DNA Hybridization Assay Using Gold ... - ACS Publications

Subscriber access provided by RMIT University Library

Article

A DNA hybridization assay using gold nanoparticles and electrophoresis separation provides 1-pM sensitivity Keiko Esashika, and Toshiharu Saiki Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.7b00682 • Publication Date (Web): 04 Dec 2017 Downloaded from http://pubs.acs.org on December 13, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Bioconjugate Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

A DNA hybridization assay using gold nanoparticles and electrophoresis separation provides 1-pM sensitivity Keiko Esashika† and Toshiharu Saiki† Department of Electronics and Electrical Engineering, Keio University, Yokohama 223-8522, Japan

ABSTRACT The efficiency of gold nanoparticle (AuNP) dimerization mediated by hybridization between two probe DNA molecules and a complementary target DNA molecule was maximized by examining several possible hybridization combinations. The uniformity of the size of the AuNPs, the use of surface modification appropriate for high hybridization efficiency, together with efficient blocking of nonspecific binding, all contributed to achieving a 1-pM detection limit following conventional gel electrophoresis separation of the DNA-modified AuNP multimers. This practical homogeneous DNA hybridization assay methodology will provide a rapid, cost-effective, and field-portable tool for clinical diagnosis.

INTRODUCTION Liquid biopsies have attracted increased attention over the past decade because they allow screening for disease using a simple blood test. For example, the analysis of fetal DNA in maternal plasma or serum enables noninvasive prenatal diagnosis and screening.1–5 The detection of specific cell-free DNA and microRNA as biomarkers offers the possibility of early cancer diagnosis,6–11 while the detection of pathogen DNA allows rapid pathogen identification and thus appropriate treatment of infectious diseases.12–15 All these applications of liquid biopsy require specific and rapid sample purification and amplification, which are typically expensive and time-consuming processes. Technological improvements are thus required to increase the sensitivity and detection limits for target molecules, reduce the

ACS Paragon Plus Environment

Bioconjugate Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 18

number of purification steps, and allow PCR-free sample preparation. Homogeneous assays reduce time-consuming processes because the reaction occurs completely in solution and does not require a solid support, in contrast to heterogeneous assays such as enzyme-linked immunosorbent assay.16–19 Gold nanoparticles (AuNPs) are widely used for the selective labeling of target biomolecules in homogeneous assays because of their large cross section at localized surface plasmon resonance (LSPR), good optical and chemical stability, and biocompatibility. Previous AuNP-based homogeneous assays have sensed AuNP aggregation mediated by hybridization with target DNA through changes in LSPR resonance (colorimetric detection) and changes in hydrodynamic properties (dynamic light scattering). In both methods, however, the detection limit is on the order of 1-10 nM.20–23 To improve the detection limit, we previously proposed an AuNP hybridization assay involving digital counting of dimer AuNPs undergoing Brownian motion.24,25

The number

of dimers is proportional to the amount of target DNA, and the detection limit is governed only by the presence of AuNP dimer due to non-specific binding, including entanglement and partial hybridization. The prevention of non-specific binding and the maintenance of high hybridization efficiency requires careful design of the surface modifications of the AuNP, including molecular length, hydrophilicity, and charge density. We recently employed alkanethiol self-assembled monolayers (SAMs) of HS-(CH2)11-(OCH2CH2)6-OCH2COOH to modify AuNP surfaces and attained good dispersability and high hybridization efficiency.26 The alkaline chain prevents surface-immobilized ssDNA from falling over the surfaces of AuNPs. The hydrophilic nature of oligoethylene glycol promotes the extension of ssDNA into the solvent thus enhancing the hybridization process. The introduction of oligoethylene glycol into the alkanethiol also prevents nonspecific binding caused by the entanglement of alkaline chain due to van der Waals interactions. We choose a COOH terminus to increase the surface charge density and thus to enhance the repulsive interaction between AuNPs. All these factors


Page 3 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


contribute to the efficient blocking of nonspecific binding maintaining high hybridization efficiency. The present study expands on this optimized surface modification and describes AuNP dimerization induced by the hybridization of two probe DNA molecules and a complementary target DNA molecule. The uniformity of the AuNP size, coupled with surface modification supporting high hybridization efficiency and efficient blocking of nonspecific binding, together with simple electrophoretic separation, allows 1-pM detection of the target DNA.

RESULTS AND DISCUSSION

Scheme 1. Protocol for the formation of AuNP dimers.

Table 1. ssDNA sequences used in this study Name

Sequences (5’ to 3’)

Pr1, 42-mer (Tm=75℃ )

5’GAATCCACGCCGTTCAATGTCGCAGAGGGGAAGGAGGTGAAA-[ThiolC3] 3’

Pr2, 42-mer (Tm=67℃)

5’ [ThiolC6]-AAACTTCTACTTGTCCACAATCTGCCCCAGCATCTTTTTGGC 3’

Pr3, 38-mer (Tm=70℃)

5’ [ThiolC6]-AAACCACGCCGTTCAATGTCGCAGAGGGGAAGGAGGTG 3’

Pr4, 42-mer (Tm=71℃)

5’ CTTCTACTTGTCCACAATCTGCCCCAGCATCTTTTTGGCAAA-[ThiolC3] 3’

Target-cDNA, 100mer

5’ TACCAGCTGTAGCCAAAAAGATGCTGGGGCAGATTGTGGACAAGTAGAAGCACCTCCTTCCCCTCTGCGACATTGAACGGCGTGGATTCAATAGTGAGCT 3’

Non-cDNA, 100mer

5’ TATTATCTCTCGACCACTGTATGCGGGCCCTGGGGTAGCTTGTTGAGTTC CTATTACATATCCTATAATTTGACGGTTGCCATCCACTCTTTCACCTTTG 3’

A protocol for the formation of AuNP dimers based on an immobilization, conjugation and hybridization process is illustrated in Scheme 1. The colloidal AuNPs have an average diameter of 41±3 nm (Tanaka Kikinzoku Kogyo). The AuNPs, coated with a negatively



Page 4 of 18

charged phosphine shell (BSPP), were functionalized with the thiolated-probe-ssDNA (Probe-DNA) listed in Table 1 (Pr1-Pr4). The Probe-DNAs were designed to be partially complementary to 100-mer Target-cDNA (Target-cDNA in Table 1), which encodes part of the gene for carcinoembryonic antigen (CEA), an important biomarker for screening colorectal cancer. Two batches of AuNPs were prepared: one was modified with Pr1 (3’ thiolated) or Pr3 (5’ thiolated), and the other with Pr2 (5’ thiolated) or Pr4 (3’ thiolated). The surface of the AuNP is also modified with a functionalized alkanethiol SAM C445, which incorporates a hydrophilic oligoethyleneglycols and COOH group at the terminus (carboxy-EG6-undecanethiol), optimized for eliminating nonspecific binding and maintaining hybridization efficiency. 26 AuNP Pr2

AuNP Pr3 SH

Target-cDNA

5’

3’

SH

5’

3’

3’ TCGAGTGATAACTTAGGTGCGGCAAGTTACAGCGTCTCCCCTTCCTCCACGAAGATGAACAGGTGTTAGACGGGGTCGTAGAAAAACCGATGTCGACCAT 5’

5’

3’ SH 5’ AuNP Pr1

3’ SH AuNP Pr4

Non-cDNA

5’ TATTATCTCTCGACCACTGTATGCGGGCCCTGGGGTAGCTTGTTGAGTTCCTATTACATATCCTATAATTTGACGGTTGCCATCCACTCTTTCACCTTTG 3’

Scheme 2. Hybridization configuration between Pr1-Pr4 (Probe-DNA) and Target-cDNA.


Page 5 of 18

(f) 14000

Integrated intensity (a.u.)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(b)Pr1 x Pr2

12000

(c)Pr3 x Pr4

10000

(d)Pr1 x Pr4

8000

(e)Pr3 x Pr2

6000 4000 2000 0 625

156

39

9.7

2.4

0

Target-cDNA concentration (pM)

Figure 1. Electrophoresis purification of AuNPs (a) before hybridization and (b)-(e) after hybridization with four combinations of Probe-DNA [(b) Pr1×Pr2, (c) Pr3×Pr4, (d) Pr1×Pr4, and (e) Pr3×Pr2] with Target-cDNA concentrations ranging from 2.4 to 625 pM. (f) The sum of the integrated intensity of electrophoresis bands over all multimers for each combination in (b)-(e) with Target-cDNA concentrations ranging from 2.4 to 625 pM.



We examined four combinations (Pr1×Pr2, Pr3×Pr4, Pr1×Pr4, and Pr3×Pr2, as shown in Scheme 2 for dimerization to determine a combination that provides the highest hybridization efficiency. Figures 1(b)-1(e) compares the result of agarose gel electrophoresis purification for the four combinations with Target-cDNA concentrations ranging from 2.4 to 625 pM. In the hybridization process, non-complementary ssDNA (Non-cDNA in Table 1) was also added so that the total concentration of DNA molecules (Target-cDNA and Non-cDNA) was constant (5000 pM) across all measurements. For all four combinations, bands due to dimers, trimers, and higher multimers arising from hybridization between the Probe-DNA (Pr1-Pr4) and Target-cDNA were observed. The double bands in Pr1×Pr2 (Fig. 1(b)) and Pr3×Pr4 (Fig. 1(c)) was due to difference in thiol linker between Pr1/Pr4 (C3 linker) and Pr2/Pr3 (C6 linker) as demonstrated in the measurement with Pr1- to Pr4-AuNPs before hybridization (Fig. 1(a)). To quantitatively compare the hybridization efficiency among the four combinations, the integrated intensity of dimer, trimer, tetramer and higher-order multimer bands were evaluated by NIH ImageJ analysis. The sum of the integrated intensity over all multimers for each combination are summarized in Fig. 1 (f). The result shows the order of hybridization efficiency as Pr3×Pr2 > Pr3×Pr4 > Pr1×Pr2 > Pr1×Pr4.

Figure 2. Electrophoresis purification of (a) AuNPs in pH6-7 buffer, (b) AuNPs resuspended in TBE40, and (c) AuNPs after incubation at 50℃ for 1h with BSPP, (d) AuNPs in (c) additionally modified with Probe-DNA (Pr1-Pr4), and (e) AuNPs in (d) additionally modified with SAM C445.


Page 6 of 18

Page 7 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


To attempt to understand the origin of this observed difference in hybridization efficiency among the combinations of Probe-DNA, we compared the electrophoresis mobilities of AuNPs modified with Pr1-Pr4. Before DNA modification we conducted electrophoresis purification of AuNPs in pH6-7 buffer, AuNPs resuspended in TBE40, and AuNPs coated with BSPP, as shown Fig. 2(a)-2(c). It is confirmed that the negatively charged BSPP gives rise to the electrophoretic mobility of the AuNPs. Figure 2(d) shows a result for BSPP-coated-AuNPs modified with Probe-DNA. We found that the mobilities of the Probe-DNA are smaller than that of AuNPs coated only by BSPP and significantly differ between Pr1/Pr4-AuNPs and Pr2/Pr3-AuNPs although the lengths and sequences of the Probe-DNA are similar to each other (Table 1). The mobilities become smaller by additionally modifying the AuNP surface with SAM (C455) and the reduction in mobilities is more significant for Pr1/Pr4 than Pr2/Pr3 (Fig. 2 (e)). Although, at the current stage, we cannot provide any explanation which is consistent with the experimental results above, it is most probable that the anomalous behaviors in electrophoresis mobility and the difference in hybridization efficiency between the combinations of Probe-DNAs originate from the difference in carbon chain length of the thiol linker between C3 and C6. The experimental result in Figs. 1(d) and 1(e) infers that freely diffusing Target-cDNA is much more efficiently hybridized with Pr2/Pr3 (C6 linker) than Pr1/Pr4 (C3 linker). The result in Figs. 1(b) and 1(c), however, implies that the hybridization efficiency between Target-cDNA and Pr1/Pr4 can be improved significantly once Target-cDNA is immobilized on the AuNP by hybridization with Pr2/Pr3.



(a)

(b)

(c)

(d)

(e)

(f) 25.0

40nm AuNPs Pr2-AuNPs Pr3-AuNPs monomers dimers trimers

0.5

40nm AuNPs Pr2-AuNPs Pr3-AuNPs monomers dimers trimers

20.0

Intensity (%)

1

Absorbance (a.u.)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 18

15.0 10.0 5.0 0.0

0 400

450

500

550

Wavelength (nm)

600

650

700

10

100 Size (nm)

1,000

Figure 3. (a)-(c) TEM images of monomers, dimers, and trimers recovered from the first, second, and third bands on an electrophoresis gel. (d) Cryo-TEM image of monomers, dimers, and trimers. (e) Absorption spectra of 40nm-AuNP, Pr2-AuNP, Pr3-AuNP, monomer, dimer, and trimer suspensions. (f) Hydrodynamic size distribution obtained by DLS measurement of 40nm-AuNP, Pr2-AuNP, Pr3-AuNP, monomer, dimer, and trimer suspensions, which are the same as those used in the measurement of (e).

Figures 3(a)-3(c) are transmission electron microscope (TEM) micrographs of particles


Page 9 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


recovered from the first band (monomer), second band (dimer) and third band (trimer) on the electrophoresis gel for the combination of Pr3×Pr2 with a Target-cDNA concentration of 156 pM. We confirmed complete separation between the monomers, dimers, and trimers, demonstrating the size and surface modification uniformity of the AuNPs. Figure 3(d) is a Cryo-TEM micrograph of monomers, dimers, trimers obtained by maintaining them in their natural state. The inter-particle gap of the dimer, trimers is uniformly 13 nm, which is equal to the length of Pr3. This gap is rather large and does not result in an LSPR shift caused by inter-particle interaction. This finding is consistent with the results of absorption measurements (Fig. 3(e)), where the spectra of unmodified 40nm-AuNP, Pr2-, Pr3-AuNP (before hybridization), monomer, dimer and trimer suspensions completely overlap. These results also indicate the absence of multimers formed by nonspecific binding and demonstrate high dispersability due to the repulsive interaction between AuNPs. For more confirmation, the size and size distribution of AuNPs and their multimers in the suspensions were measured by dynamic light scattering (DLS) measurement. Figure 3(f) shows the results, where the average diameters of unmodified 40nm-AuNP, Pr2-AuNPs, Pr3-AuNPs, monomer, dimer, trimer are 42.48nm, 54.35nm, 54.13nm, 54.71nm, 74.98nm, 78.04nm, respectively. The sizes of Pr2-AuNPs, Pr3-AuNPs, and monomer are almost equal to one another and larger than of unmodified AuNP.



(a)

(b)

(c) multimers tetramers trimers dimers

8000 6000 4000 2000 0



10000


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 18

105 104 103 y = 227.25x0.7841

102

R² = 0.9887

10 1 0.1

1

10

102

103


(d)

Figure 4. (a) Electrophoresis purification of Pr2-AuNPs and Pr3-AuNPs after hybridization with Target-cDNA at concentrations ranging from 0.6 to 5000 pM. (b) Integrated intensity of individual gel bands in (a) analyzed by using NIH ImageJ software. (c) Plot of the sum of the integrated intensity dimer, trimer, and tetramer bands for Target-cDNA concentrations ranging from 0.6 to 156 pM. The data set was fit using a power law. (d) Electrophoresis separation of AuNPs at low concentrations and with a larger amount of AuNP sample than used in (a), to enhance optical contrast.

As a proof-of-concept for application to quantitative diagnosis, electrophoresis was performed using the combination of Pr3×Pr2 with Target-cDNA concentrations ranging from


Page 11 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


0.6 to 5000 pM (Fig. 4(a)). For each Target-cDNA concentration, the amount of dimer, trimer, tetramer and higher-order multimer was evaluated by NIH ImageJ analysis of the electrophoresis gel. The integrated intensity of each electrophoresis band is summarized in Fig. 4(b). An analytical calibration curve was constructed by summing the integrated intensities of dimer, trimer, and tetramer bands and plotting the values as a function of Target-cDNA concentration. As shown in Fig. 4(c), the data points were fit with a power law as y = x0.784 (R2 = 0.9887) over a wide range of Target-cDNA concentrations. At the Target-cDNA concentration above 156 pM, which is almost equal to the concentration of Pr2and Pr3-AuNPs, higher-order multimers than tetramers are formed and the plots deviate from the power law. We determined the detection limit of Target-cDNA by performing electrophoresis separation of larger amounts of dimer samples to obtain higher image contrast in Fig. 4(d). Reproducibility was checked by running each Target-cDNA concentration (0, 0.6, and 1.2 pM) in three lanes. A clear difference is observed in the second band between 0.6 pM and 1.2 pM, thus demonstrating 1 pM sensitivity.



(a)

(c)

12000 10000 8000 6000

multimers tetramers trimers dimers

4000 2000 0


(b) Integrated intensity (a.u.)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 18

105 104 103 102

y = 188.35x0.8023

10

R² = 0.9941

1 0.1


1

10

102

103


Figure 5. (a) Electrophoresis purification of AuNPs conjugated with both Pr2 and Pr3 after hybridization with Target-cDNA at concentrations ranging from 0.6 to 5000 pM. (b) Peak area of individual gel bands in (a) analyzed using NIH ImageJ software. (c) Plot of the integrated peak area over the multimer bands for Target-cDNA concentrations ranging from 0.6 to 156 pM. The data set was fit using a power law.

In the proposed methodology, the sample preparation and examination steps, and also variations between batches will be minimized by immobilizing both Pr2 and Pr3 on the surfaces of single AuNPs, whereas in the above protocol Pr2-AuNP and Pr3-AuNP were prepared separately in two batches. The electrophoresis results (Figs. 5(a) and 5(b)) show no differences in hybridization efficiency and the probability of non-specific binding with the results obtained in Fig. 4(a). The data points in Fig. 5(c) were fit with a power law as y = x0.8023 (R2 = 0.9941). The scheme is promising also in terms of the enhancement of efficiency in dimer formation. In the case of separate immobilization of Pr2 and Pr3 respectively, hybridization with a combination of Target-cDNA, Pr2-AuNPs, and Pr3-AuNPs is needed for


Page 13 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


dimerization. Under the diffusion-limited reaction assumption, the probability for dimerization might be improved by the simultaneous immobilization of Pr2 and Pr3 because dimerization occurs with a combination of target DNA and two Pr2-Pr3-AuNPs. We are convinced that the scheme will provide better dimerization efficiency by optimizing the coverage density of Pr2 and Pr3.

CONCLUSIONS We have developed an AuNP dimerization scheme in which hybridization efficiency is maximized by carefully choosing the hybridization combination between two probe DNA molecules and a complementary target DNA molecule. A 1-pM detection limit of target DNA was achieved using simple electrophoresis gel separation. This high sensitivity is due to the uniformity of the AuNP size and the control of surface charge density of AuNP by SAM modification to lead to the complete blockage of nonspecific binding and maintenance of high hybridization efficiency. This strategy holds promise for simple, fast, and practical DNA assays for clinical diagnosis.

EXPERIMENTAL PROCEDURES Materials. A colloidal suspension of AuNPs was provided from Tanaka Kikinzoku Kogyo, (average particle diameter of 41±3 nm, concentration of 1×1011 particles/ml (=167 pM), and pH 6-7). Deionized water (DDW) purchased from Millipore (water for molecular biology) was used for all experiments. Thiol-modified oligonucleotides were purchased from Eurofins Genomics. (±)-dithiothreitol (DTT), Bis(p-sulfonatophenyl)phenylphosphine dipotassium salt dehydrate sodium chloride (BSPP), 10× TBE (0.89 M Tris-borate, 20 mM EDTA: pH 8.2-8.4), ethanol, agarose

S,

and

Ficoll

400

were

purchased

from


Wako

Pure

Chemical.


Carboxy-EG6-undecanethiol

C445: HS-(CH2)11-(OCH2CH2)6-OCH2COOH)

Page 14 of 18

SAM

was

purchased from Dojindo Molecular Technologies. Synthesis of Probe-DNA-AuNPs conjugates. The AuNP colloidal suspension was ultrasonically dispersed for 15 min, then 5 ml of the suspension was placed in a 5 ml microfuge tube (Eppendorf DNA LoBind Tubes) and mixed with 100 µl 50 mg/ml BSPP solution prepared using DDW. After incubation at 50 °C for 1 h, the AuNPs were washed by centrifugation at 5,000 rpm for 15 min and resuspended in 5 ml of TBE40 (40 mM NaCl, 0.5 mg/ml BSPP, 0.5× TBE). The AuNP suspension was divided into two aliquots and conjugates with 4 different Probe-DNA combinations were prepared, as shown in Table 1 and Scheme 2 (Pr1×Pr2, Pr3×Pr4, Pr1×Pr4, Pr3×Pr2). Binding occurred through thiolation at the 5’- or 3’end of each of the ssDNA sequences complimentary to the target DNA sequence. The Probe-DNAs were added at a number ratio of ssDNA/AuNP = 30 to the AuNP solution and were incubated at 50 °C overnight. The disulfide bond of thiolated Probe-DNA was reduced using DTT before adding to the AuNP solution. The Probe-DNA-AuNPs were then modified with the functionalized alkanethiol SAM C445 by adding to the Probe-DNA-AuNP suspension at a number ratio of alkanethiol/AuNP = 26,000 and incubated at 50 °C for 1 h. (C445 was first dissolved with EtOH and then diluted with the same amount of DDW.) Unbound Probe-DNA and C445 were removed by centrifugation at 5,000 rpm for 15 min and the pellet was resuspended with TBE40. After two washing cycles, the pellet was resuspended in 2500 µl of TBE160 (160 mM NaCl, 0.5 mg/ml BSPP, 0.5× TBE) to provide a concentration of 2×1011 particles/ml (=334 pM). The two suspensions of probe-DNA-AuNP (Pr1/Pr3 and Pr2/Pr4) were mixed at a ratio of 1:1. The Target-cDNA concentration was increased from 2.4 to 625 pM for hybridization to form AuNP dimers, where non-complementary ssDNA (Non-cDNA in Table 1) was also added so that the total concentration of DNA molecules (Target-cDNA and Non-cDNA) was constant


Page 15 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(5000 pM). After denaturation by incubating at 92 °C for 5 min, the mixed suspension was left for 30 min at room temperature for hybridization. The suspensions were washed twice by centrifugation at 5,000 rpm for 15 min with 0.5× TBE to remove NaCl. Probe-DNA-AuNPs Characterization. The suspensions (200 µl) were centrifuged at 5,000 rpm for 15 min. The pellet obtained was mixed with 1/5 volume Ficoll400 (100 mg/ml) loading buffer solution and was purified by 1.5% agarose gel electrophoresis (Mini Submarine Gel Electrophoresis Unit from NIHON EIDO. Co. Ltd.) at 175 V for 15 min with 0.5× TBE as running buffer. The bands on the gels were photographed using a digital camera system (RICOH CX4). The optical intensities of the gel bands at each concentration were compared using NIH ImageJ software. A standard curve was obtained from the plot of the integrated peak area over the multimer bands for Target-cDNA concentrations ranging from 0.6 to 156 pM. Suspensions of the Probe-DNA-AuNPs recovered from the first, the second, and the third bands of the electrophoresis gel were observed using a transmission electron microscope (TEM: TECNAI G2, TECNAI Sprits from FEI). The inter-particle distance of dimers in its natural state was evaluated by Cryo-TEM (Titan Krios from FEI). UV-visible absorption spectroscopy (UV-Vis: BioSpectrometer from Eppendorf) was used to characterize the localized surface plasmon resonance properties. The size and size distribution of AuNPs and their multimers in the suspensions were measured by DLS using a Nano ZS zetasizer system (Malvern Instruments). Measurement parameters were set as follows: a laser wavelength of 633 nm (He–Ne), a scattering, a measurement temperature of 25°C.

AUTHOR INFORMATION Corresponding Author E-mail: [email protected] Phone: (+81)45-566-1784. Fax: (+81)45-566-1529



Present Addresses †

Department of Electronics and Electrical Engineering, Keio University, Hiyoshi, Kohoku-ku,

Yokohama, Kanagawa, 223-8522, Japan

ACKNOWLEDGEMENTS We are grateful to Tanaka Kikinzoku Kogyo for providing gold nanoparticles for this study. This work was supported by JSPS KAKENHI Grant Number 16K13645 and partially by the Advanced Photon Science Alliance Project from MEXT. A part of this work was supported by Advanced Characterization Nanotechnology Platform, Nanotechnology Platform Program of MEXT at the Research Center for Ultra-High Voltage Electron Microscopy (Nanotechnology Open Facilities) in Osaka University.

REFERENCES (1) Lo, Y. M. D., Tein, M. S. C., Lau, T. K., Haines, C. J., Leung, T. N., Poon, P. M. K., Wainscoat, J. S., Johnson, P. J., Chang, A. M. Z., and Hjelm, N. M. (1998) Quantitative Analysis of Fetal DNA in Maternal Plasma and Serum: Implications for Noninvasive Prenatal Diagnosis. Am. J. Hum. Genet. 62, 768–775. (2) Palomaki, G. E., Kloza, E. M., Lambert-Messerlian, G. M., Haddow, J. E., Neveux, L. M., Ehrich, M., van den Boom, D., Bombard, A. T., Deciu, C., Grody, W. W., et al. (2011) DNA sequencing of maternal plasma to detect Down syndrome: An international clinical validation study. Genet. Med. 13, 913–920. (3) Lo, Y. M. D., Corbetta, N., Chamberlain, P. F., Rai, V., Sargent, I. L., Redman, C. W., and Wainscoat, J. S. (1997) Presence of fetal DNA in maternal plasma and serum. Lancet 350, 485–487. (4) Chan, K. C. A., Zhang, J., Hui, A. B. Y., Wong, N., Lau, T. K., Leung, T. N., Lo, K. W., Huang, D. W. S., and Lo, Y. M. D. (2004) Size Distributions of Maternal and Fetal DNA in Maternal Plasma. Clin. Chem. 50, 88–92. (5) Lun, F. M. F., Chiu, R. W. K., Chan, K. C. A., Tak, Y. L., Tze, K. L., and Lo, Y. M. D. (2008) Microfluidics digital PCR reveals a higher than expected fraction of fetal DNA in maternal plasma. Clin. Chem. 54, 1664–1672. (6) Heitzer, E., Ulz, P., and Geigl, J. B. (2015) Circulating tumor DNA as a liquid biopsy for cancer. Clin. Chem. 61, 112–123. (7) Crowley, E., Di Nicolantonio, F., Loupakis, F., and Bardelli, A. (2013) Liquid biopsy: monitoring cancer-genetics in the blood. Nat. Rev. Clin. Oncol. 10, 472–84.


Page 16 of 18

Page 17 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(8) Anker, P., Mulcahy, H., Chen, X. Q., and Stroun, M. (1999) Detection of circulating tumour DNA in the blood (plasma/serum) of cancer patients. Cancer Metastasis Rev. 18, 65– 73. (9) Jahr, S., Hentze, H., Englisch, S., Hardt, D., Fackelmayer, F. O., Hesch, R., and Knippers, R. (2001) DNA Fragments in the Blood Plasma of Cancer Patients : Quantitations and Evidence for Their Origin from Apoptotic and Necrotic Cells DNA Fragments in the Blood Plasma of Cancer Patients : Quantitations and Evidence for Their Origin from Apoptotic and Necr. Cancer Res. 61, 1659–1665. (10) Brock, G., Castellanos-Rizaldos, E., Hu, L., Coticchia, C., and Skog, J. (2015) Liquid biopsy for cancer screening, patient stratification and monitoring. Transl. Cancer Res. 4, 280– 290. (11) Sozzi, G., Conte, D., Leon, M., Cirincione, R., Roz, L., Ratcliffe, C., Roz, E., Cirenei, N., Bellomi, M., Pelosi, G., et al. (2003) Quantification of free circulating DNA as a diagnostic marker in lung cancer. J. Clin. Oncol. 21, 3902–3908. (12) Einsele, H., Hebart, H., Roller, G., Löffler, J., Rothenhofer, I., Müller, C. A., Bowden, R. A., van Burik, J., Engelhard, D., Kanz, L., et al. (1997) Detection and identification of fungal pathogens in blood by using molecular probes. J. Clin. Microbiol. 35, 1353–60. (13) Malorny, B., Tassios, P. T., Rådström, P., Cook, N., Wagner, M., and Hoorfar, J. (2003) Standardization of diagnostic PCR for the detection of foodborne pathogens. Int. J. Food Microbiol. 83, 39–48. (14) Chung, H. J., Castro, C. M., Im, H., Lee, H., and Weissleder, R. (2013) A magneto-DNA nanoparticle system for rapid detection and phenotyping of bacteria. Nat. Nanotechnol. 8, 369–75. (15) Kang, T., Yoo, S. M., Yoon, I., Lee, S. Y., and Kim, B. (2010) Patterned multiplex pathogen DNA detection by Au Particle-on-wire SERS sensor. Nano Lett. 10, 1189–1193. (16) Storhoff, J. J., Lucas, A. D., Garimella, V., Bao, Y. P., and Müller, U. R. (2004) Homogeneous detection of unamplified genomic DNA sequences based on colorimetric scatter of gold nanoparticle probes. Nat. Biotechnol. 22, 883–887. (17) Liu, X., Dai, Q., Austin, L., Coutts, J., Knowles, G., Zou, J. H., Chen, H., and Huo, Q. (2008) A one-step homogeneous immunoassay for cancer biomarker detection using gold nanoparticle probes coupled with dynamic light scattering. J. Am. Chem. Soc. 130, 2780– 2782. (18) Han, G., Xing, Z., Dong, Y., Zhang, S., and Zhang, X. (2011) One-step homogeneous DNA assay with single-nanoparticle detection. Angew. Chemie - Int. Ed. 50, 3462–3465. (19) He, S., Song, B., Li, D., Zhu, C., Qi, W., Wen, Y., Wang, L., Song, S., Fang, H., and Fan, C. (2010) A craphene nanoprobe for rapid, sensitive, and multicolor fluorescent DNA analysis. Adv. Funct. Mater. 20, 453–459. (20) Saha, K., Agasti, S. S., Kim, C., Li, X., and Rotello, V. M. (2012) Gold nanoparticles in



chemical and biological sensing. Chem. Rev. 112, 2739–2779. (21) Jans, H., and Huo, Q. (2012) Gold nanoparticle-enabled biological and chemical detection and analysis. Chem. Soc. Rev. 41, 2849–2866. (22) Zhang, Y., Chu, W., Foroushani, A. D., Wang, H., Li, D., Liu, J., Barrow, C. J., Wang, X., and Yang, W. (2014) New gold nanostructures for sensor applications: A review. Materials (Basel). 7, 5169–5201. (23) Wang, G., Akiyama, Y., Shiraishi, S., Kanayama, N., Takarada, T., and Maeda, M. (2016) Crosslinking versus Non-Crosslinking Aggregation of Gold Nanoparticles Induced by DNA Hybridization: A Comparison of the Rapidity of Solution Color Change. Bioconjug. Chem. 28, 270–277. (24) Mizuno, N., Takeshita, Y., Kobayashi, J., Esashika, K., and Saiki, T. (2014) Polarization-based immunoassay in aqueous solution using Au nanoparticle-labeled antibody. Appl. Phys. A Mater. Sci. Process. 115, 75–78. (25) Kobayashi, J., Takeshita, Y., Mizuno, N., Esashika, K., and Saiki, T. (2015) Robust discrimination between single gold nanoparticles and their dimers in aqueous solution for ultrasensitive homogeneous bioassays. Adv. Opt. Technol. 2015, 581381. (26) Esashika, K., and Saiki, T. (2016) Optimized modification of gold nanoparticles with a self-assembled monolayer for suppression of nonspecific binding in DNA assays. Jpn. J. Appl. Phys 55, 107001. TOC graphic


Page 18 of 18

DNA Hybridization Assay Using Gold ... - ACS Publications

Recommend Documents