Development of an Immunoassay for Chloramphenicol Based on the

Mar 22, 2016 - The ELISA based on the scFv-AP required higher concentrations of both immunoreagents than the ELISA based on the mAb. The concentration...
1 downloads 0 Views 4MB Size
Download PDF
Article pubs.acs.org/JAFC

Development of an Immunoassay for Chloramphenicol Based on the Preparation of a Specific Single-Chain Variable Fragment Antibody Xin-jun Du,† Xiao-nan Zhou,† Ping Li,† Wei Sheng,† Frédéric Ducancel,‡ and Shuo Wang*,† †

Key Laboratory of Food Nutrition and Safety, Ministry of Education of China, Tianjin University of Science and Technology, Tianjin 300457, China ‡ Pharmacology and Immune Analysis Department, CEA/Saclay, F-91191 Gif-sur-Yvette, France ABSTRACT: Specific antibodies are essential for the immune detection of small molecule contaminants. In the present study, the heavy and light variable regions (VH and VL) of the immunoglobulin genes from a hybridoma secreting a chloramphenicol (CAP)-specific monoclonal antibody (mAb) were cloned and sequenced. In addition, the light and heavy chains obtained from the monoclonal antibody were separated using SDS−PAGE and analyzed using Orbitrap mass spectrometry. The results of DNA sequencing and mass spectrometry analysis were compared, and the VH and VL chains specific for CAP were determined and used to construct a single-chain variable fragment (scFv). This fragment was recombinantly expressed as a soluble scFv-alkaline phosphatase fusion protein and used to develop a direct competitive ELISA. Compared with the parent mAb, scFv exhibits lower sensitivity but better food matrix resistance. This work highlights the application of engineered antibodies for CAP detection. KEYWORDS: chloramphenicol, single-chain variable fragment, recombinant expression, direct competitive ELISA

■

INTRODUCTION Chloramphenicol (CAP, D-(−)-threo-2-dichloroacetamido-1-pnitrophenyl-1,3-propanediol), is a broad-spectrum antibiotic suitable for the treatment of several infectious organisms1 because of its effective antibiotic activity against Gram-positive and Gram-negative microorganisms. Since the 1950s, CAP has been used for the treatment of animals worldwide, reflecting the low cost, ready availability, and standout performance of this antibiotic in the treatment of several infectious diseases based on protein synthesis inhibition.2 Nevertheless, many studies have shown that the use of CAP can lead to serious adverse reactions and side effects, such as bone marrow suppression, aplastic anemia, thrombocytopenia, and granulocytopenia, both in humans and in animals. CAP has been restricted to clinical use in the treatment of serious infections in many countries, such as USA, Canada, and China.3 Other countries have stipulated maximum residue limits of CAP4 to control the abuse of this drug in food-producing animals. However, CAP is still illegally used in livestock and aquaculture, reflecting the accessibility and low cost of this antibiotic.5 Therefore, it is necessary to develop simple, specific, and sensitive analytical methods to effectively monitor CAP levels in food commodities. Enzyme-linked immunosorbent assays (ELISA) based on the specific binding of antibodies and antigens have become welldeveloped techniques for the determination of trace amounts of small analytes. These assays are analytical tools for the common monitoring of food contaminants, reflecting the rapid, sensitive, and cost-effective features of these techniques.6 Immunoassays are typically performed using a monoclonal antibody (mAb) or a polyclonal antibody (pAb) and standardized immunochemical measures.7 mAbs show many advantages over pAbs. Hybridoma technology has been used to generate monoclonal antibodies against CAP, but hybridoma clones might experience the loss of antibody secretion with the passage of time.8 © XXXX American Chemical Society

Recombinant DNA technology has recently facilitated the cloning of desired antibody genes to obtain recombinant antibodies. Single-chain variable fragment (scFv), containing a complete antigen binding site comprising the variable domain of the light and heavy chains of an antibody linked by a small, flexible peptide chain, is one of the most conventional types of recombinant antibodies.9,10 Previous studies have primarily focused on the clinical potential of scFv as these proteins are considered less harmful than whole antibodies, reflecting the lack of an Fc region, which is responsible for activating the complement response in the body.11 Moreover, scFv molecules are smaller, potentially facilitative, and easier to obtain.12 Using overlap extension PCR, it is easy to produce an scFv antibody in bacterial expression vectors.13 Compared with monoclonal antibodies, scFv not only has a low cost but also can be fused with a marker molecule for effective immunological detection.14 Enzyme-labeled conjugates show great application potential in detection techniques, reflecting several advantages: the safety and stability of the reagents, the intrinsic amplification, and the multifarious methods available to determine enzyme activity. Currently, chemical labeling is the method for obtaining the conjugates that are commonly used. However, chemical methods also uncover faultiness, such as the fractional denaturation of both component elements and the heterogeneity of coupling.15 To overcome these problems and retain the advantages of enzyme-linked proteins, recombinant DNA technology, which facilitates the direct production of enzymetagged recombinant proteins in a bacterial expression system, might constitute an interesting approach.16,17 Escherichia coli alkaline phosphatase (AP) (EC 3.1.3.1), which exhibits Received: February 5, 2016 Revised: March 17, 2016 Accepted: March 22, 2016

A

DOI: 10.1021/acs.jafc.6b00639 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 1. Primers Used in the Present Study name

sequence

VH-Backa VH-Fora VK-Backb MJK1-FONXb MJK2-FONXb MJK4-FONXb MJK5-FONXb MJL1-FONXb CAP-VH15 SfiIc CAP-VL1 NotIc PhoA-Ford PhoA-Revd His-For BamHIe His-Rev Sf iIe

AGGTSMARCTGCAGSAGTCWGG TGAGGAGACGGTGACCGTGGTCCCTTGGCCCC GACATTGAGCTCACCCAGTCTCCA CCGTTTGATTTCCAGCTTGGTGCC CCGTTTTATTTCCAGCTTGGTCCC CCGTTTTATTTCCAACTTTGTCCC CCGTTTCAGCTCCAGCTTGGTCCC TAGGACAGTGACCTTGGT TACTCAGGCCCAGCCGGCCATGCAGGTGCAGCTGCAGCAGT TACTCAGCGGCCGCCCGTTTCAGCTCCAGCTT CGGTGACGTAGTCCGGTT ATTGTGAGCGGATAACAATTT TACTCAGGATCCTTTAATGTATTTGTACATGGA TACTCAGGCCGGCTGGGCCGGGTGGTGGTGGTGGTGGTGCATTTCTGGTGTCCGGGCTTTTGT

a

Primers used for the amplification of VH. bPrimers used for amplification of VL. cPrimers used to construct the scFv-pLIP6/GN expression vector. Primers used for sequencing. ePrimers used to insert a His-tag coding sequence. Regions shown in italics indicate different restriction sites. The underlined region indicates the His-tag coding sequence. d

10A3B6E, which secretes a mAb against CAP, was previously established in our laboratory. All aqueous solutions and buffers were prepared with water purified using the Milli-Q system (Millipore, Bedford, MA, USA). Polystyrene 96-well microplate and multilabel counter for ELISA analysis were obtained from Thermo Fisher Scientific Inc. (Waltham, MA, USA). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS− PAGE) was performed using a PowerPac Universal power supply, and the gels were imaged and analyzed using a Gel Doc XR system (BioRad, Hercules, CA, USA). Sequencing of Variable Regions of Immunoglobulin Genes. Total RNA was extracted from the separated hybridoma cell line 10A3B6E (approximately 1 × 107 cells) using an RNeasy Mini Kit. Subsequently, the RNA was reverse transcribed using a GoScript Reverse Transcription System. The first cDNA (cDNA) and the synthetic primers27 were used for the in vitro amplification of the variable regions of IgG genes. The primers VH-Back and VH-For were used to amplify the heavy chain variable region. VK-back and a mixture of MJK1-FONX, MJK2-FONX, MJK4-FONX, MJK5-FONX, and MJL1-FONX were used to amplify the light chain variable region. All primer sequences used are listed in Table 1. The PCR protocol involved an initial denaturation at 94 °C for 2 min, followed by 20 cycles at 94 °C for 10 s, 52 °C for 45 s, and 65 °C for 1 min, with a final extension at 65 °C for 10 min. The amplification products were purified using an agarose gel extraction kit and cloned into the pMD18-T vector for sequencing (Genewiz, Suzhou, China). The sequences for the VL and VH regions were aligned to the immunoglobulin sequences in the National Center for Biotechnology Information (NCBI) databases using the BLAST search tool. Mass Spectrometry Analysis and Amino Acid Sequence Comparison. The CAP monoclonal antibodies were purified using a Protein A IgG purification kit. The purified product was hydrolyzed using papain. The Fc region of the antibody was absorbed with protein A, and the purified Fab was obtained. SDS−PAGE was used to separate the heavy chain and light chain. Subsequently, the heavy and light chains were cut from the gel and submitted to the Shanghai Institute of Materia Medica, Chinese Academy of Sciences, for Orbitrap mass spectrometry analysis. The obtained peptide fragments were compared with the results of the translated sequencing of the variable regions of immunoglobulin genes. The right VH and VL gene fragments, showing the highest level of similarity, were selected. Assembly of the scFv Gene and Construction of the Recombinant Expression Vector. The selected VL and VH regions were amplified from VL-pMD18-T and VH-pMD18-T and purified using an agarose gel extraction kit. Using the purified fragments and linker nucleotides as templates, the primers CAP-VH15 Sf iI and CAPVL1 NotI were used to amplify the scFv fragment containing the Sf iI

substrate specificity similar to the calf intestinal enzyme, is efficiently expressed in E. coli coupled to diverse antigens18,19 or antibody fragments.20−23 Therefore, recombinant protein techniques provide an alternative method for supplying uniform and stable immunoconjugates for use in diagnostic assays. Over the past few years, several immunoassays for CAP detection based on pAbs or mAbs24,25 have been improved. However, to our knowledge, an engineered antibody for this drug has not been reported. Previously, we produced a hybridoma cell line (10A3B6E) that secretes a mAb specific for CAP. In the present study, the scFv gene of this mAb was obtained and recombinantly expressed in E. coli cells. Using this engineered antibody, we developed a competitive direct ELISA for the detection of CAP in animal samples. This work is helpful for the development and application of engineered antibodies for small molecule detection in food safety.

■

MATERIALS AND METHODS

Materials and Instruments. The GoScript Reverse Transcription System and Pfu DNA polymerase were purchased from Promega (Madison, WI, USA). The cloning vector pMD18-T was purchased from TransGen Biotechnology Co. (Beijing, China). The soluble protein expression vector pLIP6/GN was generously provided by Dr. Frédéric Ducancel (Pharmacology and Immunoanalysis Department, CEA/Saclay, Gif-sur-Yvette, France). The oligonucleotide primers were synthesized at Invitrogen (Shanghai, China). The restriction enzymes Sf iI, NotI, and BamHI were purchased from New England Biolabs Inc. (Hertfordshire, U.K). T4 DNA ligase was obtained from Fermentas Co. (St. Leon-Rot, Germany). Standard CAP and the related agonists were purchased from Dr. Ehrenstorfer GmbH (Augsburg, Germany). Bovine serum albumin (BSA), ovalbumin (OVA), papain, and horseradish peroxidase (HRP)-labeled goat antimouse IgG were obtained from Sigma-Aldrich (St. Louis, MO, USA). Skim milk and the colorimetric substrate p-nitrophenyl phosphate (pNPP) were obtained from BD Co. (Shanghai, China) and Solarbio Co., Ltd. (Beijing, China), respectively. Nickel-nitrilotriacetic acid (NiNTA) agarose was obtained from Novagen (Darmstadt, Germany). Agarose gel DNA purification, PCR product purification, and plasmid mini kits were supplied from Omega Biotek, Inc. (Norcross, GA, USA). The RNeasy Mini Kit was purchased from Qiagen (Dusseldorf, Germany). The E. coli strains DH5α and BL21(DE3) and the Protein A IgG purification kit were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Other reagents were of analytical quality. The coating antigen CAP-OVA conjugate was prepared in the laboratory using a previously described method.26 The hybridoma cell line B

DOI: 10.1021/acs.jafc.6b00639 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry restriction site at the 5′ end and the NotI restriction site at the 3′ end. The PCR amplification protocol involved an initial denaturation at 94 °C for 2 min, followed by 30 cycles at 94 °C for 1 min, 55 °C for 2 min, and 65 °C for 2 min, with a final extension at 65 °C for 10 min. The scFv products and vector pLIP6/GN were both digested with SfiI and NotI restriction enzymes. The pLIP6/GN vector contains a SfiI/NotI cloning site between codons that code for residues +6 and +7 of mature AP. The digested products were purified using a PCR product purification kit and subsequently ligated using the T4 DNA ligation enzyme. The inserted scFv and the alkaline phosphatase gene on the vector can generate a fusion protein, scFv-AP, after induction of the tac promoter using IPTG. The ligation products were transformed into E. coli DH5α competent cells for amplification. Restriction enzyme analysis and sequencing were performed to confirm the recombinant expression vector. PhoA-For and PhoA-Rev primers (Table 1) were used for sequencing.7 To easily purify the target protein, a His-tag coding sequence was inserted into the 5′ end of scFv in the recombinant plasmid. The region between the BamHI and Sf iI restriction sites of the pLIP6/GN plasmid was amplified using the primers His-For BamHI and His-Rev SfiI (Table 1). The amplified fragments containing a His-tag and the recombinant pLIP6/GN plasmid containing scFv were both digested with BamHI Sf iI and subsequently ligated together after purification. Insertion of the Histag coding region was confirmed by sequencing. Expression and Purification of the Anti-CAP scFv-AP Fusion Protein. The recombinant plasmid scFv-pLIP6/GN was extracted from DH5α cells and transformed into the E. coli BL21(DE3) strain. The colony was cultured in Luria−Bertani (LB) medium containing 100 μg/mL ampicillin at 37 °C and shaken at 200 rpm until the OD600 reached approximately 0.6−0.8. Subsequently, isopropyl β-Dthiogalactoside (IPTG) was added to the culture at a final concentration of 0.1 mmol/L and further shaken at 25 °C overnight. The bacteria in the cultures were centrifuged at 5,000 rpm for 5 min, and the supernatant was discarded. The bacterial cell pellets were resuspended in Tris-buffered saline (TBS; 0.01 mol/L, pH 7.4) and subsequently sonicated at 300 W, with a 3 s pulse and a 1 s pause for 99 cycles bathed in ice-cold water. The cell debris was removed using centrifugation at 12,000 rpm for 10 min at 4 °C. The supernatant was collected into a new tube for the purification of the target protein. The recombinant proteins were purified using a Ni-NTA agarose resin column, according to the manufacturer’s instructions. Subsequently, the eluted proteins were dialyzed against TBS for 3 days at 4 °C and detected using SDS−PAGE.28 After measuring the protein concentration using the Bradford method, the proteins were aliquoted and stored at -80 °C. Development and Evaluation of an ELISA. The direct competitive ELISA analysis was performed in the following manner. Microtiter plates were pretreated with coating antigen CAP-OVA (100 μL/well) diluted in carbonate buffer (0.05 mol/L, pH 9.6) at 4 °C overnight. After washing 3 times with TBST (0.01 mol/L TBS containing 0.05% Tween-20, pH 7.4) and blocking with different blocking reagents in TBS (200 μL/well) for 1 h at 37 °C, the plates were thoroughly washed with TBST buffer. Fifty microliters of scFvAP fusion protein in TBS were mixed with an equal volume of different concentrations (serial 2-fold dilution from 2,000 ng/mL) of free CAP or one of its analogues and added to the wells, followed by incubation at 37 °C for 1 h. After incubation, the plates were washed four times with TBST. Subsequently, 100 μL/well of AP-substrate solution (1 mmol/L p-nitrophenyl phosphate, 1 mol/L Tris-HCl, 10 mmol/L MgCl2, 50 mmol/L ZnCl2; pH 8.0) was added into each well of the plates, and the mixture was incubated at 37 °C for 20 min. The absorbance at 405 nm was determined using a microplate reader. To obtain the optimal detection sensitivity, several parameters for the ELISA were optimized, including the CAP-OVA concentration needed for coating (0.01−0.5 μg/well), components and concentration of the blocking buffer (1.0% skim milk, 0.5% skim milk, 0.5% OVA, and 1.0% OVA), ionic strength (0.01−0.03 mol/L) and pH value (5.7, 7.4, and 8.5) of the buffers used to dilute CAP and the antibody, the concentration of the scFv-AP fusion protein, and the competition time. Under the optimal conditions, the sensitivity of the

ELISA using the scFv-AP fusion protein was compared with that of an ELISA using a horseradish peroxidase (HRP)-labeled goat anti-mouse IgG and the CAP-specific mAb to evaluate the effectiveness of the method developed in the present study. Cross-Reactivity. The CAP analogues thiamphenicol, florfenicol, CAP succinate, aureomycin, and streptomycin were used as competitors to evaluate the specificity of the ELISA method described above. The IC50 values (competitor concentration leading to a 50% decrease in the maximum signal) of the analogues were obtained and used to calculate the cross-reactivities. Sample Preparation and Matrix Effects Analysis. In the present study, shrimp and codfish samples were selected and analyzed by immunoassay. The samples were collected from a local supermarket in Tianjin. Shrimp and codfish samples were homogenized, and a 2 g sample was extracted with 6 mL of ethyl acetate after shaking for 1 min at room temperature. After centrifugation at 3,500 rpm for 20 min at 20 °C, the supernatant (3 mL) was collected, evaporated in a 60 °C water bath under a stream of nitrogen, and redissolved in 1 mL of TBS (0.01 mol/L, pH 7.4). Subsequently, the obtained mixture was shaken for 1 min and centrifuged at 3,000 rpm for 10 min, and the supernatant was collected for immunoassay analysis. To analyze the matrix effects, the extract was diluted 1/5, 1/10, 1/ 20, and 1/50 with TBS (containing 0.005% Tween) and used as a dilution buffer for CAP. Inhibition curves were drawn using CAP dissolved in the four diluted real extract samples, and the results were compared with the standard curve drawn using CAP dissolved in TBS. Recovery Analysis in Real Samples. The CAP-free shrimp and codfish samples were minced and homogenized, and the homogenates were spiked with CAP to final concentrations of 10, 30, and 100 ng/g, respectively. The spiked samples were incubated at 4 °C for 30 min. The samples were processed using the method described above. The extract was directly analyzed using ELISA, and the percentage recovery was calculated.

■

RESULTS Identification of VH and VL. The VH and VL were amplified from the hybridoma cell line 10A3B6E, with lengths

Figure 1. Agarose gel electrophoresis of the VL and VH fragments of the CAP-specific immunoglobulin gene. M, DNA marker DL2000; 1, VL fragment; 2, VH fragment.

of approximately 340 and 320 bp, respectively (Figure 1). The two fragments were cloned into pMD18-T vectors for sequencing. A total of 29 of 30 VH clones and 29 of 30 VL clones were successfully sequenced (Figure 2). Simultaneously, the mAb Fab was obtained after digestion with papain and purification with Protein A resin. The heavy and light chains were separated using SDS−PAGE and subsequently analyzed using Obitrap mass spectrometry. The results indicated that 5 C

DOI: 10.1021/acs.jafc.6b00639 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 2. Comparison of the results of DNA sequencing and Obitrap mass spectrometry. (A) Alignment of the variable regions of the CAP antibody heavy chain deduced from DNA sequencing with peptides obtained from Obitrap mass spectrometry analysis of the heavy chain of CAP Fab. (B) Alignment of the variable region of the CAP antibody light chain deduced from DNA sequencing with peptides obtained from Obitrap mass spectrometry analysis of the light chain of CAP Fab.

Table 2. Comparison of ELISA Methods Based on mAb and scFv-AP Proteins ELISA parameters

based on scFv-AP

based on mAb

coating antigen (μg/well) block buffer ionic strength (mol/L) pH value dilution of the antibody competition time (min) IC50 (ng/mL) LOD (IC15) (ng/mL)

0.1 1% skim milk 0.02 5.7 1:6 60 6.92 ± 0.24 1.11 ± 0.05

0.01 0.5% skim milk 0.05 5.7 1:8000 60 0.79 ± 0.01 0.15 ± 0.04

heavy chain peptides and 4 light chain peptides were obtained (Figure 2). The sequenced VH and VL fragments were translated into amino acids and compared with the peptides. Based on a comparison of the results, VH-17 (339 bp) and VL29 (321 bp) exhibited the highest similarity, and these fragments were selected for further study (Figure 2). Assembly and Recombinant Expression of scFv. After amplification using overlap extension PCR, a 710-bp scFv fragment was obtained (Figure 3A). The scFv amplification product was digested with Sf iI and NotI and subsequently ligated to the pLIP6/GN vector. The recombinant plasmid was

Figure 3. Amplification and expression of the CAP-specific scFv. (A) Amplification of scFv: M, DNA marker DL2000; 1, amplified scFv gene fragment. (B) Expression and purification of scFv-CAP: 1, expression of whole proteins from E. coli BL21 (DE3) harboring the scFv-pLIP6/ GN plasmid after IPTG induction; 2, expression of whole proteins from E. coli BL21(DE3) harboring the scFv-pLIP6/GN plasmid without IPTG induction; M, protein standards; 3 and 4, purified scFvCAP protein.

D

DOI: 10.1021/acs.jafc.6b00639 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 3. Cross-Reactivities of scFv-AP Proteins and mAb with CAP Analogues

further confirmed using restriction enzyme digestion and sequencing. The positive recombinant plasmid was amplified in E. coli DH5α and transformed into E. coli BL21(DE3) for heterogeneous expression. After induction with IPTG, SDS− PAGE was used to analyze the expression of the protein, and a 72-kDa band was detected, which was absent in the noninduced cells (Figure 3B). The periplasmic fractions were extracted from a large volume of induced BL21(DE3) cells and loaded onto a Ni-NTA column for purification of the target proteins. SDS−PAGE analysis demonstrated that the scFv-AP fusion proteins were highly purified (Figure 3B). Direct Competition ELISA. To evaluate the effectiveness of the purified scFv-AP fusion protein in CAP detection, two different ELISA assays, one based on the anti-CAP scFv-AP fusion protein and the other based on the anti-CAP mAb, were performed and the results were compared. Several parameters for the two types of ELISA tests were optimized, and the results are summarized in Table 2. The limit of detection (LOD) and

the IC50 values for the two protocols are also summarized in Table 2. The ELISA based on the scFv-AP required higher concentrations of both immunoreagents than the ELISA based on the mAb. The concentration of the coating antigen required for the ELISA based on the mAb was approximately one-fifth of that required for the ELISA based on scFv-AP. The AP substrates used for the ELISA based on the scFv-AP fusion protein facilitated the omission of the secondary antibody, thereby saving time. The sensitivity of the ELISA based on the mAb was approximately 9 times that of the ELISA based on the scFv-AP (IC50 = 0.74 ± 0.03 ng/mL vs IC50 = 6.92 ± 0.24 ng/ mL, respectively). The LODs, calculated as the concentrations resulting in 15% inhibition (IC15) of the maximal signal, were 0.16 ± 0.02 ng/mL (mAb) and 1.11 ± 0.05 ng/mL (scFv-AP), respectively. Assessment of Specificity. The cross-reactivity (CR) of the ELISA method based on scFv-AP was determined, and the results are summarized in Table 3, showing that the anti-CAP E

DOI: 10.1021/acs.jafc.6b00639 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

determinations of CAP measured using two different antibodies were similar, but the CVs in the ELISA based on the scFv-AP were slightly lower than those for the ELISA based on the mAb.

■

DISCUSSION Most current estimation tests rely on polyclonal or monoclonal hybridoma-derived antibody reagents. Polyclonal antibodies show high affinity and robustness. However, the disadvantages of the cross-reactivity and variability between different batches greatly inhibit the application of this type of antibody. Thus, monoclonal antibodies might offer substantial advantages in terms of potency, reproducibility, and freedom from contaminants, but these reagents are comparatively hard to produce as mAbs require eukaryotic expression or the maintenance of viable hybridoma cell line, which is difficult to prepare and needs to be maintained in a quality-assured manner. Furthermore, the antibody-secreting ability of hybridoma clones tends to diminish as time goes by. To overcome these problems, the generation of engineered antibodies based on recombinant DNA technology has been utilized.29,30 Reflecting the virtue of smaller size and construction method, scFv has attracted much attention among engineered antibodies. scFv offers several advantages over the intact immunoglobulin molecule. For instance, scFVs are expressed from a single recombinant expression plasmid and can be molecularly linked with other proteins to generate fusion proteins. The relatively small size of scFv is an advantage for easy penetrance into the tissue spaces, and the production of this antibody type is exceedingly rapid, suggesting that this form of antibody has many practical applications, including the immune detection of toxic and harmful substances in food samples.31,32 In the present study, we generated a CAP-specific scFv and evaluated the performance of this molecule in detection. It is generally accepted that only one type of messenger ribonucleic acid (mRNA) for an antibody gene is transcribed in a single clonal hybridoma cell. However, the existence of many aberrant mRNAs, transcribed from rearranged but nonfunctional antibody genes in the hybridoma, makes it much harder to obtain specific antibody sequence information, even if a single clonal hybridoma is obtained.33 Indeed, these aberrant nonfunctional chains are frequently preferentially amplified over the desired antibody sequences using primers specific for the variable regions of antibody genes. There have been many attempts to overcome this problem, such as the ribozyme cleavage of aberrant sequences,34 RNaseH digestion of aberrant mRNA−DNA hybrids,35 and the screening of functional scFv products in an in vitro transcription−translation system.36 Among these methods, the phage display system has been used to screen specific antibody sequences.33,37 However, this method is still time-consuming, with low efficiency in obtaining the specific sequence. In the present study, the large scale sequencing of variable regions of antibody genes was performed

Figure 4. Elimination of the matrix effect in ELISA analysis based on the scFv-AP fusion protein. (A) Assessment of the influence of different concentrations of shrimp extract on the ELISA analysis. (B) Assessment of the influence of different concentrations of codfish extract on the ELISA analysis.

scFv-AP had a CR of 100% to CAP, 42.34% to CAP succinate, and negligible (