Encapsulating quantum dots within HIV-1 virions through site-specific

Subscriber access provided by University of Sunderland

Communication

Encapsulating quantum dots within HIV-1 virions through site-specific decoration of the matrix protein enables single virus tracking in live primary macrophages Qin Li, Wen Yin, Wei Li, Zhi-Ping Zhang, Xiaowei Zhang, Xian-En Zhang, and Zongqiang Cui Nano Lett., Just Accepted Manuscript • DOI: 10.1021/acs.nanolett.8b02800 • Publication Date (Web): 06 Nov 2018 Downloaded from http://pubs.acs.org on November 6, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Encapsulating quantum dots within HIV-1 virions through site-specific decoration of the matrix protein enables single virus tracking in live primary macrophages Qin Li1,3, Wen Yin1, Wei Li1, Zhiping Zhang1, Xiaowei Zhang1, Xian-En Zhang2, Zongqiang Cui1,* 1State

Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy

of Sciences, Wuhan, P.R.China 2National

Laboratory of Biomacromolecules, Institute of Biophysics, Chinese

Academy of Sciences, Beijing, P.R.China 3Engineering

Research Center of Industrial Microbiology, Ministry of Education,

College of Life Sciences, Fujian Normal University, Fujian, P. R. China

*Corresponding authors: Zongqiang Cui, No.44, Xiaohongshan Middle Area, Wuhan 430071, P.R.China. Tel: + 86-27-87199115, Fax: + 86-27-87199492 E-mail: [email protected]

1

ACS Paragon Plus Environment

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Labeling and imaging with quantum dots (QDs) provides powerful tools to visualize viral infection in living cells. Encapsulating QDs within virions represents a novel strategy for virus labeling. Here, we developed infectious HIV-1 virions encapsulating QDs through site-specific decoration of the viral matrix protein (MA) and used them to visualize early infection events in human primary macrophages by single-particle imaging. The MA protein was fused to a biotin acceptor peptide (BAP) tag, biotinylated, complexed with streptavidin-conjugated QDs in live cells, and incorporated into virions during virus assembly. The QD-encapsulated virions were tracked during infection of macrophages at a single particle level. The dynamic dissociation of MA and Vpr was also tracked in real time, and the results demonstrated that MA has multiple dynamic behaviors and functions during virus entry. More importantly, we tracked the dynamic interplay of QD-encapsulated virions with cellular mitochondria in live primary macrophages. We also found that HIV-1 can induce fission of mitochondria during the early phases of infection. In summary, we have constructed a type of QD-encapsulated virus particle, and used this technology to further our understanding of the early events of HIV-1 infection. Key words: Quantum dots, HIV-1, matrix, single-particle tracking, mitochondria, fission

2


Page 2 of 40

Page 3 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Virus-labeling technology and single-virus tracking in real time are powerful tools for studying virus–host dynamics. These techniques allow visualization of successive events in the viral life cycle, which provides information that is missed during static imaging, and are useful for elucidating the molecular mechanisms of virus-host interaction 1-4. Compared with virus-labeling techniques such as fluorescent fusion protein expression and organic dye staining, inorganic semiconductor nanoparticle quantum dots (QDs) provide remarkable photostability, brightness, and biocompatibility for single-virus imaging and time-lapse tracking 5, 6. Many viruses, including human T-cell leukemia virus type 1, baculovirus, hematopoietic necrosis virus, influenza A virus, and adenovirus have been successfully labeled with QDs by direct virion decoration for imaging analyses 7-8. However, previous reports of virus labeling with QDs have mainly modified peripheral viral components, such as the envelope or envelope glycoproteins, using chemical modification or direct biotinylation of the virion envelope. Encapsulating QDs within the interior of the virion provides an alternative approach for virus labeling. This strategy does not affect properties of the viral envelope, and, thus, does not perturb interactions between viral glycoproteins and host cell receptors 9. We have previously reported that QDs could be successfully encapsulated within SV40 virus-like particles to allow imaging of viral behavior in mammalian cells 10. Zhang et al. reported successful encapsulation of QDs conjugated to modified genomic RNAs within VSV-G pseudotyped lentivirus particles 9. The baculovirus nucleocapsid has also been labeled with QDs to monitor infection events subsequent to loss of viral envelope 11. Recently, we encapsulated QDs within the HIV-1 capsid by labeling HIV-1 Vpr with QDs 12. Thus, QD-labeling methods within virions afford new opportunities for single virus tracking analysis. In this work, we aimed to encapsulate QDs within virions by 3


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

incorporating them into the space between the capsid and the envelope, so as to construct a type of fluorescent HIV-1 for single particle tracking. Our strategy was to site-specifically label the HIV-1 matrix (MA) protein with QDs to construct fluorescent virions encapsulating quantum dots. MA is the major viral structural protein and is primarily located inside the HIV-1 envelope lipid bilayer, where it is attached to the bilayer by a multipart membrane-binding domain 13. MA is derived from the processing of the polyprotein precursor Pr55Gag. Pr55Gag can be processed into MA, capsid, nucleocapsid, and p6 proteins in virions 14. MA is the amino-terminal domain of Pr55Gag. It has been established that MA can be decorated with fluorescent proteins through genetic engineering of the viral genome. Here, we attempted to ligate QDs with MA and encapsulate the resulting QDs-MA into virus particles. Human primary macrophages play an important role in HIV-1 infection and progression to AIDS. Macrophages act as long-lived reservoirs and are resistant to virus-induced cytopathic effects; they are also able to cross the blood–brain barrier to spread virus. Many processes and mechanisms of viral entry and virus–host interaction in macrophages remain to be elucidated, especially in real time and at the single virus level. In this work, we encapsulated QDs within HIV-1 virions through incorporation of modified MA proteins that were tagged with a short biotin acceptor peptide, biotinylated, and complexed with streptavidin-conjugated QDs. The HIV-1 virions encapsulating QDs were used for single-particle tracking during viral entry, disassembly, and interaction with mitochondria in live primary macrophages.

4


Page 4 of 40

Page 5 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Preparation of HIV-1 virions encapsulating QDs by site-specific labeling of MA protein. HIV-1 virions encapsulating QDs (HIV-QD-MA) were assembled via MA-QD conjugation during viral assembly. We introduced the BAP tag sequence into the highly flexible MA C-terminal domain (residues 123 to 132; Pr55Gag-BAP). As illustrated in Figure 1a, we obtained Pr55Gag-BAP by inserting the BAP tag between Q127 and V128. To predict and understand detailed information about the conformational changes in Pr55Gag-BAP, we performed molecular modeling in silico using the de novo method in Rosetta 3.5. Manual model building was then performed with Coot, and the quality of the resulting 3D models was checked using MolProbity. The structures of Pr55Gag and Pr55GAG-BAP are shown in Figure 1b in ribbon form with MA, BAP, and other protein colored in green, red, and blue, respectively. By comparing the nuclear magnetic resonance structure of Pr55Gag (PDB ID: 1L6N) constructed using the de novo method with that of Pr55Gag-BAP (Figure 1b), we found that the BAP was exposed on the surface of the MA domain and showed high flexibility. Thus, we judged it likely that chimeric Pr55GAG-BAP could be specifically modified through addition of a biotin moiety catalyzed by the biotin ligase, BirA. 293T cells were co-transfected with pAD8, pcDNA3.1(+)-BirA, and pAD8-MA-BAP, and 4– 6 h later, biotin was added to the cells to induce biotinylation of the target protein. Western blotting was used to confirm biotinylation of MA in virions produced in 293T cells. As expected, both Pr55Gag and MA were specifically biotinylated (Figure 1c). Streptavidin-conjugated QDs (SA-QDs) were then added to the cells to allow biotinylated Pr55Gag-BAP to conjugate with SA-QDs; the resulting complexes would be incorporated into new viral particles during assembly in 293T cells, as shown in the schematic in Figure 1d. During viral budding and maturation, 5


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Pr55Gag-QDs should be cleaved by the viral protease to generate MA-QD-labeled HIV-1 virions (HIV-QD-MA). The HIV-QD-MA particles were collected and purified for subsequent experiments.

Characterization of HIV-QD-MA particles HIV-QD-MA particles were first characterized by transmission electron microscopy (TEM) imaging with negative staining. Dark electron-dense dots similar in size to SA-QDs (approximately 7 nm in diameter) (Figure 2a) were observed inside virions, showing that QDs were encapsulated within the viral particles. Most of the HIV-QD-MA particles contained only one QD, and a very small number of particles contained two QDs (Figures 2c and 2d). The HIV-QD-MA particles showed normal morphology compared with unlabeled virus (Figure 2b). HIV-QD-MA virus-producing cells were fixed 48 h post-transfection for ultrathin section electron microscopy analysis. The results showed that progeny virions were generated normally during the QD-labeling process (Figure 2e), indicating that the labeling approach did not interfere with virus production and morphogenesis. No dark electron-dense dots were observed in wild-type HIV-1 particles. When MA was not fused with the BAP tag, QDs could not be observed in the viral particles. These results demonstrated that MA-conjugated QDs were encapsulated within HIV-1 viral particles, rather than nonspecifically attached to the viral surface. To further confirm the successful labeling of HIV-1 with QDs, HIV-QD-MA viruses were analyzed by immunofluorescence and Vybrant® DiO staining. Coverslips were overlaid with the collected HIV-QD-MA viruses and immunostained with an antibody against the HIV-1 capsid protein p24 as shown in Figure 2g. The QD fluorescence signal (red) was readily detected on 6


Page 6 of 40

Page 7 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

HIV-QD-MA virions, and the majority of QDs (83.3% colocalization efficiency) were colocalized with p24. Furthermore, when virions were exposed to the lipophilic membrane dye DiO (green), the QD fluorescence signals colocalized with the membrane dye DiO (75.6% colocalization efficiency). These results demonstrated that QDs were successfully incorporated into HIV-1 virions. As a control, we examined wild-type viral particles lacking chimeric MA-BAP proteins and did not observe any QD signal (Figure 2h). These results further confirmed that QDs were successfully encapsulated within HIV-1 particles. Lastly, the infectivity of HIV-QD-MA viral particles was tested using a luciferase reporter assay in TZM-bl indicator cells. The result showed that the infectivity of HIV-QD-MA virus did not significantly differ from that of wild-type HIV-1 virus (Figure 2f).

Single-particle tracking of HIV-QD-MA internalization into macrophages Using virions encapsulating QDs, we could track HIV-1 entry into and mobility within macrophages at the single-virus level. HIV-QD-MAs were incubated with macrophages at 4°C for 30 min to allow virus adsorption, and then the cells were moved to a 37°C cell culture chamber mounted on the microscope for imaging. We found that some HIV-QD-MA particles were internalized into macrophages with an instantaneous velocity increase while other HIV-QD-MA particles attached to the cell membrane for a long period, where they maintained a relatively low constant speed and were not internalized. As shown in Figure 3a, two representative HIV-QD-MA particles (the internalized (i) and non–internalized (ii) virions), were imaged inside a macrophage. Time-lapse images of the movements of these two particles are shown in Figure 3b (Movie S1). In the early stage of 7


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

infection, the HIV-QD-MA particles represented by (i) in Figure 3 moved slowly for about 2 min, and then were rapidly internalized into the cytoplasm. The mean square displacement (MSD) against time (log-log plot) for the trajectory of rapid transport can be fit to a linear function (Figure 3d, left panel), yielding a velocity from 0.1 to 0.8 μ m/s (Figure 3c, left panel), which indicated that the virus was actively internalized into the cell. By contrast, the non–internalized particles represented by (ii) in Figure 3a maintained a relatively constant speed of less than 0.1 μm/s (Figure 3c and d, right panel) and were not internalized. The trajectories and maximum velocities of 400 individual virions were tracked and analyzed. Approximately half of the virions (54.4%) showed evidence of active transport into cells with an instantaneous velocity increase, while the remainder (45.6%) maintained a relatively constant speed without internalization (Figure 3f). Among the 54.4% of virions that entered cells, the maximum velocity was about 0.3–1.0 μm/s (Figure 3e). After cellular entry, about 48.5% of HIV-QD-MA viral particles moved from centripetal areas towards perinuclear areas (Figure 3g), while other virions moved in a non-directional, random-walk manner.

Real-time imaging of HIV-1 MA dissociation following entry During assembly of HIV-1 virions encapsulating QDs-conjugated MA, Vpr-mCherry can be simultaneously incorporated to construct dual-labeled HIV-QD-mCherry particles (80.7% colocalization efficiency). The dual-fluorescent HIV particles were then tracked to study the dynamic dissociation of MA and Vpr in live macrophages. In dual-fluorescent HIV-QD-mCherry, MA-QDs labeled the viral matrix, and Vpr-mCherry was associated with the viral genome in the viral core 15, 16. During movement of this particle in the cytoplasm, a dynamic separation of the 8


Page 8 of 40

Page 9 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

QD signal (red) from the colocalized mCherry signals (green) was observed (Figure 4a, b, c and Movie S2), suggesting that viral MA was disassembling from the viral core. The trajectories and velocities of this separation are shown in Figure 4d, e. In our experiments, we also observed another type of MA disassembly event. For viral particles labeled with more than one MA-QD, the MA-QD signal occasionally became separated into two parts. One part of the QD signal separated from the mCherry-Vpr labeled viral core, and another part remained associated with mCherry-Vpr throughout the 20 min duration of imaging (Figure 5a-d, Movie S3). A schematic of the viral MA disassembly events is shown in Figure 5e. We also observed that the dual-labeled viral complexes were docked at the nuclear membrane (Figure 5f) or localized to the nucleus (Figure 5g) 2–4 h post infection. These results indicated that the MA protein may have multi-dynamic behaviors and functions during viral entry.

Interplay between HIV-QD-MA virions and mitochondria in live macrophages Mitochondria have been reported to play important roles in HIV-1 infection and transmission, and the virus may regulate mitochondrial signaling pathways 17, 18. To directly observe the relationship between HIV-1 particles and mitochondria during early viral entry, we tracked endocytosed HIV-QD-MA viruses and macrophage mitochondria by labeling live mitochondria with MitoTracker® Green. As shown in Figure S1a, HIV-QD-MA particles (i, ii) underwent a centripetal movement and gradually approached mitochondria (Figure S1a). Sequential images of these two viral particles with mitochondria are shown in Figure S1b (i, ii) (Movie S4, S5). During trafficking, the two virions contacted the mitochondria for an extended period of time. Particle (i) dynamically associated with a mitochondrion for about 1 min; 9


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

similarly, particle (ii) made contact with a mitochondrion for about 40 sec. The long duration of colocalization between the virions and the mitochondria implies that complex interactions may exist. We also analyzed the percentage of endocytosed HIV-QD-MA virions that interacted with mitochondria and found that most endocytosed virions (about 76.19%) interacted with mitochondria for some length of time. The distribution of the duration of virion-mitochondrion interaction is shown in Figure S1c; duration was distributed normally with a range of 10–120 s.

Early infection by HIV-1 triggers mitochondrial fission in macrophages Mitochondria are highly dynamic, tubular network organelles undergoing continual fusion and fission. Damaged mitochondria can be eliminated through mitophagy and new mitochondria produced by asymmetric mitochondrial fission 19, 20. Hepatitis B and C virus have been reported to trigger mitochondrial fission and subsequent mitophagy to promote viral persistence 21, 22. Here, during our visualization of the direct contact between HIV-QD-MA viruses and mitochondria in live macrophages, we observed that HIV-1 could induce mitochondrial fission during the early entry phase. As shown in Figure 6a, around 2 h post-infection, a typical mitochondrion interacted with an HIV-QD-MA virion for approximately 2 min, and immediately thereafter underwent fission. The virion-induced morphological dynamics of mitochondrial fission were recorded in real time (Figure 6b, Movie S6). Around 20 s after interacting with the virion, thin and extended tubular intermediates connecting neighbor mitochondria prior to fission were observed. The thin tubular structures persisted for about 100 s, and then the mitochondria began to separate into two unequal parts (t = 120 s). In our experiment, the time course of virion-mitochondrial fission events typically occurred in about 111±43 s (Figure 6c). Statistical analysis showed that the lengths of 10


Page 10 of 40

Page 11 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

mitochondria in macrophages infected with HIV-QD-MA were significantly shorter than those of mock-infected macrophages (Figure 6d, e, f). Internalized free QDs had no effect on the length of macrophage mitochondria (Figure 6f, g). These results suggested that HIV-1 triggered macrophage mitochondrial fission.

Some HIV-1 virions internalize into macrophage mitochondria In our imaging experiments, we also observed that some HIV-QD-MA particles did not trigger mitochondrial fission, but were instead internalized into mitochondria. As shown in Figure 7, an HIV-QD-MA virion was internalized into a mitochondrion and subsequently colocalized and moved synergistically with the mitochondrion (Figure 7a, b) (Movie S7). The trajectories of the virion and the mitochondria are presented in Figure 7c. We also assessed variation in the velocities of the virion and the mitochondrion (Figure 7d); both the trajectory and velocity data indicated that HIV-QD-MA colocalized and moved along with the mitochondrion. The number of viral particles that colocalized with mitochondria increased as time after infection elapsed (Figure 7e). In our experiments, dual labeled HIV-QD-mCherry particles were also observed to be internalized into mitochondria. (Figure 7f, g, h) (Movie S8). The trajectory and velocity analyses of the dual-labeled particles and mitochondria are presented in Figure 7h, i. Together, these data suggested that some HIV-1 virions were internalized into mitochondria within macrophages. Virus detection was also carried out in the isolated cell-free mitochondria, and the result verified the virus internalization into mitochondria in HIV-1 infected cells (Figure S2).

Live cell imaging provides direct and real time information about viral life cycles and virus– 11


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

host interactions. Virus-labeling technology forms the basis for virus imaging in live cells and can help uncover mechanisms of viral infection under physiological conditions. Here, we constructed infectious HIV-1 virions encapsulating QDs through site-specific decoration of the viral MA protein; the MA protein was specifically biotinylated by inserting a BAP tag within its flexible Cterminus. Co-expression of the modified pAD8 with BirA allowed specific attachment of biotin to the BAP tag and subsequent interaction with SA-QDs. Gag-conjugated QDs were assembled into immature HIV-1 virus particles, and then the virus underwent protease-mediated maturation at or shortly following viral budding. Our successful construction of HIV-QD-MA demonstrates that QD nanoparticles can be incorporated into HIV matrix layer, and provide a kind of new fluorescently labeled virus which is different from those encapsulating QDs in capsid or labeled with other fluorescent molecules. And because of their localization inside envelope, encapsulating MA-conjugated QDs may have less impact on receptor–virus interactions than labeling viral envelopes with QDs. HIV-1 virions encapsulating QDs were used to track the stages of virus entry as well as viral interplay with mitochondria in primary macrophages at a single-particle level. About 54.4% of viral particles were actively endocytosed into primary macrophages, while 45.6% of virions maintained a relatively constant velocity and remained confined outside the cell membrane throughout the observation period. In the cytoplasm, approximately half of the HIV-QD-MA particles moved in a directional manner towards the perinuclear area. It is possible that these viruses traveled in a directional manner suggestive of active transport to a specific site in target cells where uncoating occurs. We also found that single HIV-QD-MA particles moved at various speeds when travelling, which may indicate that their movement is affected by interactions with 12


Page 12 of 40

Page 13 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

cellular components. When virions encapsulating QDs-conjugated MA were further labeled with Vpr-mCherry, the resulting dual-fluorescent HIV particles were tracked to study MA dissociation events. We observed three types of dynamic relations between MA-QD and mCherry-Vpr. The first was MA-QD dissociation from the mCherry-Vpr labeled viral core. The second was consistent MA-QD colocalization with the mCherry-Vpr labeled viral core in the cytoplasm. The third was separation of the MA-QD signal into two parts, with one part left from the mCherry-Vpr labeled viral core and another part associated with mCherry-Vpr throughout tracking in the cytoplasm. Our observations clearly display these three typical dynamic behaviors for HIV MA at single molecular level in real time. These dynamic behaviors should represent multiple functions for MA protein during virus entry. The MA protein, as the major component of the viral matrix, is mainly located inside the HIV-1 envelope lipid bilayer, and must be dissociated from the virus during uncoating. The dissociation of MA-QD from mCherry-Vpr might represent part of the uncoating process. MA was also reported to take part in nuclear import of the HIV-1 pre-integration complex 23,

which agrees with our observations that (i) some MA remained associated with the viral core

during trafficking throughout the cytoplasm, and (ii) nuclear localization of MA and Vpr was detected during infection. Of course, some degree of colocalization of MA-QD with mCherry-Vpr might derive from degradation of nonproductive viruses, a possibility which needs to be further clarified. To image the dynamic relations between MA and viral core, labeling MA and viral core with two different QDs might be attractive to perform dual-color imaging. However, it is still difficult to realize this dual-color QD labeling in a same virion particle. In future, more QD-protein conjugation strategies need to be developed to label different components in a labeling 13


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

system. We also imaged the interaction between HIV-1 virions and mitochondria in live macrophages during the early entry phases of infection. Mitochondria play important roles in the early stages of HIV-1 infection, possibly by interacting with viral complexes 17. It was also reported that HIV-1 can trigger mitochondrion death and regulate cellular apoptosis in CD4+ T cells through a caspase-independent mitochondrial pathway 24. Larrosa et al. found that in persistently-infected monocytic cells, apoptosis-resistant HIV-1 could modulate the mitochondrial apoptosis pathway before or during mitochondrial pore induction 25. Here, we observed the dynamic interplay of HIV-QD-MA with mitochondria in macrophages. To our knowledge, this is the first time that the dynamic process that a single HIV particle triggers mitochondrial fission was observed in real time. Mitochondrial length in HIV-1 infected macrophages was significantly shorter than that in mock-infected macrophages. It has been reported that hepatitis B and C virus induce mitochondrial fission and mitophagy to attenuate apoptosis and promote viral persistence 21, 22. Here, our finding of HIV-1-induced mitochondrial fission may also represent a strategy for attenuating macrophage apoptosis to promote viral persistence, a possibility which requires further study. An envelope glycoprotein dependent mechanism may contribute to HIV-1 induced mitochondrial fission. It is known that the viral envelope protein induces the release of macrophage colony-stimulating factor which can upregulate the expression of myeloid cell leukemia-1 (Mcl-1) 26. Mcl-1 induces the mitochondrial translocation of dynamin-related protein-1 (Drp-1), which may lead to mitochondria fission 21, 27. The detailed molecular mechanism of HIV-1 induced mitochondrial fission needs to be further clarified. We also observed that some viral particles were internalized into mitochondria and moved synergistically 14


Page 14 of 40

Page 15 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

with mitochondria. It has been reported that infectious mitochondria can be isolated from HIV-1 infected cells 28. Here, the internalization of HIV-1 into mitochondrion provides further evidence that the mitochondrion may be involved in HIV infection and transmission.

In conclusion, we constructed a new type of QD-encapsulated HIV-1 virion by site-specifically labeling the MA protein. Using QD-encapsulated virus particles, we clearly showed viral entry, the dissociation of MA and viral core, and virus interplay with mitochondria in human primary macrophages at a single-particle level. These data, including descriptions of viral endocytosis during entry, the multiple dynamics of MA, virus-induced mitochondrial fission, and viral complex internalization into mitochondria, serve to improve our understanding of HIV-1 entry and infection in primary macrophages.

Plasmids The macrophage-tropic HIV-1 infectious proviral plasmid pAD8 (R5 tropic subtype B; pAD8) was kindly provided by Prof. Yuntao Wu (Department of Molecular and Microbiology, George Mason University, Manassas, VA, USA). The vector pAD8-MA-BAP was constructed to express the chimeric Gag-BAP protein. To construct pAD8-MA-BAP, 15 residues encoding BAP and flanking (GGGG) linkers on both sides were inserted into the Gag ORF by overlap PCR between Gln127 and Val128 of MA. The fragment of HIV-1 pAD8 (711 bp – 1512 bp), bearing unique BssHII and SpeI restriction sites, was exchanged with the new sequence. The sequence of forward primer 1 was 5'-CGCGCACGGCAAGAGGCG-3', and that of reverse primer 1 was 5'-GATTTTCTGAGCTTCGAAGATATCGTTCAGACCTCCGCCTCCGCCCTGGCTGCTTTT TTCTGC-3'. The sequence of forward primer 2 was 15


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

5'-ATCTTCGAAGCTCAGAAAATCGAATGGCACGAAGGCGGAGGCGGAGTCAGCCAAA ATTAC-3', and that of reverse primer 2 was 5'-CGTGCCATTCGATTTTCTGAGCTTCGAAGATATCGTTCAGACCTCCGCCTCCGCCTA TCTTGTCTAAAGCTTC-3'. The pcDNA3.1(+)-BirA and pmCherry-Vpr vectors were preserved by our lab 12.

Reagents and cells Qdot® 625 streptavidin conjugate (SA-QDs), Vybrant® DiO, and MitoTracker® Green were purchased from Invitrogen. Biotin was purchased from Sigma-Aldrich. The monoclonal antibody against HIV-1 p24 was purchased from Abcam. Alexa Fluor® 488-labeled goat anti-mouse IgG antibody was purchased from Cell Signaling Technology. Human macrophage colony-stimulating factor (hM-CSF) and horseradish peroxidase-conjugated anti-chicken IgG were purchased from Cell Signaling Technology. 293T cells and TZM-bl cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) containing 10% (v/v) fetal bovine serum (FBS) under a 5% CO2 atmosphere at 37 °C.

Macrophage differentiation Peripheral blood mononuclear cells (PBMCs) were obtained in a biosafety level 3 laboratory at Wuhan University from healthy HIV-1-seronegative donors. PBMCs (5×105/well) were seeded onto 35-mm coverglass-bottomed dishes, allowed to adhere to the surface for 2 h, and then stimulated with 10 ng/mL of hM-CSF to differentiate them into primary macrophages over a period of 7 days. 16


Page 16 of 40

Page 17 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Structural modelling of Pr55GAG and MA-BAP The 3D models of Pr55GAG-BAP and MA-BAP were constructed using the de novo method in Rosetta 3.5. Manual model building was performed with Coot, and the quality of the modeled 3D structures was checked using MolProbity.

Western blotting To verify the specific biotinylation of HIV-1 MA-BAP, HIV-QD-MA-producing 293T cells were subjected to western blot analysis. Cells were lysed in cell lysis buffer for western and IP (Beyotime) containing 1 mM phenylmethanesulfonyl fluoride (PMSF, Beyotime), and a complete mini protease inhibitor cocktail (Roche). The lysate was cleared by centrifugation at 10,000×g for 10 min, mixed with SDS sample loading buffer (Beyotime), heated at 95 °C for 5 min, resolved by 12 % SDS-PAGE, and transferred onto a polyvinylidene difluoride membrane. After blocking at 4 °C overnight with phosphate-buffered saline (PBS) supplemented with 5% (w/v) skim milk, the membrane was incubated with horseradish peroxidase-conjugated anti-chicken IgG in PBS supplemented with 1% skim milk (diluted 1:1,000) at 37 °C for 2 h. After three washes with PBS containing 0.1% Tween-20, the membrane was developed with a chemiluminescent substrate (Biorad). After blocking at 4 °C overnight with PBS containing 5% (w/v) bull serum albumin (BSA), the membrane was incubated with streptavidin-conjugated rabbit polyclonal antibodies in PBS containing 1% BSA (diluted 1:1,000) at 37 °C for 2 h. The membrane was developed with a chemiluminescent substrate.

17


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Preparation of HIV-QD-MA AD8, HIV-QD-MA-DiO and HIV-QD-mCherry To produce HIV-QD-MA AD8 virus particles, 11.0 μg of pAD8, 2.5 μg of pAD8-MA-BAP and 11.0 μg of pcDNA3.1(+)-BirA plasmids were co-transfected into 100-mm plates of 293T cells. 50 μM biotin was added to the cells culture medium (DMEM containing 10% FBS) 4 to 6 h after transfection. Following 6 h further incubation, cells were washed three times with PBS and 1 μL of SA-QDs and 20 μL of Lipofectamine 2000 were added. 48 h post-transfection, virus samples were collected. Cellular debris was removed by low-speed centrifugation, and the sample was filtered through a 0.45-μm filter. To remove free QDs in the virus sample, equal volumes of specimen and 20% (w/v) polyethylene glycol (PEG)-20000 solution in saline were mixed and incubated at 4 °C for 16 h. The samples were centrifuged at 17,860×g for 20 min to collect the pelleted viruses 29. The pellet was resuspended in 1 mL of PBS and passed through an 80-nm filter 30.

To generate HIV-QD-MA-DiO AD8 dual-labeled virus, virions collected 48 h post-transfection

were cleared by low-speed centrifugation, passed through a 0.45-μm filter, and the viral envelopes of the resulting virions were stained with Vybrant® DiO for 2 h at 22 °C 1. To remove free DiO dye in the viral supernatant, equal volumes of specimen and 20% PEG-20000 solution in saline were mixed and incubated at 4 °C for 16 h. The samples were centrifuged at 17,860g for 20 min to collect the pelleted viruses. The pellets were passed through 80-nm filters as above. Purified HIV-QD-MA-DiO AD8 was resuspended in OPTI-MEM and stored at 4 °C. HIV-QD-mCherry was prepared by co-transfecting 10.0 μg of pAD8, 2.5 μg of pAD8-MA-BAP, 10.0 μg of pcDNA3.1(+)-BirA and 2 μg of pmCherry-Vpr plasmids. Qdot ® 705 was used in HIV-QD-mCherry preparation. To produce wild-type HIV-1 AD8, 100-mm plates of 293T virus-producing cells were 18


Page 18 of 40

Page 19 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

transfected with 25 μg of pAD8 using Lipofectamine 2000. Virus particles were collected 48 h post-transfection and passed through a 0.45-μm filter and stored at 4 °C. The virus preparation experiments were performed in BSL-2 or BSL-3 laboratories. Transmission electron microscopy The morphology of HIV-QD-MA-DiO virions and unlabeled HIV-1 AD8 virions was analyzed by TEM. The collected viruses were adsorbed onto carbon-coated copper grids and quickly negatively stained with 2% phosphotungstic acid, pH 7.0, before observation on a HITACHI-7000FA transmission electron microscope. HIV-QD-MA-DiO virions within cells were also analyzed by TEM ultrathin sections. Briefly, 293T cells producing HIV-QD-MA-DiO AD8 virions were fixed with 2.5% glutaraldehyde in 0.1 M PBS, pH 7.0, containing 250 mM sucrose, overnight. After being fixed, cells were washed with PBS, pH 7.0, containing 250 mM sucrose, and post-fixed using 1% osmium tetroxide in 0.1 M PBS, pH 7.0, for 1 h. Specimens were then dehydrated in a series of graded alcohol solutions. The dehydrated specimens were embedded in araldite, and polymerized for 24 h. Ultrathin sections of approximately 100 nm were cut with an ultramicrotome and picked on copper grids. The samples were observed using a HITACHI-7000FA transmission electron microscope.

Viral infectivity assay TZM-bl cells (1×104; HeLa-derived indicator TZM-bl cells expressing CD4, CXCR4, and CCR5), were cultured in 96-well plates for 24 h before infection and then infected with virions (dose equivalent to 100 ng of p24) in the presence of 15 μg/mL of DEAD dextran. Viral p24 was quantitated using an ELISA kit (provided by MAb Lab of Wuhan institute of virology, Chinese 19


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

academy of sciences or purchased from Mlbio (Cat No. ml060201) ) . HIV-1 titers were measured by end-point dilution 48 h after infection using the firefly luciferase reporter gene assay kit (Beyotime) according to the manufacturer’s instructions. TCID50 values were calculated by the Reed-Muench method 31-33. A cut-off value of 2.5-fold background relative luciferase unit was used to determine positive samples.

Fluorescence imaging For live-cell imaging experiments, samples were prepared and then sealed with parafilm. After imaging, samples were inactivated. The HIV-QD-MA virions or HIV-QD-MA-DiO dual-labeled virions were plated on 35-mm coverglass-bottom dishes and then analyzed by immunofluorescence or colocalization imaging. Briefly, virions were washed with PBS, pH 7.4, fixed with freshly prepared 4% paraformaldehyde at room temperature for 15 min, and permeabilized with 0.1% Triton X-100 for 15 min. To prevent nonspecific staining, the virions were washed with PBS, incubated in blocking buffer (10% FBS), and then incubated with mouse monoclonal antibody against HIV-1 p24 and the secondary antibodies (Alexa Fluor® 488-conjugated rabbit anti-mouse IgG). Viral fluorescence was monitored with an UltraVIEW VOX confocal system (PerkinElmer, Co.) using a 60×, 1.4 NA oil immersion objective lens. Viral fluorescence colocalization was analyzed by Volocity. For HIV-1 imaging in live macrophages, 103–103.5 TCID50 units were used to infect 1×105 cells unless otherwise specified. Viruses and cells were incubated for 30 min at 4 °C to allow virus adsorption and then moved into the cell culture chamber (Tokai Hit, 37 °C, 5% CO2) on the microscope. Imaging was performed with the UltraView Vox spinning disk confocal laser scanning system (PerkinElmer, Co.) using a Nikon 20


Page 20 of 40

Page 21 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Ti-e microscope with a 60× objective lens. Qdot® 625 was excited with a 561-nm laser and detected with a 615-nm (W70) emission wheel. Vybrant® DIO, MitoTracker® Green FM, and Alexa Fluor® 488 were excited with a 488-nm laser and detected with a 525-nm (W50) emission wheel. Giving overall consideration to viral dynamics tracking and the phototoxicity on human primary macrophages, after optimization, live cell imaging was performed at 6 or 10 s intervals for a duration of 30–60 min. To acquire the virions trajectories, the centroid of each object is identified and connected by line between time points, and the velocity was calculated by the velocity-position relation within the recorded time course by Volocity software. To avoid the “misconnection” or crosstalk from bulk fluorescent signals, we detected signals in cells that only several HIV-1-QD particles were internalized in one cell. The average number of virion was 3-6 per cell during entry tracking. The imaging data were analyzed with Volocity software. Mitochondria length was quantitatively analyzed using Image J software.

Mitochondria isolation and virus detection in the isolated mitochondria Mitochondrial fractions of HIV-1-infected cells were isolated using a Qproteome™ Mitochondria Isolation kit (Qiagen) according to its protocol 34. The pellet of isolated mitochondria were resuspended in 2 mL RPMI 1640 medium supplemented with 10% heat-inactivated FBS. Then, resuspended mitochondria were tested for p24 or infectivity by a luciferase reporter assay in TZM-bl indicator cells.

Statistical analysis All results were expressed as means ± standard deviations (SDs). The statistical significance 21


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

of differences between groups was analyzed by t-tests or one-way analysis of variance (ANOVA) followed by the Student-Newman-Keuls test.

22


Page 22 of 40

Page 23 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Figure 1. Insertion of a BAP tag into the HIV-1 Gag protein. (a) The coding sequence of the BAP tag, flanked by a Gly4 linker on both sides, was inserted into the Gag ORF as indicated, resulting in the introduction of 15 additional residues between MA Gln127 and Val128. (b) Structures of Pr55Gag (PDB ID: 1L6N) and Pr55Gag-BAP. The MA domain N-terminal to Pr55Gag Gln127 (green) and other (blue) were connected with a BAP tag (red). (c) Biotinylation of PrGagp55 and MA proteins in HIV-QD-MA-producing 293T cells. (d) Schematic strategy for 23


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

encapsulating Gag-conjugated QDs within HIV-1 particles. The PrGagp55-BAP chimeric protein is expressed during virus production. Then, the Pr55Gag-BAP is specifically modified by addition of a biotin moiety catalyzed by BirA. The biotinylated Pr55Gag-BAP subsequently binds to SA-QDs. Finally, PrGagp55-conjugated QDs are incorporated into new virions during viral assembly, and HIV-1 particles encapsulating QDs are produced through virus budding.

24


Page 24 of 40

Page 25 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Figure 2. Construction and characterization of HIV-QD-MA. (a) TEM images of SA-QDs. (b) Unlabeled wild-type HIV-1 particles. (c) A representative HIV-1 particle encapsulating a single QD. (d) A representative HIV-1 particle encapsulating a pair of QDs. Arrowheads: QDs. Scale bars: 50 nm. (e) A TEM image of an ultrathin section of HIV-QD-MA virus-producing cells 48 h 25


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

post-transfection. Scale bar: 500 nm. Right panel shows an enlarged image of the rectangular region in (e). (f) Infectivity assay of HIV-QD-MA. ns: no significant difference. (g) Fluorescent characterization of HIV-QD-MA. HIV-QD-MA particles were immunostained with anti-p24 antibody (upper panel) or with DiO (lower panel). (h) Viral particles without chimeric MA-BAP proteins immunostained with anti-p24 antibody. Scale bar: 1 μm.

26


Page 26 of 40

Page 27 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Figure 3. Single-particle tracking of HIV-QD-MA in macrophages. (a) Two representative HIV-QD-MA virion trajectories in a single macrophage are numbered i (internalized) and ii (non– internalized). The cellular boundary of the macrophage is highlighted by a dashed line. Scale bar: 5 μm. (b) Sequential images of the internalized (i) and non–internalized (ii) virions. The relative positions of the two virions are marked with colorized circles. (c) Analysis of the mean velocities of the internalized (i) and non–internalized (ii) virions. (d) Analysis of MSD plots of the internalized (i) and non–internalized (ii) virions. (e) Distribution of the maximal velocities for 27


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

different HIV-QD-MA virions. (f) Comparison of the ratio of different relative velocities for HIV-QD-MA virion trajectories. (g) Comparison of the ratio of different relative movement directions for HIV-QD-MA virion trajectories.

28


Page 28 of 40

Page 29 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Figure 4. Dynamic separation of QD-MA from the mCherry-Vpr-labeled viral core during infection. (a) Fluorescent characterization of HIV-QD-mCherry virions. (b) A dual-labeled HIV-QD-mCherry particle is shown within the macrophage, scale bar: 10 μm. (c) Sequential images of the dual-labeled particles shown in the rectangular region of (b). (d) Dynamic trajectories of HIV-QD-MA particle (red) and mCherry labeled HIV-1 Vpr (green). Scale bar: 0.2 μm. (e) Analysis of the mean velocities of the viral particle shown in (b).

29


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. Tracking of an HIV-QD-mCherry virus showing that one part of QD-MA is left from the mCherry-Vpr labeled viral core, while another part of QD-MA is associated with 30


Page 30 of 40

Page 31 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

mCherry-Vpr and transported into the nucleus.

(a) A dual-labeled HIV-QD-mCherry

particle is shown within the macrophage, scale bar: 10 μm. (b) Dynamic trajectories of HIV-QD-MA particle (red) and mCherry labeled HIV-1 Vpr (green). Scale bar: 0.2 μm. (c) Sequential images of the dual-labeled particles shown in the rectangular region of (a). (d) Analysis of the mean velocities of the viral particle shown in (a). (e) Schematic presentation of the disassembly of HIV-QD-MA. The fluorescent signal of QD-MA is pseudocolored red, and the fluorescent signal of mCherry-Vpr is pseudocolored green. (f) Colocalization of QD-MA and mCherry-Vpr on the nuclear membrane 2 h post-infection. (g) Colocalization of QD-MA and mCherry-Vpr in the nucleus 4 h post-infection. Scale bar, 5 μ m.

31


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 40

Figure 6. Real-time imaging of an HIV-QD-MA particle triggering mitochondria fission in human primary macrophages. (a) An HIV-QD-MA particle within a MitoTracker® Green-stained macrophage (shown in the rectangular region) was tracked.

(b) Time-lapse

sequential images of the amplified rectangular region. (c) Statistical analysis of the time course of HIV-QD-MA-induced mitochondrial fission. (d) Fluorescence microscopy images showing mitochondrial fragmentation in HIV-1-infected macrophages. Right panel: enlarged image of the rectangular region. (e) Mitochondrial morphology in mock-infected macrophages. Right panel: 32


Page 33 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

enlarged image of the rectangular region. (f) Mitochondrial morphology of macrophages that have internalized QDs. Right panel: enlarged image of the rectangular region. (g) 12 h post-infection, macrophages prestained with MitoTracker® Green and the length of mitochondria was analyzed (**p < 0.01). Scale bar: 10 μm.

33


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 7. Dynamic colocalization of HIV-QD-MA or HIV-QD-mCherry with MitoTracker® Green-stained mitochondria. (a) An HIV-QD-MA particle (shown in the rectangular region) was tracked. Scale bar: 10 μm. (b) Time-lapse sequential images of the amplified rectangular region. Scale bar: 2 μm. (c) Dynamic trajectories of HIV-QD-MA (red) and the colocalized mitochondrion (green) for the virion shown in (a). Scale bar: 0.2 μm. (d) Velocities of the 34


Page 34 of 40

Page 35 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

colocalized HIV-QD-MA (red) and mitochondrion (green) shown in Figure 7 (a). (e) Statistical analysis of the percentage of HIV-QD-MA viral particles that colocalized with mitochondria. (f) A dual-labeled HIV-QD-mCherry particle (shown in the rectangular region) which colocalized with a mitochondrion was tracked. Scale bar: 10 μm. Right panel is the enlarged rectangular region of the left panel. (g) Time-lapse sequential images of the amplified rectangular region. Scale bar: 2 μm. (h) Dynamic trajectories of HIV-QD-mCherry and colocalized mitochondrion for the virion in (f). Scale bar: 0.2 μm. (i) Velocities of the colocalized HIV-QD-mCherry and mitochondrion shown in Figure 7 (f).

35


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

SUPPORTING INFORMATION The Supporting Information is available online. Figures S1, The dynamic interaction of HIV-QD-MA with mitochondria (Doc) Figure S2, Verification of HIV-1 internalization in mitochondria (Doc) Movie S1, Tracking of dynamic movements of two representative HIV-QD-MA particles on the macrophage (AVI) Movie S2, Real-time imaging of the viral MA separation from the viral core (AVI) Movie S3, Real-time imaging of multi-dynamic behaviors of MA protein (AVI) Movie S4, Particle (i) in Figure S1a dynamically association with macrophage mitochondria (AVI) Movie S5, Particle (ii) in Figure S1a dynamically association with macrophage mitochondria (AVI) Movie S6, Real-time imaging of virion-induced mitochondrial fission (AVI) Movie S7, An HIV-QD-MA virion being internalized into a mitochondrion moves synergistically with the mitochondrion (AVI) Movie S8, An HIV-QD-mCherry virion moves synergistically with the mitochondrion (AVI)

AUTHOR INFORMATION Corresponding Author * E-mail: [email protected], Telephone: +86 27 8719 9115. Author Contributions Z.Q.C. designed and supervised the research. Q.L. performed the experiments. W.Y. and W.L. participated in TEM and fluorescence imaging. X.W.Z., Z.P.Z., and X.E.Z. 36


Page 36 of 40

Page 37 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

contributed to data analysis. Z.Q.C. and Q.L. wrote the manuscript. All authors have given approval to the final version of the manuscript. Notes The authors declare no competing financial interest.

ACKNOWLEDGEMENTS We thank Ding Gao for his excellent technical support in electron microscopy and fluorescence microscopy analysis and Hao Tang for his excellent technical support in BSL-3 laboratory, the Core Facility and Technical Support, Wuhan Institute of Virology, Chineses Academy of Sciences; This work was supported by the National Key Research and Development Program of China (2018ZX10301405), the Strategic Priority Research Program of Chinese Academy of Sciences (No. XDPB29050000), the National Natural Science Foundation of China (No. 31470269, No. 21727816, and No. 31470837), and Youth Innovation Promotion Association of Chinese Academy of Sciences.

37


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

REFERENCES (1) Lakadamyali, M.; Rust, M. J.; Babcock, H. P.; Zhuang, X. Proc. Natl. Acad. Sci. U. S. A. 2003, 100, 9280-9285. (2) Brandenburg, B.; Zhuang, X. Nat. Rev. Microbiol. 2007, 5, 197-208. (3) Hubner, W.; Chen, P.; Del Portillo, A.; Liu, Y.; Gordon, R. E.; Chen, B. K. J. Virol. 2007, 81, 12596-12607. (4) Lampe, M.; Briggs, J. A.; Endress, T.; Glass, B.; Riegelsberger, S.; Krausslich, H. G.; Lamb, D. C.; Brauchle, C.; Muller, B. Virology 2007, 360, 92-104. (5) Michalet, X.; Pinaud, F. F.; Bentolila, L. A.; Tsay, J. M.; Doose, S.; Li, J. J.; Sundaresan, G.; Wu, A. M.; Gambhir, S. S.; Weiss, S. Science 2005, 307, 538-544. (6) Zheng, Z.; Wang, H. Nanomedicine 2013, 8, 1225-1227. (7) Kampani, K.; Quann, K.; Ahuja, J.; Wigdahl, B.; Khan, Z. K.; Jain, P. J. Virol. Methods 2007, 141, 125-132. (8) Herod, M. R.; Pineda, R. G.; Mautner, V.; Onion, D. Small 2015, 11, 797-803. (9) Zhang, Y.; Ke, X.; Zheng, Z.; Zhang, C.; Zhang, Z.; Zhang, F.; Hu, Q.; He, Z.; Wang, H. ACS Nano 2013, 7, 3896-3904. (10) Li, F.; Zhang, Z. P.; Peng, J.; Cui, Z. Q.; Pang, D. W.; Li, K.; Wei, H. P.; Zhou, Y. F.; Wen, J. K.; Zhang, X. E. Small 2009, 5, 718-726. (11) Wen, L.; Lin, Y.; Zheng, Z. H.; Zhang, Z. L.; Zhang, L. J.; Wang, L. Y.; Wang, H. Z.; Pang, D. W. Biomaterials 2014, 35, 2295-2301. (12) Li, Q.; Li, W.; Yin, W.; Guo, J.; Zhang, Z. P.; Zeng, D.; Zhang, X.; Wu, Y.; Zhang, X. E.; Cui, Z. ACS Nano 2017, 11, 3890-3903. (13) Wilk, T.; Gross, I.; Gowen, B. E.; Rutten, T.; de Haas, F.; Welker, R.; Krausslich, H. G.; Boulanger, P.; Fuller, S. D. J. Virol. 2001, 75, 759-771. (14) Muller, B.; Daecke, J.; Fackler, O. T.; Dittmar, M. T.; Zentgraf, H.; Krausslich, H. G. J. Virol. 2004, 78, 10803-10813. (15) Welker, R.; Hohenberg, H.; Tessmer, U.; Huckhagel, C.; Krausslich, H. G. J. Virol. 2000, 74, 1168-1177. (16) Paxton, W.; Connor, R. I.; Landau, N. R. J. Virol. 1993, 67, 7229-7237. (17) Lu, G.; Matsuura, S. E.; Barrientos, A.; Scott, W. A. PLoS One 2013, 8, e78035. (18) Corbeil, J.; Sheeter, D.; Genini, D.; Rought, S.; Leoni, L.; Du, P.; Ferguson, M.; Masys, D. R.; Welsh, J. B.; Fink, J. L.; Sasik, R.; Huang, D.; Drenkow, J.; Richman, D. D.; Gingeras, T. Genome Res. 2001, 11, 1198-1204. (19) Schafer, A.; Reichert, A. S. Biol. Chem. 2009, 390, 707-715. (20) Ashrafi, G.; Schwarz, T. L. Cell Death Differ. 2013, 20, 31-42. (21) Kim, S. J.; Khan, M.; Quan, J.; Till, A.; Subramani, S.; Siddiqui, A. PLoS Pathog. 2013, 9, e1003722. (22) Kim, S. J.; Syed, G. H.; Khan, M.; Chiu, W. W.; Sohail, M. A.; Gish, R. G.; Siddiqui, A. Proc. Natl. Acad. Sci. U. S. A. 2014, 111, 6413-6418. (23) Haffar, O. K.; Popov, S.; Dubrovsky, L.; Agostini, I.; Tang, H.; Pushkarsky, T.; Nadler, S. G.; Bukrinsky, M. J. Mol. Biol. 2000, 299, 359-368. (24) Roumier, T.; Vieira, H. L.; Castedo, M.; Ferri, K. F.; Boya, P.; Andreau, K.; Druillennec, S.; Joza, N.; Penninger, J. M.; Roques, B.; Kroemer, G. Cell Death 38


Page 38 of 40

Page 39 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Differ. 2002, 9, 1212-1219. (25) Fernandez Larrosa, P. N.; Croci, D. O.; Riva, D. A.; Bibini, M.; Luzzi, R.; Saracco, M.; Mersich, S. E.; Rabinovich, G. A.; Martinez Peralta, L. Retrovirology 2008, 5, 19. (26) Swingler, S.; Mann, A. M.; Zhou, J.; Swingler, C.; Stevenson, M. PLoS Pathog. 2007, 3, 1281-1290. (27) Autret, A.; Martin, S. J. Cell. Mol. Life Sci. 2010, 67, 1599-1606. (28) Lee-Huang, S.; Lin Huang, P.; Lee Huang, P. Biochem. Biophys. Res. Commun. 2011, 415, 384-389. (29) Kohno, T.; Mohan, S.; Goto, T.; Morita, C.; Nakano, T.; Hong, W.; Sangco, J. C.; Morimatsu, S.; Sano, K. J. Virol. Methods 2002, 106, 167-173. (30) Andrawiss, M.; Takeuchi, Y.; Hewlett, L.; Collins, M. J. Virol. 2003, 77, 11651-11660. (31) Wei, X.; Decker, J. M.; Wang, S.; Hui, H.; Kappes, J. C.; Wu, X.; Salazar-Gonzalez, J. F.; Salazar, M. G.; Kilby, J. M.; Saag, M. S. Nature 2003, 422, 307-312. (32) Todd, C. A.; Greene, K. M.; Yu, X.; Ozaki, D. A.; Gao, H.; Huang, Y.; Wang, M.; Li, G.; Brown, R.; Wood, B.; D'Souza, M. P.; Gilbert, P.; Montefiori, D. C.; Sarzotti-Kelsoe, M. J. Immunol. Methods 2012, 375, 57-67. (33) Montefiori, D. C. Methods Mol. Biol. 2009, 485, 395-405. (34) Kim, Y.; Kim, H. D.; Kim, J. Biochim. Biophys. Acta 2013, 1833, 2943-2952.

39


Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

72x35mm (600 x 600 DPI)


Page 40 of 40

Encapsulating quantum dots within HIV-1 virions through site-specific

Recommend Documents