Development of an Inducible Secretory Expression System in Bacillus

Aug 21, 2018 - Flow system does the dirty work. Organic chemists optimizing a reaction, like chefs perfecting a dish, execute a single transformation...
1 downloads 0 Views 1MB Size
Download PDF
Article Cite This: J. Agric. Food Chem. XXXX, XXX, XXX−XXX

pubs.acs.org/JAFC

Development of an Inducible Secretory Expression System in Bacillus licheniformis Based on an Engineered Xylose Operon Youran Li,†,‡ Ke Jin,†,‡ Liang Zhang,†,‡ Zhongyang Ding,†,‡ Zhenghua Gu,†,‡ and Guiyang Shi*,†,‡ †

Key Laboratory of Industrial Biotechnology, Ministry of Education, Jiangnan University, Wuxi 214122, P. R. China National Engineering Laboratory for Cereal Fermentation Technology, Jiangnan University, 1800 Lihu Avenue, Wuxi, Jiangsu Province 214122, P. R. China

‡

Downloaded via QUEEN MARY UNIV OF LONDON on August 28, 2018 at 07:43:42 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

S Supporting Information *

ABSTRACT: The xylose operon can be an efficient biological component for regulatory expression uses in Bacillus licheniformis. However, its characteristic susceptibility to carbon catabolite repression (CCR) makes its application inconvenient. In this study, plasmids harboring the wild-type operons from three Bacillus species were constructed and introduced into B. licheniformis. These plasmids ensured secretory expression of maltogenic α-amylase (BLMA) in B. licheniformis under strict regulation. The glucose-mediated CCR was then alleviated by engineering the xylose operon of the expression system. Evidence showed that mutations in the highly conserved nucleotides of the identified catabolite responsive element (cre) consensus sequence prevented association of the regulator CcpA with DNA, thus resulting in an increase in BLMA activity of up to 12fold. Furthermore, features of this engineered system for inducible expression were investigated. Induction in mid-log phase using 10 g/L xylose at 37 °C was found to be beneficial for promoting the accumulation of recombinant product, and the maximum yield of BlmMA reached 715.4 U/mL. This study contributes to the industrial application of the generally recognized as safe (GRAS) workhorse B. licheniformis. KEYWORDS: Bacillus licheniformis, inducible expression, catabolite repression, catabolite responsive element

■

affect the growth of the host strain itself.7 Inducible expression systems, which separate enzyme production from growth, would definitely help solve the above problems, and these systems are also the predominant approaches for enzyme production in E. coli or Saccharomyces cerevisiae. Among the few reported inducible promoters functioning in Bacillus species, the xylose promoter has interested researchers because of its high level of transcription initiation.8 Compared with the T7, spac, and grac systems transplanted from E. coli, this system also has greater strictness.9−11 In our previous study, xyloseinducible expression plasmids were constructed to express genes in B. licheniformis intracellularly. We have noted that the enzyme production was seriously inhibited when glucose was used as a fermentation substrate, which is very detrimental to the application of this system. Further study is required to gain full insight into this type of repression and to find a strategy to solve the problem. Carbon catabolite repression (CCR) is the major problem obstructing the practical use of the sugar-inducible expression system. For example, glucose has a significant influence on the function of the xylose operon. As a model system, the operon is used to study the mechanism of CCR in Bacillus species. The present study has revealed the components involved in this global regulatory cascade: a characteristic cis-active sequence (cre; catabolite responsive element) and a trans-acting protein (CcpA; catabolite control protein) that recognizes and

INTRODUCTION Food enzymes are increasingly important in many industrial applications, as they can provide more than just alternatives to traditional chemical processes. Although present in plants, animals, and microorganisms, more than half of all industrial food enzymes are produced by Bacillus bacteria.1 Bacillus licheniformis is one of the most important microorganisms in the industrial production of food enzymes, such as proteases, amylases, and lipases, mainly because of the advantages of its generally recognized as safe (GRAS) status and high secretory capacity. Most of the above-mentioned enzymes are products of wild-type strains; thus, current studies focus on either isolation of new subspecies of B. licheniformis to produce valuable enzymes or optimization of fermentation conditions to improve productivity.2,3 Research on genetic engineering, which mainly uses Bacillus subtilis-derived tools, is just beginning, and the efficiency advantage of this species is not fully realized. Unlike E. coli or Saccharomyces cerevisiae,4 this excellent industrial microorganism has hardly been used as an expression host to produce heterologous proteins. This deficiency is largely attributed to lack of suitable expression systems. The main secretory proteins of B. licheniformis, protease and amylase, are growth-associated enzymes,5 the behavior of which has evolved to adapt to different substrates in the environment. However, this native mechanism may not be suitable for industrial processes of enzyme production, in which the strains should maximize enzyme expression with minimum resource consumption in other ways, including biomass accumulation.6 Furthermore, this type of expression system is not available for those heterologous proteins that © XXXX American Chemical Society

Received: Revised: Accepted: Published: A

May 31, 2018 August 19, 2018 August 21, 2018 August 21, 2018 DOI: 10.1021/acs.jafc.8b02857 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 1. Bacterial Strains and Plasmids Used in This Study

strains Escherichia coli JM109 Bacillus subtilis 168 Bacillus megaterium CICIM B1514 Bacillus licheniformis DSM13 Bacillus licheniformis ADP1 BlsMA BllMA BlmMA plasmids pMD18-T-simple pHY300-PLK pBS pBL pBM pBSMAST pBLMAST pBMMAST

source/ referenceb

descriptiona

strain or plasmid

F′, traD36, proAB + lacIq, △(lacZ), M15/△ (lac-proAB), gln V44, e14−, gyrA96, recA1, relA1, endA1, thi, hsdR17 wild-type wild-type wild-type B. licheniformis DSM13, △amyL, △aprE B. licheniformis ADP1 harboring pBSMAST B. licheniformis ADP1 harboring pBLMAST B. licheniformis ADP1 harboring pBMMAST E. coli cloning vector, ApR E. coli/Bacillus shuttle vector, ApR/TetR pHY-derivate with xylose regulon from B. subtilis pHY-derivate with xylose regulon from B. licheniformis pHY-derivate with xylose regulon from B. megaterium pHY-derivate with xylose regulon from B. subtilis, signal peptide encoding sequence from B. subtilis levansucrase (SacBss), BLMA encoding gene (yvdF) and terminator sequence from B. licheniformis xylose isomerase (TerBlx) pHY-derivate with xylose regulon from B. licheniformis, signal peptide encoding sequence from B. subtilis levansucrase (SacBss), BLMA encoding gene (yvdF) and terminator sequence from B. licheniformis xylose isomerase (TerBlx) pHY-derivate with xylose regulon from B. megaterium, signal peptide encoding sequence from B. subtilis levansucrase (SacBss), BLMA encoding gene (yvdF) and terminator sequence from B. licheniformis xylose isomerase (TerBlx)

CICIMCU CICIMCU CICIMCU CICIMCU CICIMCU this work this work this work TaKaRa this this this this

work work work work

this work this work

a ApR, ampicillin resistance; TetR, tetracycline resistance. bCICIM-CU, Culture and Information Center of Industrial Microorganisms of China Universities.

sequences of the regulon. This repression could be modulated by mutation of endogenous cre sequences, a strategy that should be applicable to other microorganisms with similar regulatory elements.

interacts with cre elements to negatively regulate the transcription of the corresponding gene.12 A typical sequence of cre in Bacillus species has been determined to be TGWAANCGNTNWCA, where N represents any base and W represents either A or T.13 These binding motifs are typically present in the N terminal sequences of a number of carbon metabolism-relevant genes. The most affected cre site in the Bacillus subtilis xylose operon was identified as cre+130, which is located 130 bp downstream from the ATG start codon of the gene encoding xylose isomerase (xylA).12 The deletion of that cre site reduced glucose repression from 13fold to 2.5-fold.14 Intriguingly, it was recently reported that CcpA also employs a binding motif in promoter regions to regulate carbon metabolism.15 These results provided new insight into the molecular basis of regulation mediated by CcpA and revealed different mechanisms of CcpA-mediated regulation of the xylose operon. There is no consensus regarding whether cre sites actually do exist or not in the noncoding sequences of xylose operons. The effect of sequences in the initial transcription regions of this operon on the CCR effect also has fascinated researchers. Maltogenic α-amylase (MA) acts on α-1,4-glucosidic linkages in starch to remove successive maltose residues from the nonreducing ends of starch chains. The special characteristics of this enzyme have caused it to be widely used in food industries, such as in baking and starch processing. In B. licheniformis, the activity of this enzyme was not detectable in culture broth but was detected at an extremely low level in cell lysate.16,17 In this study, a series of inducible expression plasmids based on wild-type and engineered bacilli xylose regulons were constructed for secretory gene expression in food-safe B. licheniformis. The results revealed the presence of a cre site subject to repression by glucose within the noncoding

■

MATERIALS AND METHODS

Bacterial Strains, Plasmids, and Culture Conditions. Table 1 lists the bacterial strains and plasmids that were used or generated during this study. Bacillus licheniformis ADP1 is a gene knockout expression host that was constructed during our previous study, and it lacks two secretory enzymes, amylase (encoded by amyL) and protease (encoded by aprE). This strain is designed to improve both the purity and the stability of the protein products from this species. The osmotic media and agents for protoplast transformation were prepared according to Waschkau et al.,18 including no. 416 medium, SMMP medium, SMM buffer, and DM3 agar. E. coli and Bacillus were grown at 37 °C in terrific broth (TB) based on Li’s methods.19 Fermentation medium (20 g/L tryptone, 5 g/L yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, and 10 mM MgSO4) was prepared for the production of recombinant enzymes, and 100 μg/mL ampicillin, 30 μg/mL kanamycin, or 20 μg/mL tetracycline was added when necessary. Flask cultures were produced using 250 mL Erlenmeyer flasks containing 30 mL of medium and shaken at 37 °C in a rotary shaker at 250 rpm. The 3% seed cultures were inoculated into the fermentation medium for batch fermentation. Plasmid Construction. The shuttle expression plasmids were constructed based on pHY300-PLK using the primers listed in Table 2. First, three promoter regions, PxylBs, PxylBl, and PxylBm, were cloned using a template from the genomic DNA of B. subtilis 168, B. licheniformis DSM13, or B. megaterium CICIM B1514, respectively. PCR was performed with Prime Star DNA polymerase (Takara, Osaka, Japan) and the primer pairs PbsxF/R, PblxF/R, or PbmxF/R. All the amplified fragments consisted of a promoter and a corresponding repressor. The fragments were then purified and digested with BglII and BamHI, followed by incorporation into B

DOI: 10.1021/acs.jafc.8b02857 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 2. Primers Used to Construct Recombinant Plasmids primers

sequences (5′-3′)a

PbsxF PbsxR PblxF PblxR PbmxF PbmxR BLMAF BLMAR PsacsF PsacsR PterF PterR M1F M1R M2F M2R M3F M3R M4F M4R M5F M5R M6F M6R ProbeF ProbeR xylAF xylAR rpSEF rpSER

Gccagatctttacattgtaatcatgt Gccggatccgtgatttcccccttaaaa Gccagatctttaaaatctctcgttcat Aatggatcctccgatctcccccttcac Gccagatcttaactaacttataggggt Cgcggatccttgtcatttcccccttt Cggggtaccatggaatatgcagcgataca Aggatctggagcttatcctgttagaccgcccccaaaatga Gccggatccatgaacatcaaaaagtttgc tcccccgggcggggtaccatgatgatgatgatgatgcgca aacgcttgagttg Tcattttgggggcggtctaacaggataagctccagatcct Tcccccgggtaaaaaaccattcactctaa gtatgtattttacaggatcaattaatcgctttagatggaaatagaggaaaaaataagttttcaaaa ttttgaaaacttattttttcctctatttccatctaaagcgattaattgatcctgtaaaatacatac tccttgtatgtattttacaggatcaattaatatctttcaatggaaatagaggaaaaaataagtt aacttattttttcctctatttccattgaaagatattaattgatcctgtaaaatacatacaagga Tagtataacaaattttgaaaacttattttttcctctatttccatctaaagatattaattgatcctgtaaaatacatacaaggaagttagtttaatg Cattaaactaacttccttgtatgtattttacaggatcaattaatatctttagatggaaatagaggaaaaaataagttttcaaaatttgttatacta gtatgtattttacaggatcaattaatcgattgcaatggaaatagaggaaaaaataagttttcaa ttgaaaacttattttttcctctatttccattgcaatcgattaattgatcctgtaaaatacatac ccttgtatgtattttacaggatcaattacgcgctttcaatggaaatagaggaaaaaat attttttcctctatttccattgaaagcgcgtaattgatcctgtaaaatacatacaagg ccttgtatgtattttacaggatcaatagatcgctttcaatggaaatagaggaaa tttcctctatttccattgaaagcgatctattgatcctgtaaaatacatacaagg Gaaaacttattttttcct Acttccttgtatgtattt Gggcggaagagaaggttatg Cgcatactcaactgccattcta Tggtcgtcgtttccgcttcg Tcgcttctggtacttcttgtgctt

restriction sites BglII BamHI BglII BamHI BglII BamHI KpnI BamHI SmaI, KpnI SmaI

a

Restriction sites are underlined. Transformation of B. licheniformis. The constructed expression plasmids were introduced into B. licheniformis ADP1 by protoplast transformation according to Li’s method.20 Positive transformants were screened on a DM3 agar plate with 20 μg/mL tetracycline. Enzyme Assay and Fermentation. The constructed recombinant B. licheniformis strains were cultured overnight, and then the fermentation flasks were inoculated with 1% of the culture and incubated at 37 °C with shaking at 250 rpm. Cultures were added with 10 g/L xylose after 6 h to initiate expression. Samples were taken for OD600 measurements as well as for enzyme assays after fermentation. The BLMA activity in the culture broth was assayed based on Shim’s method21 using 0.5% soluble starch as the substrate, except for the pH, which was 5.0. One unit of BLMA activity was defined as the amount of enzyme required to generate 1 μmol of maltose per minute. Enzyme samples from the cre*M2 version construct were then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10% gel). Real-Time Quantitative PCR. Glucose, fructose, sucrose, maltose, maltodextrin, and soluble starch were used as sole carbon sources under standard fermentation conditions (30 g/L) to investigate their CCR effect on inducible expression. The influence of different concentrations of glucose on the strength of CCR during fermentation was further studied in detail by real-time quantitative PCR (RT-qPCR). First, overnight-cultured strains were used to inoculate 35 mL of fermentation medium at a ratio of 1% with shaking at 250 rpm at 37 °C. Samples were taken for glucose and biomass detection at 2, 6, 12, 24, and 48 h, and cells were harvested for mRNA isolation at the same times. The total RNA was extracted with a QIAGEN RNeasy RNAprotect Mini kit (Qiagen, Inc., Mississauga, ON, Canada) according to the manufacturer’s instructions and

pHY300-PLK, yielding pPxBs, pPxBl, and pPxBm. The signal peptide sequence of B. subtilis levansucrase (SacBss fragment) and the terminator sequence of B. licheniformis xylose isomerase (TerBlx fragment) were amplified from the B. subtilis 168 genome and the B. licheniformis DSM13 genome using the primers PsacsF/PsacsR and PterF/PterR, respectively. In addition, the BLMA gene (MA fragment) was amplified by polymerase chain reaction (PCR) using genomic DNA from B. licheniformis DSM13 as a template and the primers BLMAF and BLMAR. An expression cassette was first generated by combining the MA and TerBlx fragments via overlap PCR using the primers BLMAF and PterR. Afterward, the SacBss and MA-TerBlx fragments were inserted into the plasmids pPxBs, pPxBl, and pPxBm downstream of different promoters at the BamHI/SmaI and KpnI/SmaI sites to yield pBSMAST, pBLMAST, and pBMMAST, respectively. Engineering of the Xylose Operon. A series of putative cre sites were predicted within the promoter regions of the xylose operon according to a comparative genome analysis. To determine whether these sites modulated CcpA-mediated CCR, site-specific mutagenesis was used to introduce both base substitutions and deletions. To do so, the PxylBl fragment was first subcloned into pMD18-T-simple to avoid introducing unwanted mutations outside the target sequences. Then, the mutagenesis was performed according to the instructions in the PrimeSTAR mutagenesis basal kit (Takara Bio, Shiga, Japan) using primers listed in Table 2 and the above vector as the template. The nucleotide sequences of the resulting products were analyzed using an ABI PRISM 310 genetic analyzer (Thermo-Applied Biosystems, Carlsbad, CA, U.S.A.). Finally, the verified mutation constructs were reinserted into pBLMAST to replace the wild-type ones, yielding several versions of engineered expression plasmids. C

DOI: 10.1021/acs.jafc.8b02857 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 1. Effects of different carbon sources on the enzyme production (A) and transcription analysis of the glucose-mediated repression effect over the course of fermentation (B). BllMA was cultured in fermentation medium containing 30 g/L different carbon sources. BllMA was cultured in this medium without glucose as a control. A transcriptional analysis of blmA was performed via RT-PCR using a dual-labeled probe after the parallel extraction of RNA and DNA followed by cDNA synthesis. Ratios of the amounts of mRNA (cDNA) per gene dose are given in a decade logarithmic scale (lg). The values are the means of results from five independent biological replicates. Error bars indicate standard deviations. The results of the transcription analyses are given in relative amounts of mRNA (cDNA) per gene dose. These amounts were determined in relation to one reference sample within a given experiment. Consequently, the comparison of ratios is valid only within one experimental setup. Induction Temperature. Different induction temperatures were chosen for optimization, including 30, 35, 37, 40, and 45 °C. BlmMA was cultured under the standard conditions described earlier, and 1% xylose was added after 10 h for induction. The fermentation was then allowed to proceed at each induction temperature. Finally, supernatants of culture broth were sampled for the enzyme activity assay. Statistical Analysis. All the experiments were performed at least three times. The results were shown in terms of means ± standard deviations (SDs). A Student’s t test was performed for statistical analyses, and a threshold P-value of 0.05 was used to indicate significant results.

quantified by a Quawell Q5000 ultraviolet−visible spectrophotometer (Quawell Technology, San Jose, CA, U.S.A.). cDNA was amplified using the prepared mRNA as template with a PrimeScript RT reagent kit (TaKaRa) and was then used as template for RT-qPCR using a Bio-Rad CFX Manager Real-Time PCR system (Bio-Rad, Hercules, CA, U.S.A.) with SYBR Premix Ex TaqII kit (TaKaRa, China) and the prime pairs xylAF/R. The reaction conditions were as follows: 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 15 s, and annealing/ elongation at 60 °C for 1 min. The rpsE gene was used as an internal standard and was amplified by the primers rpSEF and rpSER. The relative transcript strength was calculated using the 2−ΔΔCt method. Electrophoretic Mobility Shift Assays. B. licheniformis CcpA protein was expressed and purified in our previous studies. The DNA probes for electrophoretic mobility shift assays (EMSAs) were generated by PCR using the plasmid pBLMAST as a template, which encompasses the noncoding regions (−50 to + 20 bp) of Pxyl, and primer pair ProbeF/ProbR is listed in Table 2. The Biotin 3′ End Labeling kit (GS008, Beyotime, China) was used to biotinylate the probes. Before electrophoresis, 10 nM biotinylated probes were incubated with 10 μg of CcpA protein in the binding buffer (Chemiluminescent EMSA kit GS009, Beyotime) at room temperature for 20 min. The subsequent procedures were carried out according to the manufacturer’s instructions. Investigation of Inducible Expression Conditions. A set of fermentation experiments was performed by using the strain harboring a cre*M2 version of the expression system to ascertain favorable conditions for the induction of recombinant protein (BLMA) by xylose. Fermentation medium containing 30 g/L glucose was used as basal medium, and the other conditions are described below. Timing of Inducer Addition. Different growth stages at 37 °C were chosen for optimization, including the early, mid, and late logarithmic phases (0, 2, 4, 6, 8, 10, and 12 h). BlmMA was cultured under the standard conditions described earlier, and 1% xylose was added to initiate the transcription of the BLMA gene at each time point. The fermentation was then allowed to proceed at 37 °C. Finally, supernatants of culture broth were sampled for the enzyme activity assay. Inducer Addition. Different xylose concentrations were chosen for optimization, including 0%, 0.2%, 0.5%, 0.8%, 1%, 1.5%, and 2%. BlmMA was cultured under the standard conditions described earlier, and xylose was added after 10 h for induction. The fermentation was then allowed to proceed at 37 °C. Finally, supernatants of culture broth were sampled for the enzyme activity assay.

■

RESULTS All Three Bacillus-Original Xylose Regulons in the B. licheniformis Expression Systems. The promoters PxylBs, PxylBl, and PxylBm were successfully amplified to sizes of 1.5, 1.3, and 1.4 kb, respectively, which were consistent with the corresponding records in the NCBI database. SacBss, TerBlx, and MA were also successfully amplified, yielding fragments of 132, 139, and 1761 bp, respectively. The fusion cassette of the above three fragments, SB-MA-TerBlx (1900 bp), was inserted downstream of PxylBs, PxylBl, and PxylBm into pHY300-PLK, yielding pBSMAST, pBLMAST, and pBMMAST, respectively. When these plasmids were ready, cell digestion using lysozyme was pivotal to a successful protoplast transformation. Protoplasts were identified by their round forms under a microscope, which are unlike that of the normal Bacillus cells, and a formation rate of protoplast can be thereby calculated. The best transformation efficiency (3 cfu/μg of DNA) of protoplasts was recorded when protoplast formation rate was 85%. The host strain ADP1 and the verified transformants BlsMA, BllMA, and BlmMA were subjected to fermentation. After a 24-h induction, the results of the enzyme activity assay showed that BLMA was functionally expressed and secreted in all three constructs, with extracellular activities of 71.3, 114.5, and 89.2 U/mL, respectively, while no activity was detected in ADP1. Mono- and Oligosaccharides Trigger the CCR of Vector-Harbored WT Xylose-Inducible Promoters. Most researches study CCR effect in microorganism using glucose as a repressing carbon source. To explore whether and to what D

DOI: 10.1021/acs.jafc.8b02857 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry extent other carbon sources also exert CCR in B. licheniformis, two monosaccharides, two oligosaccharides, and three highmolecular-weight polymer carbohydrates were added to the fermentation media and used as a model for investigating the possible repression. After 72 h, all the carbon sources were close to depletion, and the enzyme activity was no longer accumulated. Glucose, fructose, or sucrose obviously impair expression because the resulting BLMA activity was extremely poor (Figure 1A). The very hallmark of repression mediated by glucose is that only