Letters pubs.acs.org/acschemicalbiology
Engineering High Affinity Protein−Protein Interactions Using a HighThroughput Microcapillary Array Platform Sungwon Lim,†,⊥ Bob Chen,†,⊥ Mihalis S. Kariolis,† Ivan K. Dimov,‡ Thomas M. Baer,§ and Jennifer R. Cochran*,†,∥ †
Department of Bioengineering, ‡Institute for Stem Cell Biology and Regenerative Medicine, §Stanford Photonics Research Center, Chemical Engineering, Stanford University, 450 Serra Mall, Stanford, California 94305, United States
∥
S Supporting Information *
ABSTRACT: Affinity maturation of protein−protein interactions requires iterative rounds of protein library generation and high-throughput screening to identify variants that bind with increased affinity to a target of interest. We recently developed a multipurpose protein engineering platform, termed μSCALE (Microcapillary Single Cell Analysis and Laser Extraction). This technology enables high-throughput screening of libraries of millions of cell-expressing protein variants based on their binding properties or functional activity. Here, we demonstrate the first use of the μSCALE platform for affinity maturation of a protein−protein binding interaction. In this proof-of-concept study, we engineered an extracellular domain of the Axl receptor tyrosine kinase to bind tighter to its ligand Gas6. Within 2 weeks, two iterative rounds of library generation and screening resulted in engineered Axl variants with a 50-fold decrease in kinetic dissociation rate, highlighting the use of μSCALE as a new tool for directed evolution.
C
Fluorescence-based library screening methods are powerful as they enable direct quantification of the desired binding interaction and normalization of protein expression levels with equilibrium and kinetic binding parameters.18 As a compliment to FACS, we recently developed a multipurpose, highthroughput platform capable of screening millions of protein variants based on their binding properties or functional activity.19 This platform, termed μSCALE (Microcapillary Single Cell Analysis and Laser Extraction), sequesters millions of cells within a dense array of microcapillaries, images them via fluorescence microscopy, and uses a precise laser-based method to recover desired cells from microcapillaries of interest. Our initial study demonstrated the use of μSCALE to perform three distinct protein engineering applications: isolation of a protein ̈ antibody fragment library, creation of a binder from a naive fluorescent protein biosensor, and identification of an improved enzyme variant. These diverse examples each highlight a key feature of the μSCALE platform to enable rapid identification of improved protein variants from highly stringent library screening conditions. While the ability to isolate rare clones is beneficial when ̈ library for novel protein binders, the potential screening a naive advantages of this platform are magnified in the affinity maturation process, where successive protein libraries are generated and screened to isolate variants with increased target binding affinity. Here, we demonstrate the first use of the μSCALE platform for affinity maturation of a protein−protein
ombinatorial protein engineering methods have been used to generate high affinity molecules that can modulate ligand−receptor interactions, 1 label abnormal cells,2,3 and prevent undesired protein cleavage.4 Researchers achieve this goal of “affinity maturation” by generating libraries of millions of protein variants including antibodies,5,6 ligands,7 receptors,8,9 or other scaffolds10,11 and screening them in a high-throughput manner to identify proteins with improved binding against a target of interest.12 Protein libraries for affinity maturation are constructed by random or targeted mutagenesis of a gene encoding for the protein to be engineered.13 The corresponding protein variants are expressed as fusions to a cell, virus, or transcription/ translation machinery14 and then screened with either panning or fluorescence-activated cell sorting (FACS). Panning consists of exposing a protein library to an immobilized binding target of interest, washing away the nonbinding library members, and collecting the binders. Alternatively, FACS is used to screen protein libraries displayed on the surface of yeast, bacteria, or mammalian cells.15,16 With this method, researchers label a cellsurface-displayed protein library with a fluorescently labeled binding target and use flow cytometry to sort the binding members based on their fluorescence intensity. The inherent lack of precision that accompanies sorting methods involving panning or high speed fluidics mandates iterative screening of a single library pool to enrich for the most desired protein variants.17 During each sort round, binding stringency is imposed with methods that allow differentiation of protein variants based on their kinetic and equilibrium binding constants, such as increased sample washing or incubation of the library with reduced concentration of binding target. © XXXX American Chemical Society
Received: September 12, 2016 Accepted: December 5, 2016
A
DOI: 10.1021/acschembio.6b00794 ACS Chem. Biol. XXXX, XXX, XXX−XXX
Letters
ACS Chemical Biology
Figure 1. μSCALE platform overview for screening protein libraries for improved binding interactions. Two rounds of library generation and μSCALE screening were performed. In each round, the induced yeast-displayed Axl Ig1 proteins were incubated with the binding target, Gas6, and stained with fluorescently labeled antibodies for the detection of Gas6 and a c-Myc epitope tag to quantify Axl expression levels. The stained yeast was mixed with opaque microbeads and then loaded into the microcapillary array. After the cells were imaged and quantified in the array, desired cells were recovered via laser extraction of individual microcapillaries, propagated, and sequenced.
Figure 2. μSCALE affinity maturation of Axl Ig1 against Gas6. (a) In round 1 (left), the error-prone PCR library was screened, and 30 microcapillaries were extracted. In round 2 (right), the StEP-shuffled library was screened, and 40 microcapillaries were extracted. Red circles indicate extracted capillaries. (b) μSCALE, in concert with MACS, enables two rounds of yeast library creation and screening to be performed within 2 weeks.
binding interaction. In this work, we evolved a fragment of the extracellular domain of the Axl receptor tyrosine kinase to bind tighter to its ligand, growth arrest specific 6 (Gas6). Signaling through the Gas6/Axl regulates immune function, blood coagulation, and tumor cell invasion and migration.20,21 We chose Gas6/Axl as a model system for this study as we previously used standard protein engineering screening methods (i.e., yeast cell surface display and FACS) to isolate high-affinity Axl variants that functioned as effective inhibitors of tumor metastases.9
Our protein engineering strategy included two iterative rounds of library generation and screening: an initial library of randomly generated Axl mutations and a second library of recombined Axl mutations derived from the variants recovered from the first library. We detail the general workflow of the μSCALE platform in Figure 1. Briefly, we incubate a library of yeast, each displaying a unique Axl variant on their surface, with Gas6 ligand and an antibody against a C-terminal c-Myc epitope tag (to quantify Axl expression levels on individual yeast). The library is subsequently stained with fluorescently labeled secondary antibodies for detection. We then mix the B
DOI: 10.1021/acschembio.6b00794 ACS Chem. Biol. XXXX, XXX, XXX−XXX
Letters
ACS Chemical Biology
recombination through a staggered extension process (StEP). We used StEP, as the recombination efficiency is comparable to DNA shuffling but does not require DNA fragmentation and can be carried out it a single tube.24 Due to limited enrichment of high affinity binders using equilibrium-based sorts,16,25 we screened this second library using a kinetic off-rate sort to isolate Axl variants that remained bound to Gas6 after an extended dissociation period. This kinetic off-rate screen was accomplished by incubating the yeast-displayed Axl Ig1 library with saturating levels of Gas6, washing to remove the unbound ligand, and allowing dissociation in the presence of excess wildtype Axl Ig1-Fc competitor9 for 24 h prior to antibody staining. We extracted 40 individual microcapillaries exhibiting the highest Gas6 binding relative to Axl expression levels and propagated the contents of each microcapillary separately (Figure 2a, right). After sequencing of the plasmid DNA from the extracted yeast clones, we observed strong consensus mutations, in particular A72V, D87G, V92A, and V126I mutations (Table 1 and Supporting Information Table 2). In
labeled yeast cells with opaque microbeads and load them into the microcapillary array by pipetting. The cells randomly distribute into the microcapillaries according to Poisson statistics19 and are contained within the array by liquid held in place by surface tension. The microcapillaries are imaged by fluorescence microscopy, and signal intensity is subsequently quantified with a throughput of approximately 4500 microcapillaries per second for a 20 μm array. Yeast cells displaying Axl variants with the highest level of Gas6 binding (normalized for Axl expression levels) are identified and recovered from individual microcapillaries using a laser-based extraction method. In this process, the opaque microbeads absorb energy from a UV laser pulse, which disrupts the microcapillary meniscus and empties the contents onto a capture surface. The recovered cells are then cultured and lysed to recover genetic material for sequencing. For the first round of screening we used an existing library previously created by error-prone PCR, which introduced random mutations into the gene encoding the first immunoglobulin-like domain (Ig1) of Axl.9 The resulting variants were displayed on the cell surface as fusion to the yeast agglutinin mating proteins.22 The library contained ∼7.4 × 107 yeast transformants, as estimated by dilution plating and colony counting. One round of magnetic-activated cell sorting (MACS)23 was first performed using Gas6-coated magnetic beads, which cleared the library of nonbinders or weak binders to Gas6 and reduced the theoretical library size to 3.5 × 106 clones (Supporting Information Figure 1). The recovered pool of yeast was cultured, induced for Axl Ig1 expression, and prepared for μSCALE screening by incubating with 100 pM Gas6 for 15 h to reach binding equilibrium, followed by staining with fluorescently labeled antibodies to quantify Gas6 binding and c-Myc epitope tag expression levels. The library was loaded into the microcapillary array, yielding an average of 1.6 cells per 20 μm diameter capillary (Supporting Information Figure 2). After loading, the microcapillary array was imaged by epifluorescence in two spectral channels (Supporting Information Figure 3). Images were quantified using standard MATLAB image processing functions to generate plots of the fluorescence intensities (Supporting Information Figure 4 and Figure 2a, left). The spatial segregation of the microcapillaries allowed cell analysis and sorting to be decoupled, which enabled us to analyze the Axl expression levels and Gas6 binding properties of the entire library population prior to identifying the most desired microcapillaries for extraction. Additionally, the spatial segregation and direct imaging of individual microcapillaries allowed us to differentiate between fluorescent debris and cells, reducing false positives (Supporting Information Figure 5). To enrich for Gas6 binders, we individually extracted 30 microcapillaries containing yeast with the highest levels of Gas6 binding relative to Axl expression levels and propagated the contents of each microcapillary separately. When the plasmid DNA from these yeast clones was sequenced, some mutational consensus was observed, notably, the mutations D87G and V92A (Supporting Information Table 1). Importantly, these two mutations were identified as the critical drivers of improved binding affinity in previously characterized Axl Ig1 variants.9 These results demonstrate that similar key mutations can be isolated from a library screened by μSCALE or FACS. To combine beneficial mutations and remove neutral or deleterious mutations, DNA isolated from the library clones was used as a template to generate a second library via
Table 1. Equilibrium Binding Constants and Kinetic Dissociation Rates of Axl Variants Isolated from the Second Round of Library Screening by μSCALEa residue no. WT Axl V2.1 V2.2 V2.3
72
87
92
126
A
D
V A A A
V
G V
I
Gas6 binding affinity
kinetic dissociation rates
Kd (pM)
koff (10−5 s−1)
630 150 140 140
± ± ± ±
150 8.3 7.9 2.4
36 1.4 1.3 0.68
± ± ± ±
4.3 0.15 0.31 0.31
a
Reported values represent Gas6 binding to yeast surface-displayed Axl proteins measured using flow cytometry.
addition to D87G and V92A, the point mutation A72V was also identified from the original error-prone PCR library when screened by FACS in our previous work9 and was found to be a key contributor to Gas6 binding, both alone and in combination with D87G and V92A, in a subsequent study.26 We next performed equilibrium and kinetic off-rate binding assays with individual yeast-displayed wild-type Axl and the Axl variants that appeared most frequently from μSCALE screening. The three Axl Ig1 variants tested demonstrate increased binding to Gas6 that appeared highly cooperative compared to wild-type Axl (Figure 3a and Table 1). The small magnitude differences observed between these equilibrium binding constants likely reflects a lower limit for accurately measuring ultrahigh binding affinities using yeast-surface display, namely time needed to reach equilibrium and ligand depletion effects.27 Indeed, the binding affinity of Gas6 to soluble wild-type Axl Ig1 was determined to be 33 ± 0.6 pM using the Kinetic Exclusion Assay (KinExA),9 which measures the amount of free ligand at equilibrium, compared to 630 ± 150 pM measured with yeast surface-displayed Axl in the current study. In contrast, measurements of kinetic dissociation rates are not subject to the same limitations. The off-rate of yeast-displayed wild-type Axl was determined to be (36 ± 4.3) × 10−5 s−1 (Figure 3b and Table 1), similar to the value measured by KinExA (70 ± 2) × 10−5 s−1.9 The three Axl variants exhibited up to a 50-fold slower kinetic dissociation rate compared to wild-type Axl (Figure 3b and Table 1), validating that μSCALE can be used to screen yeast-displayed libraries for protein variants with C
DOI: 10.1021/acschembio.6b00794 ACS Chem. Biol. XXXX, XXX, XXX−XXX
Letters
ACS Chemical Biology
Figure 3. Gas6 binding curves of yeast-displayed Axl Ig1 wild-type and variants identified by μSCALE. (a) Equilibrium binding curves. (b) Kinetic off-rate binding curves. Error bars correspond to the standard deviation of three independent measurements performed on different days. as previously described.19 In essence, the system is an inverted fluorescence microscope with a diode-pumped Q-switched Nd:YLF UV laser. The motorized fluorescence microscope was used to acquire all images with an ORCA-ER cooled CCD camera (Hamamatsu), and the UV laser was used to recover desired samples under previously described conditions.19 MATLAB was used to quantify fluorescence images after acquisition. As described in Supporting Information Figure 4, image segmentation via thresholding was performed with Otsu’s method, which segments the image into isolated pixel regions. The regions are filtered by size, roundness (eccentricity), and minimal fluorescence intensity with user defined parameters indicative of yeast cells. The filtered regions are applied to the raw images, and the fluorescence values of each region are quantified. These image analysis steps were performed with standard functions in the MATLAB Image Processing Toolbox. Microcapillary Array Preparation, Loading, and Extraction. Microcapillary arrays (20 μm diameter, 1-mm-thick; INCOM, Inc.) were sterilized in ethanol and treated using a corona wand (BD-20AC Electro-Technic Products) to generate a hydrophilic surface as previously described.19 First, the cell suspensions were mixed with opaque microbeads (Thermo Fisher Scientific, 37002D) to a final bead concentration of 10 mg mL−1. The arrays were then loaded using a concentration of 12 800 cells/μL. A 2 mm slab of 1% weight/volume agarose was placed on the array to help prevent evaporation. Using the UV laser, the desired microcapillaries were extracted onto a glass coverslip, which was inverted on top of agar plates containing yeast growth medium (SD-CAA) to propagate the extracted cells. Colonies were routinely observed within 2 days of extraction. Magnetic-Activated Cell Sorting. A yeast-displayed Axl Ig1 library we previously created by error-prone PCR9 was used for initial studies. One round of magnetic-activated cell sorting (MACS) was performed to isolate yeast-displayed Axl variants that bind Gas6-coated magnetic beads. Gas6-coated magnetic beads (8 mg) were prepared by incubating His-tag reactive Dynabeads (Thermo Fisher Scientific, 10103D) with a saturating amount of recombinant Gas6 containing a hexahistidine tag9 on a rotator for 10 min at 4 °C. The beads were washed using a magnetic holder (Dynal, MPC-S) with Binding/Wash Buffer (50 mM sodium phosphate [pH 8.0], 300 mM NaCl, and 0.01% Tween-20 in water) to removed unconjugated Gas6. The yeastdisplayed Axl Ig1 library (8 × 108 cells) was washed with Pull-down Buffer (3.25 mM sodium phosphate [pH 7.4], 70 mM NaCl, and 0.01% Tween-20 in water) and incubated with Gas6-coated Dynabeads in Pull-down Buffer for 1 h at 4 °C. After incubation, the yeast and beads were placed in the magnetic holder and washed several times with Binding/Wash Buffer. Gas6-bound yeast cells were eluted from beads with His-Elution Buffer (150 mM imidazole, 25 mM
increased target binding affinity using kinetic off-rates as a sorting parameter. Here, we present μSCALE as a new technique for affinity maturation of protein−protein interactions. The platform offers two unique features to aid in library screening. First, μSCALE affords a comprehensive snapshot of the biochemical or biophysical properties of all library members prior to sorting, allowing users to define parameters for selecting only the top variants for further analysis. Second, the laser-based extraction technique enables isolation of rare clones with high precision. These two attributes allow efficient library screening for high affinity variants. The same Axl Ig1 library, screened by FACS, identified a variant termed MYD1 that contains four mutations: G32S, D87G, V92A, and G127R.9 Compared to wild-type Axl, MYD1 had a 12-fold tighter equilibrium binding constant and an 18fold slower off-rate of binding to Gas6, as measured by KinExA. While this exact clone was not isolated in our current study, the dominant mutations D87G and V92A were highlighted as consensus mutations by both FACS and μSCALE screening. Moreover, both μSCALE and FACS identified the A72V mutation, which further increased Gas6 binding affinity and improved in vivo efficacy when combined with MYD1 in a follow-up study.26 One limitation of the μSCALE platform is reduced screening throughput compared to FACS. We show that combining the platform workflow with bulk bead-based cell screening approaches such as MACS can further increase library throughput. While more rigorous comparison of the two technologies is needed to fully assess the ability to exhaustively recover all desirable variants, a trade-off between purity and yield exists for all screening technologies. Nevertheless, the ability to carry out iterative rounds of library creation and screening on an accelerated time scale (Figure 2b) creates opportunities to exploit yeast surface display for true “directed evolution” efforts, while establishing μSCALE as a viable tool for engineering affinity reagents.
■
METHODS
μSCALE Instrumentation and Image Analysis. All μSCALE experiments were performed with a Veritas laser-capture microdissection (LCM) system (Arcturus), adapted with hardware and software modifications to enable microcapillary screening applications D
DOI: 10.1021/acschembio.6b00794 ACS Chem. Biol. XXXX, XXX, XXX−XXX
Letters
ACS Chemical Biology
U/μL Taq DNA polymerase, and 600 ng of the pooled plasmid DNA in a total volume of 50 μL. For PCR, after an initial denaturation step at 94 °C for 30 s, 80 extension cycles were performed for 30 s at 94 °C (denaturation) and 5 s at 55 °C (annealing/extension). Amplified DNA was purified using gel electrophoresis. The yeast display plasmid pCT30 was digested with NheI and BamHI. Purified StEP PCR product and linearized pCT plasmid were electroporated in a 5:1 ratio by weight (5 μg and 1 μg, respectively) into the S. cerevisiae strain EBY100, where they were assembled in vivo through homologous recombination.17 Library size was estimated to be 4 × 106 by dilution plating. μSCALE Kinetic Off-Rate Sort. Yeast cells transformed with the DNA shuffled library were grown in SD-CAA media and induced to express Axl on their surface by culturing in SG-CAA media. The yeastdisplayed library was incubated at RT for 3 h in PBSA containing 2 nM Gas6, washed with PBSA twice to remove unbound Gas6, and then incubated with an excess amount (100 nM) of wild-type Axl-Fc competitor9 for 24 h at RT. Fluorescent antibody labeling and microcapillary array loading was conducted in a similar manner to the μSCALE equilibrium sort as described above. For the μSCALE kinetic off-rate sort, 40 capillaries with the highest Gas6 binding/c-Myc expression ratio were individually extracted. Extracted yeast was grown on SD-CAA agar plates, where 42 colonies grew from 40 extracted microcapillaries. Plasmid DNA recovered from extracted yeast was analyzed by colony PCR and sequencing as described above. Binding and Kinetic Off-Rate Assays. The Gas6 binding affinities of wild-type and Axl Ig1 variants were measured by incubating 4 × 104 induced yeast cells with varying concentrations of Gas6 in PBSA for 48 h at RT. Reaction volumes and time were empirically determined to minimize ligand depletion and to ensure equilibrium was reached. After incubation, cells were stained with PBSA containing a 1:500 dilution of chicken anti-c-Myc antibody (Thermo Fisher Scientific, A21281) for 30 min at 4 °C. Secondary antibody labeling was carried out in PBSA containing a 1:100 dilution of mouse anti-His Tag IgG Hilyte Fluor 488 (Anaspec, 61250-H488) and goat anti-chicken IgY Alexa Fluor 555 (Thermo Fisher Scientific, A21437) for 20 min at 4 °C. Fluorescence values representing binding and expression of the labeled cells were measured using an Accuri C6 flow cytometer (BD Biosciences). Data were analyzed using FlowJo software (Treestar Inc.), and full binding titrations were fit as a fourparameter sigmoidal curve using KaleidaGraph (Synergy Software) to calculate equilibrium binding constants (Kd) from three technical replicates of each fit point. Kinetic dissociation rates of wild-type and Axl Ig1 variants were measured by incubating 5 × 104 induced cells with a saturating amount of Gas6 (10 nM) in PBSA for 1 h at RT. After incubation, cells were washed twice with PBSA to remove any unbound Gas6 and incubated with an excess amount (100 nM) of soluble wild-type Axl Fc competitor9 at RT for time points ranging from 1 to 48 h. Samples were staggered such that all dissociation steps reached completion at the same time. During the last 30 min of the dissociation reaction, chicken anti-c-Myc antibody (Thermo Fisher Scientific, A21281) was added to a final dilution of 1:500. Yeast was pelleted, washed, incubated with fluorescently labeled secondary antibodies, and analyzed as described above for an equilibrium binding experiment. The standard deviation was calculated from the Kd values measured independently in three separate experiments performed on different days.
sodium phosphate [pH 8.0], 150 mM NaCl, and 0.005% Tween-20 in water). Using this protocol, MACS reduced the library to 3.5 × 106 variants, which corresponds to 4.7% of the original library size. μSCALE Equilibrium Sort. Yeast isolated from MACS were grown in SD-CAA minimal yeast media (20 g of dextrose; 6.7 g of Difco yeast nitrogen base; 5 g of Bacto casamino acids; 5.4 g of Na2HPO4; 8.56 g of NaH2PO4·H2O; dissolved in deionized H2O to a volume of 1 L)17 and induced to express Axl on their surface by culturing in SG-CAA media (prepared as SD-CAA except using 20 g of galactose substituted for dextrose). Yeast displaying Axl variants were incubated at RT for 15 h in PBSA (phosphate-buffered saline + 1 mg mL−1 BSA) containing 100 pM Gas6. Following incubation with Gas6, cells were stained in PBSA containing a 1:200 dilution of chicken anti-c-Myc antibody (Thermo Fisher Scientific, A21281) for 45 min at 4 °C. Cells were then incubated in PBSA containing a 1:100 dilution of mouse anti-His Tag IgG Hilyte Fluor 555 (Anaspec, 61250-H555) for 45 min at 4 °C. Then, an additional secondary labeling for Gas6 was performed in PBSA with 1:100 dilution of rabbit anti-mouse IgG Hilyte Fluor 555 (Anaspec, 28164-H555) for 45 min at 4 °C, followed by secondary labeling for c-Myc in PBSA with 1:100 dilution of goat anti-chicken IgY Alexa Fluor 488 (Thermo Fisher Scientific, A11039) for 45 min at 4 °C. Labeled yeast was diluted to ∼12 800 cells/μL, loaded into a 20 μm microcapillary array, and analyzed for Gas6 binding and c-Myc expression using excitation/emission parameters described above. While this loading density should result in a theoretical concentration of four cells per capillary, the actual number observed was ∼1.6 cells per capillary (Supporting Information Figure 2) due to challenges with precisely quantifying yeast cell cultures. Thirty microcapillaries with the highest Gas6 binding/c-Myc expression ratio were individually extracted and grown on SD-CAA plates. At least one cell grew from 22 of 30 extractions, yielding 30 clones total as some microcapillaries contained more than one cell when extracted. Plasmid DNA recovered from extracted clones was analyzed by colony PCR and sequencing as described below. Yeast Colony PCR. The screened Axl variants were sequenced by yeast colony PCR modified from a previously reported protocol.28 Individual yeast colonies grown on SD-CAA agar plates after μSCALE extraction were resuspended in PCR tubes filled with 20 μL of sterile Milli-Q water. The tubes were then heated in a microwave for 30 s to better expose DNA by altering cellular walls and membranes.29 A total of 2 μL of microwaved colony suspension was added into a PCR reaction mixture containing 4.0 μL of 5X Phusion HF buffer, 0.5 μL of 10 mM dNTPs, 1.0 μL of 10 μM forward primer (GGCAGCCCCATAAACACACAGTAT), 1.0 μL of 10 μM reverse primer (GTATTTTGTACGAGCTAAAAGTACAGTGG), 0.2 μL of Phusion High-Fidelity DNA polymerase (NEB, M0530), and 11.3 μL of distilled water. Variant Axl Ig1 genes were amplified by PCR conditions consisting of (1) an initial denaturation step for 5 min at 98 °C; (2) 32 extension cycles carried out for 20 s at 98 °C, 30 s at 58 °C, and 40 s at 72 °C; and (3) a final elongation step for 10 min at 72 °C. The PCR products were analyzed by DNA sequencing (Sequetech). Yeast-Displayed DNA-Shuffled Library. A second Axl Ig1 library was created by DNA shuffling using the PCR-based staggered extension process (StEP).24 The 30 clones extracted from the μSCALE equilibrium sort (Supporting Information Table 1) were individually regrown in 1 mL of SD-CAA containing 1% penicillinstreptomycin in a deep 96-well polypropylene plate, and then pooled by combining an equivalent number of cells representing each variant. After culturing the pooled yeast in SD-CAA media, plasmid DNA was isolated using the Zymoprep Yeast Plasmid Miniprep kit (Zymo Research), followed by an additional purification step using the GeneJET PCR Purification Kit (Thermo Fisher Scientific). For an optimized StEP condition, 600 ng of purified plasmid DNA was finalized as the concentration for template DNA. The StEP reaction was performed in a PCR mixture consisting of 5 μL of 10× ThermoPol Buffer (NEB, M0267), 2 μL of 50 mM MgCl2, 2.5 μL of 10 μM forward primer (CGTTTGTCAGTAATTGCGGTTCTCACCCC), 2.5 μL of 10 μM reverse primer (GTATTTTGTACGAGCTAAAAGTACAGTGG), 1 μL of 10 mM dNTPs, 0.5 μL of 5
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acschembio.6b00794. Supporting Tables 1 and 2 and Figures 1−5 (PDF) E
DOI: 10.1021/acschembio.6b00794 ACS Chem. Biol. XXXX, XXX, XXX−XXX
Letters
ACS Chemical Biology
■
(9) Kariolis, M. S., Miao, Y. R., Jones, D. S., Kapur, S., Mathews, I. I., Giaccia, A. J., and Cochran, J. R. (2014) An engineered Axl “decoy receptor” effectively silences the Gas6-Axl signaling axis. Nat. Chem. Biol. 10, 977−983. (10) Hackel, B. J., Ackerman, M. E., Howland, S. W., and Wittrup, K. D. (2010) Stability and CDR Composition Biases Enrich Binder Functionality Landscapes. J. Mol. Biol. 401, 84−96. (11) Zahnd, C., Kawe, M., Stumpp, M. T., De Pasquale, C., Tamaskovic, R., Nagy-Davidescu, G., Dreier, B., Schibli, R., Binz, H. K., Waibel, R., and Plückthun, A. (2010) Efficient Tumor Targeting with High-Affinity Designed Ankyrin Repeat Proteins: Effects of Affinity and Molecular Size. Cancer Res. 70, 1595−1605. (12) Lane, M. D., and Seelig, B. (2014) Advances in the directed evolution of proteins. Curr. Opin. Chem. Biol. 22, 129−136. (13) Bornscheuer, U., and Kazlauskas, R. J. (2011) Survey of Protein Engineering Strategies, in Current Protocols in Protein Science, pp 26.7.1−26.7.14, John Wiley & Sons, Inc., Hoboken, NJ. (14) Packer, M. S., and Liu, D. R. (2015) Methods for the directed evolution of proteins. Nat. Rev. Genet. 16, 379−394. (15) Daugherty, P. S., Iverson, B. L., and Georgiou, G. (2000) Flow cytometric screening of cell-based libraries. J. Immunol. Methods 243, 211−227. (16) Cherf, G. M., and Cochran, J. R. (2015) Applications of yeast surface display for protein engineering. Methods Mol. Biol. 1319, 155− 175. (17) Chao, G., Lau, W. L., Hackel, B. J., Sazinsky, S. L., Lippow, S. M., and Wittrup, K. D. (2006) Isolating and engineering human antibodies using yeast surface display. Nat. Protoc. 1, 755−768. (18) VanAntwerp, J. J., and Wittrup, K. D. (2000) Fine Affinity Discrimination by Yeast Surface Display and Flow Cytometry. Biotechnol. Prog. 16, 31−37. (19) Chen, B., Lim, S., Kannan, A., Alford, S. C., Sunden, F., Herschlag, D., Dimov, I. K., Baer, T. M., and Cochran, J. R. (2016) High-throughput analysis and protein engineering using microcapillary arrays. Nat. Chem. Biol. 12, 76−81. (20) Lemke, G., and Rothlin, C. V. (2008) Immunobiology of the TAM receptors. Nat. Rev. Immunol. 8, 327−336. (21) Graham, D. K., DeRyckere, D., Davies, K. D., and Earp, H. S. (2014) The TAM family: phosphatidylserine-sensing receptor tyrosine kinases gone awry in cancer. Nat. Rev. Cancer 14, 769−785. (22) Boder, E. T., and Wittrup, K. D. (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nat. Biotechnol. 15, 553−557. (23) Miltenyi, S., Müller, W., Weichel, W., and Radbruch, A. (1990) High gradient magnetic cell separation with MACS. Cytometry 11, 231−238. (24) Zhao, H., and Zha, W. (2006) In vitro “sexual” evolution through the PCR-based staggered extension process (StEP). Nat. Protoc. 1, 1865−1871. (25) Boder, E. T., and Wittrup, K. D. (1998) Optimal screening of surface-displayed polypeptide libraries. Biotechnol. Prog. 14, 55−62. (26) Kariolis, M. S., Miao, Y. R., Diep, A., Nash, S. E., Olcina, M. M., Jiang, D., Jones, D. S., Kapur, S., Mathews, I. I., Koong, A. C., Rankin, E. B., Cochran, J. R., and Giaccia, A. J. (2016) Inhibition of the GAS6/ AXL pathway augments the efficacy of chemotherapies. J. Clin. Invest., DOI: 10.1172/JCI85610. (27) Hunter, S. A., and Cochran, J. R. (2016) Cell-Binding Assays for Determining the Affinity of Protein − Protein Interactions: Technologies and Considerations. Methods Enzymol. 580, 21−43. (28) Sambrook, J., and Russell, D. W. (2006) Analyzing Yeast Colonies by PCR. Cold Spring Harb. Protoc., DOI: 10.1101/ pdb.prot4015. (29) Goodwin, D. C., and Lee, S. B. (1993) Microwave miniprep of total genomic DNA from fungi, plants, protists and animals for PCR. Biotechniques 15, 438−444. (30) Gai, S. A., and Wittrup, K. D. (2007) Yeast surface display for protein engineering and characterization. Curr. Opin. Struct. Biol. 17, 467−473.
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. ORCID
Sungwon Lim: 0000-0003-4045-6478 Author Contributions ⊥
These authors contributed equally
Notes
The authors declare the following competing financial interest(s): All authors are listed as inventors on issued and pending patent applications owned by Stanford University related to this technology. J.R.C. and B.C. have financial interests in xCella Biosciences, which is commercializing technology related to high-throughput protein analysis and engineering.
■
ACKNOWLEDGMENTS This project was funded in part by the Stanford−Wallace H. Coulter Translational Partnership Award Program, the Siebel Stem Cell Institute and the Thomas and Stacey Siebel Foundation, the Stanford Photonics Research Center, and a Hitachi America Faculty Scholar Award (to J.R.C.). We acknowledge support from the Howard Hughes Medical Institute International Student Research Program (S.L.), National Science Foundation Graduate Fellowship Program (B.C.), Stanford Bio-X Fellowship Program (S.L., M.S.K.), Stanford Graduate Fellowship Program (B.C.), and ARCS Graduate Fellowship (M.S.K.).
■
REFERENCES
(1) Weiskopf, K., Ring, A. M., Ho, C. C. M., Volkmer, J.-P., Levin, A. M., Volkmer, A. K., Ozkan, E., Fernhoff, N. B., van de Rijn, M., Weissman, I. L., and Garcia, K. C. (2013) Engineered SIRPα variants as immunotherapeutic adjuvants to anticancer antibodies. Science 341, 88−91. (2) Plückthun, A. (2015) Designed Ankyrin Repeat Proteins (DARPins): Binding Proteins for Research, Diagnostics, and Therapy. Annu. Rev. Pharmacol. Toxicol. 55, 489−511. (3) Orlova, A., Magnusson, M., Eriksson, T. L. J., Nilsson, M., Larsson, B., Höidén-Guthenberg, I., Widström, C., Carlsson, J., Tolmachev, V., Ståhl, S., and Nilsson, F. Y. (2006) Tumor Imaging Using a Picomolar Affinity HER2 Binding Affibody Molecule. Cancer Res. 66, 4339−4348. (4) Boddapati, S., Levites, Y., and Sierks, M. R. (2011) Inhibiting βsecretase activity in Alzheimer’s disease cell models with single-chain antibodies specifically targeting APP. J. Mol. Biol. 405, 436−447. (5) Li, B., Fouts, A. E., Stengel, K., Luan, P., Dillon, M., Liang, W.-C., Feierbach, B., Kelley, R. F., and Hötzel, I. (2014) In vitro affinity maturation of a natural human antibody overcomes a barrier to in vivo affinity maturation. MAbs 6, 437−445. (6) Lee, C. V., Liang, W.-C., Dennis, M. S., Eigenbrot, C., Sidhu, S. S., and Fuh, G. (2004) High-affinity human antibodies from phagedisplayed synthetic Fab libraries with a single framework scaffold. J. Mol. Biol. 340, 1073−1093. (7) Levin, A. M., Bates, D. L., Ring, A. M., Krieg, C., Lin, J. T., Su, L., Moraga, I., Raeber, M. E., Bowman, G. R., Novick, P., Pande, V. S., Fathman, C. G., Boyman, O., and Garcia, K. C. (2012) Exploiting a natural conformational switch to engineer an interleukin-2 “superkine. Nature 484, 529−533. (8) Maute, R. L., Gordon, S. R., Mayer, A. T., McCracken, M. N., Natarajan, A., Ring, N. G., Kimura, R., Tsai, J. M., Manglik, A., Kruse, A. C., Gambhir, S. S., Weissman, I. L., and Ring, A. M. (2015) Engineering high-affinity PD-1 variants for optimized immunotherapy and immuno-PET imaging. Proc. Natl. Acad. Sci. U. S. A. 112, E6506− 14. F
DOI: 10.1021/acschembio.6b00794 ACS Chem. Biol. XXXX, XXX, XXX−XXX
