DNA was linearized with EcoR1 restriction enzyme (Gibco, (11) Paul, C. L.; Clark, S. J. BioTechniques 1996, 21, 126-133.
Gaitherburg, MD), precipitated in 95% ethanol, and resuspended in TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0). The linearized pUC19 was used in all subsequent steps. A 17-µg aliquot of the linear plasmid was methylated with SssI methylase (New England Biolabs, Beverly, MA) according to the manufacturer’s instructions. The DNA was checked for complete methylation by digestion with HpaII (Gibco) restriction enzyme. No trace of digested DNA was visible on an ethidium bromide stained agarose gel after a 2-h incubation with HpaII. Unmethylated pUC19 was fully digested by HpaII. Methylation with SssI methylase blocks restriction by HpaII. Post-CDPCR Mixing Experiment. Stock solutions of both standard pUC19 and methylated pUC19 were prepared. The concentrations of both stock solutions were measured by fluorescence in a 5 µg/µL ethidium bromide solution with a Turner TD-700 filter fluorometer. Both stock solutions were diluted to a concentration of 300 ng/µL. Ten microliters of each stock solution was added to separate 1.5-mL microfuge tubes. Then, 5 µL of 1 M sodium hydroxide was added to each tube, and the tubes were incubated at 55 °C for 10 min to ensure complete denaturation of the DNA. Next, 1.2 mL of a freshly prepared 4 M sodium bisulfite (Sigma, St. Louis, MO), 1 mM hydroquinone (Sigma) solution at pH 5.0 was added to each tube while they were maintained at 55 °C. The mixtures were covered with light mineral oil (Sigma) to prevent evaporation and incubated at 50 °C. After 24 h, the tubes were cooled on ice, and the oil was removed. To each tube was added 10 µL of glassmilk (Bio101, Vista, CA), and the DNA was allowed to bind to the glassmilk for 20 min on ice. The glass beads were washed three times with NEW wash, and the deaminated DNA was recovered in 50 µL of TE buffer. The deamination reaction was completed by the addition of 20 µL of 1 M sodium hydroxide to the recovered DNA. Both tubes were incubated for 15 min at room temperature before 45 µL of 7.5 M ammonium acetate (pH 7) was added. The DNA was precipitated with 400 µL of 95% ethanol and resuspended in 50 µL of TE. A 250-base-pair sequence was amplified from the deaminated DNA in each tube. The PCR reactions had a total volume of 100 µL, containing 100 µM each of dNTP, 1× PCR buffer (Gibco), and 1.5 mM magnesium chloride, 50 pmol each of the P100 and P307M13 primers, and 2.5 units of Taq polymerase (Gibco). The primer sequences were as follows: P100 ) 5′ TATGGTGTATTTTTAGTATAATTTG 3′ and P307M13 ) 5′ TGTAAAACGACGGCCAGTATCATAACATTAACCTATAAAAATA 3′. These primers amplify a 250-base-pair product from the deaminated pUC19 as well as incorporate a priming site for the M13-21 forward sequencing primer at one end of the PCR product. Thermal cycling was done with an MJ Research (Watertown, MA) PTC100 thermal cycler with a heated lid. Cycling conditions were 30 cycles of 94 °C for 10 s, 58 °C for 30 s, and 72 °C for 60 s. A 5-µL aliquot of each PCR reaction product was run on a 1% agarose gel to estimate its purity. Each PCR reaction was purified by a PCR cleanup spin column (Qiagen, Santa Clarita, CA), and the concentration was measured by fluorescence in ethidium bromide. To obtain a template for a calibration curve experiment, the PCR product from methylated and deaminated pUC19 was mixed with the PCR product from the unmethylated and deaminated pUC19 in 25%, 50%, and 75% proportions. Cycle sequencing was performed on the PCR Analytical Chemistry, Vol. 70, No. 18, September 15, 1998
3819
products from both methylated and unmethylated pUC19 as well as the mixed PCR products using the Thermosequenase kit with 7-deaza-G (Amersham, Arlington, IL). The 8-µL sequencing reactions contained 2 µL of Thermosequenase A reagent, 0.4 pmol of ROX M13-21 dye-labeled primer (Perkin-Elmer, Foster City, CA), and 10 ng of PCR product mixtures as template. Cycling sequencing conditions were 30 cycles of 95 °C for 30 s and 55 °C for 30 s. Three sequencing reactions were performed on each PCR product or PCR product mixture. After cycling, the sequencing reactions were precipitated with ethanol and resuspended in 5 µL of deionized formamide for injection on the capillary electrophoresis instrument. Pre-CDPCR Mixing Experiment. The 300 ng/µL solutions of methylated and unmethylated pUC19 DNA were mixed in six tubes to generate standard solutions that contained 100%, 80%, 60%, 40%, 20%, and 0% methylated pUC19. Each tube contained 3 µg of total DNA. The mixture in each tube was then subjected to deamination conditions identical to those in the post-PCR mixing experiment. The final deaminated solutions were also of 50-µL total volume. These deaminated DNA mixtures were used as templates for PCR. The deamination products were PCR-amplified under conditions that were identical to those used for the post-CDPCR mixing experiment. A second reaction was also performed with the addition of 2 M betaine to the PCR buffer. Conditions for the sequencing of the pre-PCR mixtures were identical to those described for the post-PCR mixing experiment, except that 10 ng of each of the six PCR reactions amplified without betaine and the six PCR reactions amplified with betaine were sequenced directly; there was no mixing of the PCR products after amplification. Instrumentation. The five-capillary electrophoresis instrument with sheath flow cuvette was constructed in-house and will be described elsewhere.12,13 Briefly, the 543-nm line of the green helium-neon laser (Melles Griot, Irvine, CA) was used to excite the ROX dye-labeled primer, and fluorescence was collected through a 605DF10 band-pass filter (Omega Optical, Brattleboro, VT). The intensity of the fluorescence was sampled at 4 Hz. Capillaries of 42 cm × 150 µm o.d. × 50 µm i.d. dimension were coated with γ-methacryloxypropyltrimethoxysilane (Sigma) in 95% ethanol. The coated capillaries were filled with a polymerizing 7% acrylamide solution, without cross-linker, and the solution was allowed to polymerize overnight. Urea (7 M, ICN, Costa Mesa, CA) was present as denaturant, and 1× TBE (89 mM Tris, 89 mM borate, 1 mM EDTA, pH 8.2) was used as a buffer. The temperature of the capillaries was maintained at 40 °C during the injection and separation procedures. Samples were injected on the capillaries by applying a 100 V cm-1 electric field for 15 s. After injection, the sample vial was replaced with a 1× TBE running buffer, and a 150 V cm-1 field was applied across the capillary to separate the DNA fragments. Data Analysis. Electropherograms from the sequencing runs were imported into Peak Fit v4.0 (Jandel Scientific, San Rafael, CA), and the adenine peaks, which were complementary to the positions of two partially methylated cytosine residues, were (12) Zhang, J. Z.; Yan, J.; Jiang, R.; Ren, H.; Hou, J. Y.; Fang, Y.; Roos, P.; Lewis, S.; Lewis, D.; Dovichi, N. J. Unpublished results. (13) Swerdlow, H.; Zhang, J. Z.; Chen, D. Y.; Harke, H. R.; Grey, R.; Wu, S.; Fuller, C.; Dovichi, N. J. Anal. Chem. 1991, 63, 2835-2841.
3820 Analytical Chemistry, Vol. 70, No. 18, September 15, 1998
identified. The nearest adenine peak, which was complementary to a thymine residue, was also identified. After baseline subtraction, all peaks in this area were fit with a set of five-parameter GEMG (half-Gaussian-exponentially modified Gaussian hybrid) curves to calculate their areas. The area of the adenine peak complementary to the 5-Me-C position was divided by the area of the neighboring adenine peak,
Ratio )
area5-Me-C areaT
(2)
where Ratio is the ratio of the areas of the two peaks, area5-Me-C is the area of the adenine peak that was complementary to the 5-Me-C in the original sequence, and areaT is the area of the adenine peak that was complementary to a neighboring thymine peak. The adenine peak acts as an internal standard for the peaks generated by PCR amplification of the deaminated cytosine. This ratio was defined as 100% for the completely unmethylated sample and as 0% for the completely methylated sample. The fraction of methylation was estimated by
mole fraction 5-Me-Cfinal )
Ratiosample - Ratio0% Ratio100% - Ratio0%
)
mol Cfinal (3) mol Cfinal + mol 5-Me-Cfinal
where Ratio100%, Ratio0%, and Ratiosample are the peak ratios for the 100% methylated standard, the 0% methylated standard, and the sample, respectively. The second equality is the definition of mole fraction. Mol Cfinal and mol 5-Me-Cfinal are the number of moles of the CDPCR products from the unmethylated and methylated DNA. RESULTS AND DISCUSSION A flowchart of the chemistry for methylated pUC19 is shown in Figure 2. Double-stranded pUC19 is first treated with SssI methylase, which quantitatively methylates all cytosines that are in CG dinucleotides; this material serves as the methylated DNA standard in the analysis. This methylated DNA is next treated with bisulfite, which quantitatively converts unmethylated cytosines to uracil, while leaving methylated cytosine unaffected. The two strands are no longer complementary. One strand is chosen for PCR amplification by use of appropriate primers. During PCR, U is amplified as T, and 5-Me-C is amplified as C. One of the PCR strands is next chosen as the template for a singlebase sequencing reaction. In our experiment, the bottom PCR strand in part D of the figure was used as the template for the A termination reaction. A new peak appears after CDPCR when unmethylated C’s are amplified as T’s in the sequencing template, generating an A in the sequencing ladder. In the original work of Paul and Clark, two sequencing reactions are performed: one reaction to detect the appearance of new peaks due to the conversion of cytosine to uracil and the other to detect the preservation of 5-methylcytosine residues as cytosine. We chose to use a single reaction, focusing on the appearance of uracil in the converted product, which generated a peak in the A-terminated sequencing reaction. The thymine
Figure 2. Flowchart summarizing the process for quantitation of cytosine methylation by sodium bisulfite deamination and direct cycle sequencing. (A) This sequence represents a small part of the linear double-stranded pUC19 DNA molecule. (B) The pUC19 molecule after methylation with SssI methylase, which methylates all cytosines in the sequence 5′ CG 3′. (C) The pUC19 molecule after deamination with sodium bisulfite. C is converted to U, but 5-Me-C is unaffected. The pUC19 is no longer double-stranded because deamination has destroyed the strand complementarity. (D) The PCR product from the deaminated pUC19. Primers are designed to amplify a sequence from one strand of the deaminated pUC19. One end of the PCR product will contain the sequence for a M13-21 standard sequencing primer. (E) Cycle sequencing of the PCR product. ROX-labeled DNA fragments terminated with only A are created. Unmethylated C’s generate peaks in the A termination reaction. Methylated C’s do not contribute to peaks in the A termination reaction.
present in the original template served as an internal standard; completely unmethylated cytosines will generate peaks with the same amplitude as neighboring thymines, while completely methylated cytosines will not generate peaks in the reaction product. Direct sequencing of the CDPCR products requires that the peak height produced by the sequencing reaction be related to the amount of template. Paul and Clark employed Sequenase, which is a modified version of T7 DNA polymerase and which generates uniform peaks in sequencing reactions. We use Thermosequenase, which is a modified version of Taq DNA polymerase. This thermostable enzyme has incorporation properties similar to those of Sequenase, while it can be used in cycle sequencing. Post-PCR Mixing To Determine Accuracy of Thermosequenase Cycle Sequencing. We first replicated the work of Paul and Clark by using Thermosequenase, cycle sequencing, and the single termination reaction. Methylated pUC19 and unmethylated pUC19 standards were subjected to separate CDPCR protocols. The products were then pooled and sequenced. Because the methylated and unmethylated DNA are mixed after PCR, this experiment provides no information on errors introduced due to differential amplification of the reaction products generated by deamination of the methylated and unmethylated DNA. This calibration curve determines the accuracy of the Thermosequenase reaction and capillary electrophoresis analysis.
Figure 3. Sequencing electropherograms from mixtures of PCR products arising from either SssI methylated or unmethylated pUC19. Above the electropherograms is the sequence of the original pUC19 template. Below this sequence is the complementary sequence to the deaminated product; the complement to the deaminated product contains a G or an A, depending on the methylation status of the complementary C. 5-Me-C generates a G in the complement of the deaminated product, while unmethylated cytosine generates an A in the complement to the deaminated product. All potentially methylated sites are shown in bold. Electropherograms A-E are mixtures of PCR products from unmethylated pUC19 and methylated pUC19 in 0%, 25%, 50%, 75%, and 100% 5-Me-C PCR product, respectively. Arrows indicate peaks corresponding to the position of methylated cytosines in the original pUC19 template. The arrows marked X and Y indicate the positions of cytosines used to obtain the data in Table 1.
An electropherogram of the A-terminated sequencing reaction of each PCR product mixture is shown in Figure 3. Peaks corresponding to positions of methylated cytosines became progressively smaller as the amount of PCR product from the methylated pUC19 increased. The relative peak areas corresponding to T’s in the pUC19 template remained constant as the ratio of PCR products from methylated and unmethylated pUC19 was varied. Small ghost peaks were seen in the baselines of all the electropherograms. The extent of methylation at two cytosine sites, labeled X and Y in the electropherogram, was estimated by use of eq 3, which employs the neighboring A peaks as internal standards and corrects for the ghost peaks in the baseline. The data are shown in Table 1. The measured values for peak Y are close to the expected value, while the data for peak X tend to be slightly higher than expected. Analytical Chemistry, Vol. 70, No. 18, September 15, 1998
3821
Table 1. Calibration Curve Generated by Mixing CDPCR Products of Methylated and Unmethylated pUC19a 5-Me-C, %
X, %
Y, %
0 25 50 75 100
0 30 55 78 100
0 25 48 76 100
a X and Y are the average percentage of 5-Me-C at sites X and Y in Figure 3.
Table 2. Calibration Curve Generated by Mixing Methylated and Unmethylated pUC19 and Then Performing Conventional CDPCRa 5-Me-C, %
X, %
Y, %
0 20 40 60 80 100
0 6 7 25 62 100
0 6 11 17 53 100
a X and Y are the average percentage of 5-Me-C at sites X and Y (electropherogram data not shown).
Pre-CDPCR Mixing To Determine the Accuracy of Conventional CDPCR. We wished to determine the bias inherent in CDPCR. In this experiment, the methylated and unmethylated pUC19 standards were mixed, subjected to CDPCR, and sequenced. Because the methylated and unmethylated DNA are mixed before PCR, this experiment is sensitive to differential PCR amplification of the reaction products generated by deamination of the methylated and unmethylated DNA. The data in Table 2 reveal that the PCR reaction preferentially amplified the sequence of deaminated, unmethylated DNA. This result is not surprising, since the deamination products of the methylated DNA will have higher G-C content than the products of the unmethylated fraction; the higher G-C content of the methylated fraction will lead to both higher melting temperature for the duplex and more secondary structure in the denatured strand. Both effects will decrease the amplification rate by decreasing the hybridization of the PCR primer to the template. We have modeled the effect of differential amplification in PCR. The differential amplification, D, describes the relative increase in the product from unmethylated DNA during the PCR:
mol Cinitial mol Cfinal )D mol 5-Me-Cfinal mol 5-Me-Cinitial
(4)
Equation 4 can be substituted into eq 3 and then written in terms of the initial mole fraction of unmethylated DNA:
mole fraction 5-Me-Cfinal ) mole fraction 5-Me-Cinitial D + (1 - D)(mole fraction 5-Me-Cinitial)
(5)
The data for peaks X and Y were averaged and plotted in Figure 3822 Analytical Chemistry, Vol. 70, No. 18, September 15, 1998
Figure 4. Effect of betaine on PCR bias. The data for peaks X and Y in Table 2 were averaged at each concentration of 5-Me-C and plotted as the open circlessthis is the calibration curve generated by conventional CDPCR. The bottom curve is a least-squares fit of eq 5 to the conventional CDPCR data; D ) 4.0. The data for peaks X and Y in Table 3 were averaged at each concentration of 5-Me-C and plotted as asteriskssthis is the calibration curve generated by betaine modified CDPCR. The top curve is the least-squares fit of eq 5 to the betaine-modified CDPCR data; D ) 1.2.
Table 3. Calibration Curve Generated by Mixing Methylated and Unmethylated pUC19 and Then Performing Betaine-Modified CDPCR 5-Me-C, %
X, 5
Y, 5
0 20 40 60 80 100
0 18 40 58 79 100
0 24 28 49 72 100
a X and Y are the average percentage of 5-Me-C at sites X and Y (electropherogram data not shown).
4 as open circles; the smooth curve is the nonlinear least-squares fit of eq 5 to the data. In this case, D ) 4.0; that is, the unmethylated fraction of the sample was amplified 4 times more than was the methylated fraction during PCR. Bias in the PCR reaction is a serious problem in bisulfite-based methylation analysis. For instance, a gene that is methylated on one chromosome and not on the other should indicate a 50% methylation level by bisulfite analysis. If our pUC19 sequence were this gene, we would have estimated its methylation status to be ∼20%. This result could be mistaken for an unmethylated sequence, particularly if the CDPCR product is cloned and only a few clones are sequenced. Pre-CDPCR Mixing To Determine the Accuracy of Betaine-Modified CDPCR. We wished to minimize the bias in conventional CDPCR. We speculate that G-C hybrids in the methylated DNA’s deamination product create secondary structures that inhibit the efficiency of amplification in the PCR step. We added 2 M betaine to the PCR buffer to minimize G-C hybridization. Betaine is known to preferentially destabilize GC
base-pairs.14 It may eliminate the PCR bias by removing secondary structures created by GC base-paring. Betaine does not appear to disrupt enzyme activity or DNA-protein interactions14 and has been previously used to help achieve uniform amplification of repetitive DNA regions.15 Table 3 presents the data obtained from the pre-PCR mixing experiment when 2 M betaine is included in the PCR reactions. The data were averaged for peaks X and Y and plotted in Figure 4; the dashed curve is the least-squares fit of eq 5 to the data; D ) 1.2 for these data. The addition of betaine to the PCR reactions reduced the PCR bias by more than factor of 3. While there is residual bias, it is sufficiently small in this particular application.
CONCLUSION Sodium bisulfite deamination PCR amplification of genomic DNA is currently the simplest, quickest, and most sensitive method to determine the methylation status of all cytosines in a DNA sequence. Direct single-termination dye-primer sequencing with Thermosequenase has a linear response to the concentration of CDPCR products in a methylation analysis sample. It is currently the fastest and most precise method to accomplish this analysis. However, the analysis may be biased during the PCR step. This bias is problematic when the sample is a mixture of methylated and unmethylated DNA. However, well-controlled experiments can uncover PCR bias, and this bias can be reduced or eliminated by the inclusion of betaine in the PCR buffer.
(14) Rees, W. A.; Yager, T. D.; Korte, J.; von Hippel, P. H. Biochemistry 1993, 32, 137-144. (15) Baskaran, N.; Kandpal, R. P.; Bhargava, A. K.; Glynn, M. W.; Bale, A.; Weissman, S. M. Genome Res. 1996, 6, 633-638.
Received for review January 23, 1998. Accepted July 1, 1998. AC980067T
Analytical Chemistry, Vol. 70, No. 18, September 15, 1998
3823
