ARTICLE pubs.acs.org/ac
Distance-Dependent Metal-Enhanced Quantum Dots Fluorescence Analysis in Solution by Capillary Electrophoresis and Its Application to DNA Detection Yong-Qiang Li,†,‡ Li-Yun Guan,†,‡ Hai-Li Zhang,† Jun Chen,†,‡ Song Lin,†,‡ Zhi-Ya Ma,†,‡ and Yuan-Di Zhao*,†,‡ Britton Chance Center for Biomedical Photonics, †Wuhan National Laboratory for Optoelectronics, and ‡Key Laboratory of Biomedical Photonics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, People’s Republic of China
bS Supporting Information ABSTRACT: Here the distance dependence of metal-enhanced quantum dots (QDs) fluorescence in solution is studied systematically by capillary electrophoresis (CE). Complementary DNA oligonucleotides-modified CdSe/ZnS QDs and gold nanoparticles (Au NPs) were connected together in solution by the hybridization of complementary oligonucleotides, and a model system (QDAu) for the study of metal-enhanced QDs fluorescence was constructed, in which the distance between the QDs and Au NPs was controlled by adjusting the base number of the oligonucleotide. In our CE experiments, the metalenhanced fluorescence of the QDs solution was only observed when the distance between the QDs and Au NPs ranged from 6.8 to 18.7 nm, and the maximum enhancement by a factor of 2.3 was achieved at 11.9 nm. Furthermore, a minimum of 19.6 pg of target DNA was identified in CE based on its specific competition with the QDDNA in the QDAu system. This work provides an important reference for future study of metal-enhanced QDs fluorescence in solution and exhibits potential capability in nucleic acid hybridization analysis and high-sensitivity DNA detection.
s a new type of fluorescent probe, quantum dots (QDs) have attracted more and more attention in the biosensing field due to their unique optical characteristics, including high photobleaching threshold, good chemical stability, size-tunable photoluminescence spectra, broad absorption, and narrow emission wavelengths.1,2 Recently QD-based biosensors have been developed for fluorescence immunoassay,3,4 biomolecule detection,5,6 and DNA mutation study.7,8 The detection sensitivity of the QD-based biosensor is closely related with the intensity of QDs fluorescence. Although QDs have high quantum yield, further enhancement of their luminescence is still required in some stringent experiments (e.g., microarrays, single-molecule detection).9,10 In this respect, the metal-enhanced fluorescence (MEF) effect, based on the surface plasmon resonance (SPR) of metallic nanostructures, seems to be very promising.11,12 The SPR of metallic nanostructures, especially the Ag and Au nanoparticles (NPs), can enhance the local electromagnetic field surrounding it and finally lead to the fluorescence increase of nearby fluorophores.13,14 The MEF of QDs had been confirmed by previous literatures, and the magnitude of QDs fluorescence enhancement was found to strongly depend on the distance between QDs and metal nanostructures.1518 Up to now, a number of experimental methods have been developed to adjust the distance between
A
r 2011 American Chemical Society
QDs and metal NPs in metal-enhanced QDs fluorescence study. All these methods are mainly involving the design of metal/ spacer/QDs hybrid structures, in which the distance between the QDs and metal NPs is adjusted by controlling the thickness of the spacer. For instance, Liu et al. used silica as the spacer to control the distance between CdSe QDs and Au NPs and explored the effect of Au NPs on QDs fluorescence.19 Kulakovich et al. utilized the layer-by-layer technique to deposit polyelectrolyte between CdSe/ZnS QDs and Au NPs and investigated systematically the variance of QDs fluorescence with the distance between QDs and Au NPs controlled by adjusting the welldefined layer of the polyelectrolyte.20 In most of the previous research of metal-enhanced QDs fluorescence, the control of interparticle distance is achieved by a solid medium (polyelectrolyte, silica), and less attention has been paid to the MEF of QDs in a liquid medium. In fact, a large number of QD-based biosensors are developed for the detection of targets in liquid medium, especially in aqueous solutions. Therefore, the study of metalenhanced QDs fluorescence in solution, especially the investigation for its distance dependence, has an important significance Received: January 26, 2011 Accepted: March 31, 2011 Published: May 09, 2011 4103
dx.doi.org/10.1021/ac200224y | Anal. Chem. 2011, 83, 4103–4109
Analytical Chemistry
ARTICLE
Table 1. Alignment of DNA Oligonucleotide Sequences Used in Experiments sequence (50 30 )
sequence name
base no.
ED (nm)a
A3.4
NH2—GCCATTGCCA
10
3.4
B3.4
SH—TGGCAATGGC
10
3.4
A6.8
NH2—GCCATTGCCATTGCCATTGC
20
6.8
B6.8
SH—GCAATGGCAATGGCAATGGC
20
6.8
A10.2
NH2—GCCATTGCCATTGCCATTGCCATTGCCATT
30
10.2
B10.2
SH—AATGGCAATGGCAATGGCAATGGCAATGGC
30
10.2
A11.2
NH2—GCCATTGCCATTGCCATTGCCATTGCCATTGCC
33
11.2
B11.2 A11.9
SH—GGCAATGGCAATGGCAATGGCAATGGCAATGGC NH2—GCCATTGCCATTGCCATTGCCATTGCCATTGCCAT
33 35
11.2 11.9
B11.9
SH—ATGGCAATGGCAATGGCAATGGCAATGGCAATGGC
35
11.9
A12.6
NH2—GCCATTGCCATTGCCATTGCCATTGCCATTGCCATTG
37
12.6
B12.6
SHCAATGGCAATGGCAATGGCAATGGCAATGGCAATGGC
37
12.6
A13.6
NH2—GCCATTGCCATTGCCATTGCCATTGCCATTGCCATTGCCA
40
13.6
B13.6
SH—TGGCAATGGCAATGGCAATGGCAATGGCAATGGCAATGGC
40
13.6
A18.7
NH2—GCCATTGCCATTGCCATTGCCATTGCCATTGCCATTGCCATTGCCATTGCCATTG
55
18.7
B18.7 target DNA
SHCAATGGCAATGGCAATGGCAATGGCAATGGCAATGGCAATGGCAATGGCAATGGC GCCATTGCCATTGCCATTGCCATTGCCATTGCCAT
55 35
18.7
nontarget DNA
CCCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAAA
36
a
ED: estimated distances between QDs and Au NPs in QDAu conjugates formed by the hybridization of DNA oligonucleotides used for QDs and Au NPs modification with its complementary ones. for the construction of high-sensitivity QD-based biosensors. However, as far as we know, the systematic investigation of the distance dependence of metal-enhanced QDs fluorescence in solution has never been reported. In this work, the distance dependence of metal-enhanced QDs fluorescence in solution was studied systematically by capillary electrophoresis (CE). As a high-efficiency separation technique, CE is proved to be very suitable for high-sensitivity QD-based bioanalysis by our previous work,21,22 in which QD-labeled targets can be separated from the mixed composition, making the results more directly and improving the detection sensitivity. In addition, only a trace amount of sample is consumed in CE, which is important for bioanalysis as it can greatly reduce the cost of detection. In our experiments, CdSe/ZnS QDs and Au NPs were first modified by two complementary DNA oligonucleotides, respectively, and then they were connected together in solution by the hybridization of complementary oligonucleotides. The distance between the QDs and Au NPs was controlled by adjusting the base numbers of oligonucleotides. Subsequently, the effect of distance between the QDs and Au NPs on QDs fluorescence was explored systematically by CE, and results showed that the Au NP-enhanced QDs fluorescence in solution had strong distance dependence. Furthermore, a highsensitivity method for the detection of target DNA in solution was established by CE, based on its specific competition with the QDDNA in the QDAu system.
’ EXPERIMENTAL SECTION Materials and Reagents. Trisodium citrate (99%) and chloroauric acid (98%) were supplied by Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Cadmium acetate, zinc acetate, and selenium powder were obtained from Acros Organics (Geel, Belgium). Tri-n-octylphosphine (TOP), tri-n-octylphosphine oxide (TOPO), bis(trimethylsilyl) sulfide ((TMS)2S),
hexadecylamine (HDA), sodium thioglycolate, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), N,N, N0 ,N0 -tetramethylethylenediamine (TEMED), ammonium peroxydisulfate (APS), polyacrylamide (PAA), and 2-hydroxyethyl cellulose (HEC, MWav = 90 000) were purchased from SigmaAldrich Fine Chemicals (St. Louis, MO, U.S.A.). RQ1 RNasefree DNase was a product of Promega (Madison, U.S.A.). All the DNA oligonucleotides used in experiments were obtained from Shanghai Sangon Biological Engineering Technology and Services Co., Ltd. (Shanghai, China), and their sequences are shown in Table 1. Uncoated fused-silica square capillary (50 μm square i.d., 365 μm o.d.) was purchased from Yongnian Optical Fiber Factory (Hebei, China). All other materials and reagents were of analytical grade. Ultrapure water (g18.2 MΩ) from a MilliQ system (Millipore, Bedford, MA, U.S.A.) was used for all solutions. The electrophoresis buffers were filtered through a 0.22 μm filter before use. Instrumentation. CE analyses with fluorescence detection were carried out on a home-built system, consisting of a highvoltage supply (030 kV) (Shanghai Nuclear Research Institute, China) and a IX71 inverted fluorescence microscope (Olympus, Japan) equipped with a 100 W mercury lamp, an excitation filter (BP 420 ( 20 nm), a dichromatic mirror (DM 455), an emission filter (BA 474 nm), and a QE65000 fiber-optic spectrometer (Ocean Optics, U.S.A.). The UVvis absorption spectra of Au NPs, AuDNA conjugates, QDs, and QDDNA conjugates were measured on a UV-2550 UVvis spectrophotometer (Shimadzu, Japan). The fluorescence spectra of QDs and QD DNA conjugates were measured on an LS-55 spectrophotometer (Perkin-Elmer, U.S.A.). The size and ζ-potential of QDs and Au NPs were measured on a ZS90 Nanosizer (Malvern, U.K.) at 25 °C by the dynamic light scattering (DLS) and laser doppler electrophoresis methods, respectively. Preparation of Au NPs and AuDNA Conjugates. The Au NPs were synthesized by the citrate reduction of HAuCl4.23,24 4104
dx.doi.org/10.1021/ac200224y |Anal. Chem. 2011, 83, 4103–4109
Analytical Chemistry Briefly, 10 mL of 1% (w/v) HAuCl4 3 4H2O solution was added to 250 mL of ultrapure water and heated to a boil while stirring; then 2.5 mL of 10% (w/v) trisodium citrate solution was added quickly, which resulted in a change in solution color from pale yellow to deep red. After the color change, the solution was boiled for an additional 15 min and allowed to cool to room temperature. The concentration of Au NPs solution was determined by a method previously reported.25 All glassware was cleaned in aqua regia (3 parts HCl, 1 part HNO3), rinsed with ultrapure water, and then oven-dried prior to use. DNA-modified Au NPs were prepared by deriving 5 mL of Au NPs aqueous solution (about 8.1 nM) with 3 OD of 50 -(thiol)oligonucleotides. After standing for 16 h at room temperature, 5 mL of 0.1 M NaCl10 mM phosphate buffer (PBS, pH 7) was added, and the mixture was allowed to stand for 40 h, followed by centrifugation for 40 min at 14 000 rpm to remove excess DNA oligonucleotides. Following removal of the supernatant, the red oily precipitate (AuDNA conjugate) was washed with 2 mL of 0.1 M NaCl10 mM PBS (pH 7), recentrifuged, and redispersed in 1 mL of 0.3 M NaCl10 mM PBS (pH 7) buffer. Preparation of CdSe/ZnS QDs. Oil-soluble CdSe/ZnS core shell QDs were synthesized using a two-step method according to previous reports.2628 Different-sized oil-soluble QDs with different emission wavelengths were obtained by controlling the temperature and initial molar ratio of reactants. Water-soluble CdSe/ZnS QDs were prepared by a surface ligand exchange reaction between TOPO and the hydrophilic substance. In brief, 150 mg of sodium thioglycolate powder was added to 500 μL of CdSe/ZnS chloroform solution in a centrifuge tube under vigorous stirring. After incubating for 12 h, 40 μL of distilled water was added to the mixture, and it was precipitated by acetone. After centrifugation the precipitate was washed by acetone and redispersed in PBS (0.01 M, pH 7.4) solution. Excess sodium thioglycolate was removed through three rounds of centrifugation. Finally, the precipitate was dissolved in PBS homogeneously. The concentrations of QDs solutions were calculated by an equation proposed by Peng’s group,29 and the quantum yields (QY) of QDs were measured by an optically dilute method using rhodamine 6G as a criterion.30 Preparation of CdSe/ZnS QDDNA Conjugates. QDDNA conjugates were prepared by mixing CdSe/ZnS QDs with 0.5 OD of 50 -(amine)oligonucleotides and EDC in PBS (10 mM, pH 7.4) buffer. The resulting mixture with a molar ratio of 2:1:50 (QDs/ oligonucleotides/EDC) was allowed to stand 810 h at room temperature. Following the reaction, a certain volume of anhydrous ethanol was added (vPBS/vethanol = 1:4), followed by centrifugation at 14 000 rpm for 20 min to remove excess EDC and QDs. Following removal of the supernatant, the precipitate (QD DNA conjugate) was then dissolved in PBS buffer, precipitated with anhydrous ethanol twice, and finally was redissolved in 500 μL of PBS buffer. Construction of the Metal-Enhanced QDs Fluorescence System. Complementary DNA oligonucleotides-modified Au NPs and CdSe/ZnS QDs were connected together by the hybridization of complementary oligonucleotides. The reactions were performed by mixing QDDNA and corresponding Au DNA conjugates in a hybridization buffer containing 20 mM TrisHCl, 50 mM KCl, and 5 mM MgCl2 at pH 8.0 and incubating 1.5 h at 35 °C. CE Procedure. CE analyses were carried out on a home-built system. A capillary was fixed on the detecting platform of an inverted fluorescence microscope, and a detection window was
ARTICLE
Figure 1. UVvis absorption spectra of Au NPs (a) and AuB3.4 conjugate (b).
simply made by burning a specific length of polyimide coating of capillary above the objective lens of the microscope. A 100 W mercury lamp was used as the excitation light source. After passing through the excitation filter (BP 420 ( 20 nm) and being reflected by a dichromatic mirror (DM 455), the excitation light (420 ( 20 nm) was focused on the detecting window by an objective lens to excite the samples moving through it. The fluorescence emitted from the samples was collected by the same objective, passed through the dichromatic mirror and an emission filter (BA 474 nm), and finally recorded by a fiber-optic spectrometer. For the suppression of electroosmotic flow (EOF) and absorption of samples on the capillary inner surface, the inside wall of the capillary was coated with PAA according to the previously reported procedure.31 The capillary was 60 cm long with an effective length of 40 cm from the inlet to the detection window. Reversed polarity conditions, i.e., the anode at the capillary outlet end, were used for all separations. The samples were hydrodynamically introduced to the capillary. CE analysis was carried out at room temperature. Before analysis, the capillary was rinsed and equilibrated with electrophoresis buffer (25 mM Na2B4O7, pH 9.0) for 15 min. Between each run, the capillary was washed by pure water and electrophoresis buffer for 10 min in sequence to ensure the reproducibility.
’ RESULTS AND DISCUSSION Characterization of Au NPs and AuDNA Conjugates. The UVvis absorption spectra changes of Au NPs after modification by (thiol)oligonucleotides B3.4 (Table 1) were first investigated. As shown in Figure 1, the plasma absorption band of as-prepared Au NPs had a slight red shift from 520 (Figure 1a) to 522 nm (Figure 1b) after modification, while its absorbance was reduced slightly due to the possible loss of a small amount of Au NPs during the modification procedure. The red shift of the Au NPs’ plasma absorption band was probably related to the change of its size (hydrodynamic diameter determined by the DLS technique), which was found to increase from 15.7 (Supporting Information, Figure S1a) to 18.2 nm (Supporting Information, Figure S1b) after B3.4 modification. In addition, the change of environment surrounding the surface of Au NPs after conjugation may be another reason for the red shift of the plasma absorption band. Furthermore, the ζ-potential of Au NPs was 4105
dx.doi.org/10.1021/ac200224y |Anal. Chem. 2011, 83, 4103–4109
Analytical Chemistry
Figure 2. UVvis absorption spectra (A) and fluorescence emission spectra (B, λex = 420 nm) of CdSe/ZnS QDs (a) and CdSe/ZnS QDA3.4 conjugate (b).
found to change from 35 (Supporting Information, Figure S2a) to 41.1 mV (Supporting Information, Figure S2b) after B3.4 modification, which to some extent indicated that the quantity of negative charge on the Au NPs surface was increased after modification. Similarly, the properties of Au NPs (plasma absorption band, size, and ζ-potential) possessed a consistent trend after modification by other (thiol)oligonucleotides shown in Table 1. Moreover, the UVvis absorption spectrum of filtrate collected during the preparation of AuB3.4 conjugate (Supporting Information, Figure S3a) was studied in order to estimate the saturation of (thiol)oligonucleotides coupling to Au NPs. By comparing this spectrum with that of 3 OD of B3.4 treated by the same dilution procedure in a control experiment (Supporting Information, Figure S3b), it was estimated that about 0.45 OD (2.7 nmol) of B3.4 was coupled to Au NPs, and then based on the concentration of Au NPs used for AuB3.4 conjugate preparation, it was further estimated that about 66.7 B3.4 oligonucleotides were conjugated on a single Au NP. Characterization of QDs and QDDNA Conjugates. The UVvis absorption spectra and fluorescence emission spectra of QDs after conjugation with (amine)oligonucleotide A3.4 (Table 1) were measured, and the results are shown in Figure 2. It showed that the first excitonic absorption peak and fluorescent emission wavelength of QDs were 518 and 531 nm, respectively, and remained unchanged after conjugation with A3.4, indicating that the A3.4 conjugation had no effect on the QDs’ absorption peak and emission wavelength. However, the absorbance and fluorescent intensity of the QDs were reduced after conjugation, which might result from the removal of excess QDs during the conjugation procedures. According to the change of the QDs’ absorbance at the first excitonic absorption peak after conjugation (Figure 2A), it was estimated that approximately 30% of the QDs were lost during the conjugation process. In addition, the size (hydrodynamic diameter determined by the DLS technique) and ζ-potential of the QDs were all found to increase after conjugation with A3.4 (Supporting Information, Figures S4 and S5), which was similar to the results of Au NPs (Supporting Information, Figures S1 and S2). CE Analyses of the Au-Enhanced QDs Fluorescence System. The CE characterization of the QDs and QDA3.4 conjugate was first explored. From Figure 3, it was found that the QDA3.4 conjugate (Figure 3b) had a smaller peak width than
ARTICLE
Figure 3. Electropherograms for QDs (a), QDA3.4 (b), and a hybridization mixture containing 50 μL of QDA3.4 and different amounts of AuB3.4: (c) 200 and (d) 250 μL. The intensities of electrophoresis peaks shown in curves a and b were normalized. A coated capillary with 40 cm effective (60 cm total) length and 50 μm i.d. was used. A solution of 25 mM Na2B4O7 (pH 9.0) was used as running buffer. Applied voltage was 20 kV, and hydrodynamic injection was carried out by siphoning at 15 cm height differences for 20 s. The relative standard deviations (%RSD) for the migration times of peaks in curves a, b, and d (three repeat experiments) were 0.51%, 0.48%, and 0.52%, respectively, while the %RSD for their peak areas were 1.74%, 1.62%, and 1.81%, respectively. The %RSD for the migration times of peaks 1 and 2 in curve c (three repeat experiments) were 0.54% and 0.55%, respectively, while the %RSD for their peak areas were 1.89% and 1.98%, respectively.
the QDs (Figure 3a), which to some extent indicated that the uniformity of charge distribution on the QDs surface was optimized during the process of conjugation. The electrophoresis mobilities of the QDs and QDA3.4 conjugate were also observed to be different from their electropherograms, which was directly related to the difference of their charge-to-size ratio. In the electropherogram for the hybridization mixture of QD A3.4 and AuB3.4 conjugates (Figure 3c), two electrophoresis peaks were observed, and peak 1 had approximately the same migration time as the QDA3.4 conjugate. In addition, peak 1 disappeared with the increasing AuB3.4 amount in the hybridization mixture (Figure 3d), while peak 2 was found to increase. On the basis of the above results, peaks 1 and 2 could be easily identified to correspond to the QDA3.4 conjugate and hybridization product of QDA3.4∼B3.4Au, respectively. As shown in Figure 3c, the separation of QDA3.4 and QDA3.4∼B3.4Au was relatively poor under the present electrophoresis conditions, which would have negative effects on the subsequent detection of target DNA. Therefore, further efforts to improve the resolution were addressed by introducing polymer additive into the separation buffer to induce the size-sieving effect, and the results are shown in Figure S6 (Supporting Information). It showed that a baseline separation was achieved in the electropherogram with addition of 0.5% HEC (Supporting Information, Figure S6b), and longer migration times of QDA3.4 (peak 1) and QD A3.4∼B3.4Au (peak 2) were also obtained in comparison with the electropherogram without HEC (Supporting Information, Figure S6a). Although the HEC in the separation buffer could reduce the mobilities of both QDA3.4 and QD A3.4∼B 3.4 Au, the mobility of the hybridization product of 4106
dx.doi.org/10.1021/ac200224y |Anal. Chem. 2011, 83, 4103–4109
Analytical Chemistry
ARTICLE
Figure 4. Electropherograms for the hybridization mixture of QDA3.4 and AuB3.4. Samples: (a) 50 μL of QDA3.4; (b) 50 μL of QDA3.4 þ 250 μL of AuB3.4. Separation buffers: 25 mM Na2B4O7 þ 0.5% HEC, pH 9.0. Other conditions were the same as described in Figure 3. The % RSD for the migration times of peaks in curves a and b (three repeat experiments) were 0.53% and 0.58%, respectively, while the %RSD for their peak areas were 1.75% and 1.88%, respectively.
QDA3.4∼B3.4Au might be influenced more obviously due to its lower charge-to-size ratio, finally resulting in the improvement of separation resolution. The fluorescence intensity changes of QDA 3.4 after hybridization with AuB3.4 were subsequently investigated. From Figure 4, it could be found that the fluorescence intensity of QDA3.4 after fully hybridizing with AuB3.4 was reduced to some extent. In our CE experiments, an equation was proposed to calculate the fluorescence changes of the QDDNA after fully hybridizing with their corresponding AuDNA (ΔF): ΔF ¼
FQA FQ
where FQ is the area of the electrophoresis peak for the QDDNA conjugate and FQA is the area of the electrophoresis peak for the QDAu conjugate obtained by the full hybridization between the QDDNA and corresponding Au DNA conjugates. From Figure 4, the ΔF was calculated to be 0.42 according to the equation, indicating that at this time the fluorescence of QDs was not enhanced by Au NPs but was reduced by about 58%. The reason for the QDs fluorescence quenching was probably mainly attributed to the occurrence of resonance energy transfer (RET) between the QDs and Au NPs.32,33 At this time the QDs were in close proximity to Au NPs (contour length is about 3.4 nm for a 10-mer double-stranded DNA), and there was substantial overlap between the emission spectra of the QDs (curve a, Figure 2B) and the absorption spectra of the Au NPs (Figure 1a), fully meeting the conditions required for the occurrence of RET. By controlling the base numbers of DNA oligonucleotides used for QDs and Au NPs modification, the effect of distance between QDs and Au NPs on the fluorescence of QDs was subsequently explored. As described in previous literatures, the doublestranded DNAs with less than 150 bp were relatively still in solution and more difficult to deform without external force.34,35 Therefore, the contour lengths of hybridized double-stranded
Figure 5. Variance of QDs fluorescence with the distance between QDs and Au NPs. Error bars show the standard deviation of three experiments.
DNA oligonucleotides between the QDs and Au NPs were used to approximately indicate the distance between them in our experiments. As shown in Figure 5, the fluorescence of QDs first decreased when the distance was less than 6.8 nm and then began to increase with the increasing distance and achieved the maximum enhancement by a factor of 2.3 at 11.9 nm; later, the fluorescence enhancement was found to decrease gradually when further increasing the distance, and it finally almost disappeared at 18.7 nm. These results indicated that the metal-enhanced QDs fluorescence in solution had strong distance dependence and was only occurring within the appropriate distance, which is similar to the results obtained in the solid medium. The mechanism for Auenhanced QDs fluorescence in our experiments was closely related to the resonance coupling between Au NPs and QDs.36 In our experiments, QDs with fluorescence emission wavelength at 531 nm were used, whose fluorescence frequency under excitation at 420 nm was near resonance with the Au NPs surface plasmons. Therefore, the resonance coupling between Au NPs and QDs would occur, and the surface plasmons of Au NPs would be excited by the QDs’ luminescence, producing a local enhanced electromagnetic field around the Au NPs. The local enhanced electromagnetic field could in turn interact with QDs, leading to the enhancement of the QDs’ fluorescence. For enhancing the intensity of the QDs fluorescence, the distance between the QDs and metal NPs ought to be neither too short nor too long. The RET between the QDs and metal NPs may occur within extremely short distance and finally lead to the fluorescence quenching of the QDs, whereas the surface plasmons of the Au NPs cannot be excited by the radiative dipole of the QDs in the condition of too long distance,20 and no MEF effect will occur. RQ1 RNase-free DNase is an endonuclease and can degrade DNA without specificity. This DNase was added to the QDA11.9∼B11.9Au system in which the QDs and Au NPs were in the optimal distance position, and its effect on the system fluorescence was studied. As shown in Figure 6, the fluorescence of the system was reduced significantly after adding the DNase, which was mainly attributed to the degradation of complementary DNA oligonucleotides between QDs and Au NPs by the DNase. The coupled QDs and Au NPs would be separated due to the DNA degradation, and the distance between them would 4107
dx.doi.org/10.1021/ac200224y |Anal. Chem. 2011, 83, 4103–4109
Analytical Chemistry
Figure 6. Effect of DNase on the fluorescence of the QDA11.9∼ B11.9Au system. Samples: (a) 50 μL of QDA11.9 þ 250 μL of AuB11.9; (b) 50 μL of QDA11.9 þ 250 μL of AuB11.9 þ 1 unit of RQ1 RNase-free DNase; (c) 50 μL of QDA11.9. The temperature and time of the degradation reaction were 37 °C and 10 min, respectively. Other conditions were the same as described in Figure 4. The %RSD for the migration times of peaks in curves a, b, and c (three repeat experiments) were 0.62%, 0.68%, and 0.59%, respectively, while the % RSD for their peak areas were 1.84%, 2.02%, and 1.92%, respectively.
immediately increase, which would result in the reduction and even disappearance of the MEF effect, followed by the decrease of system fluorescence. In addition, it was found that the electrophoresis peak of the system became very broad after adding the DNase (Figure 6b), whose migration time scope basically covered the electrophoresis peaks of both the QDA11.9 (Figure 6c) and QDA11.9∼B11.9Au conjugate (Figure 6a). The peak broadening was probably related to the cleavage nonspecificity of DNase. A series of cleavage products would be obtained after adding the DNase, in which might be included a variety of QD DNA conjugates with different base numbers and even the free QDs formed due to the complete degradation of DNA oligonucleotides on their surface. The complex cleavage products led to a broad electrophoresis peak. Figure 7a presents the electropherogram of the QDA11.9∼ B11.9Au system with 150 nM of target DNA (Table 1). The sequence of target DNA is the same as A11.9. From this electropherogram, two electrophoresis peaks were found and were easily assigned to the QDA11.9 and QDA11.9∼B11.9Au conjugates, respectively, by comparing their migration times with that of alone QDA11.9 (Figure 6c) and QDA11.9∼ B11.9Au (Figure 6a) samples. The appearance of the QDA11.9 peak (peak 1) indicated that there existed free QDA11.9 in the system. Namely, the specific competition between the QDA11.9 in the QDA11.9∼B11.9Au conjugate and target DNA occurred at this time, and a part of the QDA11.9 had fallen from the QDA11.9∼B11.9Au conjugate and became the free QD A11.9. In addition, with the decrease of target DNA amounts in the system (Figure 7bd), the electrophoresis peak for the free QDA11.9 (peak 1) was found to decrease gradually, while the electrophoresis peak for the QDA11.9∼B11.9Au conjugate (peak 2) correspondingly increased. This phenomenon indicated that the specific competition between the QDA11.9 and target DNA was closely related to the amount of target DNA in the system. Therefore, the concentration of target DNA in the system could be determined based on the intensity change of
ARTICLE
Figure 7. Electropherograms for the mixture of the QDA11.9∼ B11.9Au system (50 μL of QDA11.9 þ 250 μL of AuB11.9) and different amounts of target DNA: (a) 150, (b) 60, (c) 22, and (d) 15 nM. The temperature and time of the competition reaction were 37 °C and 1.5 h, respectively. Other conditions were the same as described in Figure 4. The %RSD for the migration times of peaks 1 and 2 in curves a, b, c, and d (three repeat experiments) were 0.61% and 0.63%, 0.62% and 0.64%, 0.65% and 0.67%, and 0.66% and 0.67%, respectively, while the % RSD for their peak areas were 1.84% and 1.87%, 1.83% and 1.88%, 1.85% and 1.91%, and 1.84% and 1.95%, respectively.
peak 1. In our experiments, a minimum of 19.6 pg (15 nM) of target DNA was identified (Figure 7d). In addition, the electropherogram of the QDA11.9∼B11.9Au system with nontarget DNA (Table 1) was investigated (Supporting Information, Figure S7b) in which no QDA11.9 peak was found, indicating that no specific competition between the QDA11.9 in the QDA11.9∼B11.9Au conjugate and nontarget DNA had occurred. Namely, our method has better specificity for the target DNA detection. However, it is difficult to achieve the detection of single-base substitution for our method using the linear DNA probe. The molecular beacon (MB) technique provides a viable alternative due to the high specificity of its stemloop structure. In our previous study, single-base mutation was accurately detected by employing an MB probe in which CdTe QDs and the organic molecule black hole quencher 2 (BHQ2) were used as the fluorophore and quencher, respectively, and no metal-enhanced fluorescence effect was utilized.22 Therefore, it is estimated that an effective method with high sensitivity may be established for the detection of single-base mutation by combining the metal-enhanced QDs fluorescence and MB technique. Such research is more complex and significative, so it will be the next work in our group.
’ CONCLUSIONS In this study, a metal-enhanced QDs fluorescence system was constructed by conjugating QDs with Au NPs in solution through a DNA oligonucleotide bridge, in which the distance between the QDs and Au NPs could be easily controlled by adjusting the base numbers of oligonucleotide. The distance dependence of the metal-enhanced QDs fluorescence in solution was then studied systematically by CE, and a simple method for the detection of target DNA in solution with a high sensitivity of 19.6 pg was finally established. This work provides an important reference for future study of metalenhanced QDs fluorescence in solution and exhibits potential capability in nucleic acid hybridization analysis and highsensitivity DNA detection. 4108
dx.doi.org/10.1021/ac200224y |Anal. Chem. 2011, 83, 4103–4109
Analytical Chemistry
’ ASSOCIATED CONTENT
bS
Supporting Information. Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org.
’ AUTHOR INFORMATION Corresponding Author
*E-mail:
[email protected]. Fax: (þ86) 27-8779-2202.
’ ACKNOWLEDGMENT This work was supported by the National Natural Science Foundation of China (Grant No. 81071229), Specialized Research Fund for the Doctoral Program of Higher Education of China (No. 20100142110002), the Fundamental Research Funds for the Central Universities (Hust, 2010ZD005), and the Open Research Fund of State Key Laboratory of Bioelectronics, Southeast University. We also thank Analytical and Testing Center (HUST) for the help of measurement. This work was also supported by the Doctor Student Academic Scholarship of the Ministry of Education of China and the Doctor Student Innovation Fund of HUST. ’ REFERENCES
ARTICLE
(23) Frens, G. Nat. Phys. Sci. 1973, 241, 20–22. (24) Srorhoff, J. J.; Elghanian, R.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L. J. Am. Chem. Soc. 1998, 120, 1959–1964. (25) Carregal-Romero, S.; Perez-Juste, J.; Herves, P.; Liz-Marzan, L. M.; Mulvaney, P. Langmuir 2010, 26, 1271–1277. (26) Dabbousi, B. O.; Rodriguezviejo, J.; Mikulec, F. V.; Heine, J. R.; Mattoussi, H.; Ober, R.; Jensen, K. F.; Bawendi, M. G. J. Phys. Chem. B 1997, 101, 9463–9475. (27) Qu, L.; Peng, Z. A.; Peng, X. Nano Lett. 2001, 1, 333–337. (28) Liu, T. C.; Wang, J. H.; Wang, H. Q.; Zhang, H. L.; Zhang, Z. H.; Hua, X. F.; Cao, Y. C.; Zhao, Y. D.; Luo, Q. M. J. Biomed. Mater. Res., Part A 2007, 83A, 1209–1206. (29) Yu, W. W.; Qu, L.; Guo, W.; Peng, X. Chem. Mater. 2003, 15 2854–2860. (30) Wang, H. Q.; Li, Y. Q.; Wang, J. H.; Xu, Q.; Li, X. Q.; Zhao, Y. D. Anal. Chim. Acta 2008, 610, 68–73. (31) Wang, Z.; Wang, C.; Yin, J.; Li, T.; Song, M.; Lu, M.; Wang, H. Electrophoresis 2008, 29, 4454–4462. (32) Xu, Q.; Bao, L.; Lin, Y.; Wang, H. Q.; Zhang, Z. L.; Zhao, Y. D. J. Innovative Opt. Health Sci. 2010, 3, 315–320. (33) Zhang, J.; Badugu, R.; Lakowicz, J. R. Plasmonics 2008, 3, 3–11. (34) Zhang, C. Y.; Johnson, L. W. Anal. Chem. 2006, 78, 5532–5537. (35) Singh-Zocchi, M.; Dixit, S.; Ivanov, V.; Zocchi, G. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 7605–7610. (36) Shimizu, K. T.; Woo, W. K.; Fisher, B. R.; Eisler, H. J.; Bawendi, M. G. Phys. Rev. Lett. 2002, 89, 117401.
(1) Alivisatos, A. P. Science 1996, 271, 933–937. (2) Wang, J. H.; Wang, H. Q.; Li, Y. Q.; Zhang, H. L.; Li, X. Q.; Hua, X. F.; Cao, Y. C.; Huang, Z. L.; Zhao, Y. D. Talanta 2008, 74, 724–729. (3) Engstrom, H. A.; Andersson, P. O.; Gregorius, K.; Ohlson, S. J. Immunol. Methods 2008, 333, 107–114. (4) Lichlyter, D. J.; Grant, S. A.; Soykan, O. Biosens. Bioelectron. 2003, 19, 219–226. (5) Ho, F. M.; Hall, E. A. H. Biosens. Bioelectron. 2004, 20, 1001–1010. (6) Ray, P. C.; Darbha, G. K.; Ray, A.; Walker, J.; Hardy, W. Plasmonics 2007, 2, 173–183. (7) Kim, J. H.; Morikis, D.; Ozkan, M. Sens. Actuators, B 2004, 102 315–319. (8) Cady, N. C.; Strickland, A. D.; Batt, C. A. Mol. Cell. Probes 2007, 21, 116–124. (9) Chen, H. H.; Leong, K. W. Nanomedicine 2006, 1, 119–122. (10) Geho, D.; Lahar, N.; Gurnani, P.; Huebschman, M.; Herrmann, P.; Espina, V.; Shi, A.; Wulfkuhle, J.; Garner, H.; Petricoin, E.; Liotta, L. A.; Rosenblatt, K. P. Bioconjugate Chem. 2005, 16, 559–566. (11) Lakowicz, J. R. Anal. Biochem. 2001, 298, 1–24. (12) Aslan, K.; Gryczynski, I.; Malicka, J.; Matveeva, E.; Lakowicz, J. R.; Geddes, C. D. Curr. Opin. Biotechnol. 2005, 16, 55–62. (13) Geddes, C. D.; Lakowicz, J. R. J. Fluores. 2002, 12, 121–129. (14) Sokolov, K.; Chumanov, G.; Cotton, T. M. Anal. Chem. 1998, 70, 3898–3905. (15) Ray, K.; Badugu, R.; Lakowicz, J. R. J. Am. Chem. Soc. 2006, 128, 8998–8999. (16) Lee, J.; Govorov, A. O.; Dulka, J.; Kotov, N. A. Nano Lett. 2004, 4, 2323–2330. (17) Jin, Y.; Gao, X. Nat. Nanotechnol. 2009, 4, 571–576. (18) Li, R.; Xu, S.; Wang, C.; Shao, H.; Xu, Q.; Cui, Y. ChemPhysChem 2010, 11, 2582–2588. (19) Liu, N.; Prall, B. S.; Klimov, V. I. J. Am. Chem. Soc. 2006, 128, 15362–15363. (20) Kulakovich, O.; Strekal, N.; Yaroshevich, A.; Maskevich, S.; Gaponenko, S.; Nabiev, I.; Woggon, U.; Artemyev, M. Nano Lett. 2002, 2, 1449–1452. (21) Li, Y. Q.; Wang, J. H.; Zhang, H. L.; Yang, J.; Guan, L. Y.; Chen, H.; Luo, Q. M.; Zhao, Y. D. Biosens. Bioelectron. 2010, 25 1283–1289. (22) Li, Y. Q.; Guan, L. Y.; Wang, J. H.; Zhang, H. L.; Chen, J.; Lin, S.; Chen, W.; Zhao, Y. D. Biosens. Bioelectron. 2011, 26, 2317–2322. 4109
dx.doi.org/10.1021/ac200224y |Anal. Chem. 2011, 83, 4103–4109
