Enzyme-Free and Amplified Fluorescence DNA Detection Using

Article pubs.acs.org/ac

Enzyme-Free and Amplified Fluorescence DNA Detection Using Bimolecular Beacons Jiahao Huang,† Xuefen Su,‡ and Zhigang Li*,† †

Department of Mechanical Engineering, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong ‡ School of Public Health and Primary Care, Faculty of Medicine, Prince of Wales Hospital, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong S Supporting Information *

ABSTRACT: In this work, we propose a simple and enzyme-free strategy for sensitive and selective DNA detection by using two different types of molecular beacons (MBs), MB1 and MB2. In this method, the target DNA binds with and restores the fluorescence of MB1 first. Then, MB2 hybridizes with MB1 and free the target, which is used to trigger another reaction cycle. The cycling use of the target and the employment of bi-MBs amplify the fluorescence intensity for sensitive DNA detection. The detection limit of this method was obtained as 10 pM, which is about 2 orders of magnitude sensitive than the conventional MB-based approaches.

S

equence-specific and sensitive detection of DNA is of great importance in a variety of applications, including life science, medical diagnosis, pathogen identification, and environmental and food safety monitoring.1−4 In the past decades, various oligonucleotide probes have been developed for DNA detection by using different reporting entities, such as fluorescent markers, radioactive elements, chemiluminescent compounds, and protein enzymes.5−8 Recently, molecular beacons (MBs), as fluorescent probes, have been used as attractive probes for quantitative genomic studies.9 An MB represents a segment of special single-stranded DNA labeled with a fluorophore at one end and a quencher at the other end. It consists of a probe sequence in the center region and two short complementary sequences at the ends. As an example, the detection of DNA using a MB is illustrated in Figure 1a. Since the first report by Tyagi and Kramer in 1996,10 MBs have been widely employed in many applications, such as genetic screening, biosensor development, biochip construction, the detection of single nucleotide polymorphisms (SNPs), and messenger-RNA (mRNA) monitoring in living cells.11−14 Compared with the traditional DNA probes, MBs have many advantages, such as high signal-to-background ratio and molecular recognition selectivity. In addition, MBs make the detection of DNA possible in homogeneous solutions without the separation of hybridized and nonhybridized probes. Regardless of the ways MBs are used, the basic principle behind the detection remains unchanged (Figure 1a), i.e., the restoration of fluorescence due to the hybridization between MBs and target molecules in a 1:1 stoichiometric ratio, which, however, may affect the signal gain and reduce the sensitivity of MB-based methods. To improve the detection sensitivity, various target and signal amplification techniques have been developed. For target amplifications, thermal-cycling methods are usually needed. © 2012 American Chemical Society

Figure 1. Principles for DNA detection using molecular beacons (MBs). (a) Working mechanism of an MB. The MB assumes a stem− loop structure and brings the fluorophore and quencher in close proximity in the absence of the target. After the target hybridizes with the MB, the MB is opened and the fluorophore is separated from the quencher, leading to the restoration of fluorescence. (b) Schematic of the amplified DNA detection based on bi-MBs and the recycle of the target. The target binds with and restores the fluorescence of MB1 first. Then MB2 hybridizes with MB1 forming MB1−MB2 duplex structure and liberates the target, which becomes available to trigger another reaction cycle for the formation of MB1−MB2 complex.

Received: February 17, 2012 Accepted: June 20, 2012 Published: June 20, 2012 5939

dx.doi.org/10.1021/ac3004727 | Anal. Chem. 2012, 84, 5939−5943

Analytical Chemistry

Article

Table 1. Molecular Beacons and Other Oligonucleotides Used in the Experimentsa name MB1 MB2 oligo oligo oligo oligo

1 2 3 4

(target) (1 mismatch) (2 mismatch) (random)

sequence (5′ to 3′) AAGTAGT-(DABCYL)-GATTGAGCGTGATGAATGTCACTACTTCAACTCGCATTCATCACGCTCAATC-(FAM) TGATGAA-(FAM)-TGCGAGTTGAAGTAGTGACATTCATCACGCTCAATCACTACTTCAACTCGCA-(DABCYL) GACATTCATCACGCTCAATCACTACTT GACATTCATCACGTTCAATCACTACTT GACATTCATCACGTACAATCACTACTT TTCATCATCAACTCGCACTACTTACAG

a

The bold letters indicate the stem sequences of the MBs. The italic letters indicate the complementary bases between MB1 and MB2. The overlined letters in MB1 show the sequences complementary to the target. The underlined letters represent the mismatched sites.

Examples include polymerase and ligase chain reactions,15 where a thermal-cycling protocol is used for target DNA amplification. In these methods, although the amount of DNA products can be exponentially duplicated through repeated thermal cyclings to reach a very high sensitivity, the thermalcycling processes are time-consuming and constrained by the laboratory settings. Thermal-cycling methods are also limited to thermostable enzymes and may generate unreliable products. For signal amplifications, usually protein enzymes are used to release and recycle the target DNA molecules after their hybridization with MBs. In this way, a target DNA molecule can be continuously used to hybridize with many MBs to amplify the fluorescence signal. In the literature, nicking endonucleases, Exonuclease III, HaeIII nuclease, and DNA polymerase,16−19 have been employed as the enzymes for this purpose. However, the protein enzymes needed in these approaches are expensive, which increase the detection cost and may limit the application of these techniques. Enzyme-free and amplified DNA detections have also been achieved by the analyte-induced autonomous cross-opening of hairpins and continuous DNAzyme-mediated signal producing process.20 Signals can also be amplified through target regeneration approaches.21 In this work, we report a simple strategy for sensitive and selective detection of DNA based on the inherent signaltransduction mechanism of MBs and circular reactions between MBs and targets. In this scheme, two types of MBs, MB1 and MB2, are used. After the target DNA binds with MB1 and generates fluorescence emission, MB2 hybridizes with MB1 and liberates the target DNA, which becomes available for the next cycle of MB1−target hybridization. The cycling use of the target continuously triggers the conformational changes of the MBs and amplifies the response signal. At the same time, the conformational change of MB2 strengthens the fluorescence signal and enhances the detection sensitivity. This approach does not require expensive protein enzymes and complex modifications of MBs. It also does not involve time-consuming thermal-cycling procedures. Moreover, the design of the MBs makes the method very selective. Therefore, it is a relatively low-cost, simple, sensitive, and selective method.

loop sequence of MB1, while the remainer of the sequence of MB1 was complementary to the sequence of MB2. Oligos 2 and 3 contained one and two mismatched base pairs, respectively, while oligo 4 was a random DNA sequence. All other reagents were of analytical grade and were used without further purification and modification. All the solutions were prepared with deionized water. Fluorescence Measurement. Fluorescence measurements were conducted in a F4500 fluorometer (Hitachi, Japan) at 24 °C. According to the fluorescent properties of FAM, the dye labeled on the MBs, the excitation and emission wavelengths were set at 496 and 517 nm. The slit width for both excitation and emission was set at 5 nm. To obtain the emission spectra, the samples were excited by a 490 nm light and the fluorescence emission was scanned from 510 to 600 nm with a step of 1 nm. To compare the signal gain and confirm the detection principle, samples that contained MB1 or MB2 only were also prepared. Fluorescence signals were scaled by that of the sample containing MB2 only (58.4 au), which was stable and the lowest among all the fluorescence responses. All the solutions were 500 μL and made by mixing corresponding MBs, MgCl2, and Tris-HCl (pH 8.0) with concentrations of 50 nM, 5 mM, and 50 mM, respectively (the mixing order depends on the experiments and is provided in the next section). All the samples were incubated at 24 °C for at least 10 min before the experiments.

■

RESULTS AND DISCUSSION The detection principle is illustrated in Figure 1b. Two MBs, MB1 and MB2 (Table 1), are employed, which, in the absence of the target, form a stem−loop structure due to the binding of the complementary sequences at the ends and the fluorescence is quenched. The stems of the MBs are relatively longer than those in the other MB-based sensors.22 The purpose is to make the beacons sufficiently stable individually in their hairpin structures, prevent the beacons from hybridization, and improve the sensitivity of the method. The sequences in the toehold region, stem, and part of the loop of MB1 are complementary to the target, while the rest sequence of MB1 is complementary to MB2. When the target appears, it hybridizes with and opens the hairpin structure of MB1. This, on one hand, restores the fluorescence of MB1 and, on the other hand, exposes the complementary sequence of MB1 to MB2 and leads to the binding of MB2 with MB1. Because the MB1− MB2 duplex is more stable than the target−MB1 hybridization, MB2 will replace and free the target when it hybridizes with MB1 (Figure 1b, and Figure S1 in Supporting Information). Consequently, a MB1−MB2 duplex is formed and the fluorescence of MB2 is also restored, which enhances the fluorescence intensity. The released target then becomes available to trigger another reaction cycle for the formation of

■

EXPERIMENTAL SECTION Materials. The MBs and oligonucleotides were synthesized by TaKaRa Bio Inc. (Dalian, China). Sequences of the oligos are listed in Table 1. Both MB1 and MB2 form a stem−loop structure with an additional toehold region to easily initiate the possible hybridizations. The fluorophore and quencher were labeled at the complementary bases at the 5′ and 3′ ends in the stem region to ensure a low background signal in the absence of the target (Figure 1b). The sequence of the target (oligo 1) was perfectly matched to the toehold region, stem, and part of the 5940

dx.doi.org/10.1021/ac3004727 | Anal. Chem. 2012, 84, 5939−5943

Analytical Chemistry

Article

Nevertheless, the quantitative effect of DDEM requires further investigation and is beyond the scope of current work. We further tested the sensitivity of the detection strategy by changing the target concentration from 10 to 1000 pM (Figure 3a, where the target and MB2 were mixed first and then MB1

MB1−MB2 complex. Therefore, in addition to the simple and relatively low-cost detection process, the employment of biMBs and the recycle of the target make this strategy appealing in amplifying fluorescence signal for selective and sensitive DNA detection. To demonstrate the feasibility of this strategy, the fluorescence response of the sensing system was measured before and after 1 nM target DNA was introduced, as shown in Figure 2. After the addition of the target DNA, the fluorescence

Figure 2. Time response of fluorescence intensity of samples containing MB1, MB2, or both before and after the addition of 1 nM target DNA. The signal was scaled by the signal of the solution containing MB2 only, which was 58.4 au.

intensity of the sensing system (solution containing MB1 and MB2 probes) increased quickly. Compared with the conventional method, which employs MB1 only, the MB2-aided amplification method led to a 3-fold increase in the signal intensity after 2 h. Clearly, the signal enhancement was caused by the cycling use of the target DNA and the continuous generation of the MB1−MB2 complex as shown in Figure 1b (the enhancement would be less than 100% if the target was not reused). It is also seen that the signal of the sensing system also increased with time in the absence of the target DNA. This background signal was due to the hybridization of MB1 with MB2. Fortunately, upon the addition of the target DNA, the net signal gain of the sensing system (269.9 ± 13.1) was significantly larger than that of the conventional method (53.0 ± 6.9) using MB1 only (Figure 2) after 2 h. For the solution containing MB1 or MB2 only, the fluorescence intensity remained unchanged, indicating that the hairpin structures of the MBs were intact. Furthermore, in the solution including MB2 only, the fluorescence change was not observed with the presence of the target, showing that the target did not hybridize with MB2, which is necessary for the detection mechanism in Figure 1b. Therefore, the results indicated that the conformational changes of MB1 and MB2 were triggered by the target and the strategy in Figure 1b worked well. Because the MBs are labeled with fluorophores (FAM) and the distance between the FAM−FAM pair in the MB1−MB2 complex is close (15 base pairs), it is possible that the donor−donor energy migration (DDEM)23 between the FAM tags may affect the fluorescence recovery of the MB1−MB2 duplex and lead to a relatively lower response signal. However, the DDEM may also reduce the background signal and ensure the signal gain of the method.

Figure 3. Fluorescence responses of different samples (the signal was scaled by 58.4 au, which was the response of the solution containing MB2 only). (a) Relative fluorescence intensity of the sensing system for target concentrations from 10 to 1000 pM. (b) Relative fluorescence intensity of a control involving MB1 only for target concentrations from 1 to 50 nM.

was introduced). Figure 3a shows the time response of the signal, and it is found that the number of opened MBs increased with increasing target concentration. Figure S2a (Supporting Information) depicts the emission spectra after 2 h, which could be clearly identified, especially in the vicinity of 520 nm. The dependence of the fluorescence intensity on the target concentration Ctarget is illustrated in Figure S2b. It is seen that the signal response was proportional to logarithmic target concentration. The detection limit was experimentally determined as 10 pM, which is comparable to those obtained in the enzyme-aided amplification methods,16b,17 though it is not as sensitive as other enzyme-free amplification systems.20,21b 5941

dx.doi.org/10.1021/ac3004727 | Anal. Chem. 2012, 84, 5939−5943

Analytical Chemistry

Article

It is worth mentioning that our detection approach is not as fast as other MB-based methods.21 This might be caused by the circular reactions to open the relatively long and stable stem of the MBs. Other than this, it is a very simple, highly sequencespecific, and sensitive method, which does not require protein enzymes and complicated preparation procedures.

To confirm that the high sensitivity of the current strategy was the consequence of the target-induced circular reactions between the MBs and target, control experiments involving MB1 only at different target concentrations were conducted at similar conditions. As shown in Figure 3b and Figure S3 (Supporting Information), the fluorescence intensity followed in similar fashion to that in Figure 3a and Figure S2 when the target concentration was varied from 1 to 50 nM. A careful comparison between parts a and b of Figure 3 reveals that the amount of the target needed for the proposed sensing system (Figure 3a) was much lower than that without the aid of MB2 (Figure 3b) to produce comparable fluorescence intensity. This indicates that the target-induced circular reactions occurred in the present detection approach. In Figure 3b, it is noted that it took more than 1 h for the fluorescence intensity to become stable, which is longer than that of other single MB-based sensing systems. This might be caused by the relatively long stems of the hairpin structures adopted in this work. The detection limit of the control assay was only 1.0 nM (Figure S3b), which is 2 orders of magnitude poorer than that of the current sensing method. The selectivity of the sensing system was also evaluated by monitoring the fluorescence response when the sensor was challenged with one base- and two base-mismatched as well as random DNA sequences (Table 1). The fluorescence intensities and emission spectra after the addition of different 5 nM DNA sequences are depicted in Figure 4 and Figure S4

■

CONCLUSIONS A bimolecular beacon-based sensing strategy for amplified fluorescence DNA detection has been proposed and tested. The employment of two different types of MBs, on one hand, provides 2-fold potential fluorescence sources, but on the other hand, makes the target available for inducing circular reactions to generate strong fluorescence. The detection limit of the method was 10 pM, which is 2 orders of magnitude lower than that of the conventional methods without amplification mechanisms. Another advantage of the method is that it does not require protein enzymes and thermal-cycling procedures, which make the detection expensive and complex. Furthermore, the special structures of the MBs, such as the long stem, promote the detection selectivity. Therefore, the proposed strategy is a simple, sensitive, and selective method for picomolar DNA detection.

■

ASSOCIATED CONTENT

S Supporting Information *

Additional information as noted in the text. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the Research Grants Council of the Hong Kong Special Administrative Region under Grant No. 615710.

■

REFERENCES

(1) (a) Marrazza, G.; Chiti, G.; Mascini, M.; Anichini, M. Clin. Chem. 2000, 46, 31−37. (b) Xie, H.; Yu, Y. H.; Mao, P. L.; Gao, Z. Q. Nucleic Acids Res. 2004, 32, e15. (c) Zhao, X. J.; Tapec-Dytioco, R.; Wang, K. M.; Tan, W. H. Anal. Chem. 2003, 75, 3476−3483. (2) (a) Ren, R.; Leng, C. C.; Zhang, S. S. Chem. Commun. 2010, 46, 5758−5760. (b) Bi, S.; Zhang, J. L.; Zhang, S. S. Chem. Commun. 2010, 46, 5509−5511. (c) Li, D.; Yan, Y. M.; Wieckowska, A.; Willner, I. Chem. Commun. 2007, 34, 3544−3546. (d) Rohan, T. R.; Brown, T. Chem. Commun. 2005, 44, 5487−5502. (e) Favis, R.; Day, J. P.; Gerry, N. P.; Phelan, C.; Narod, S.; Barany, F. Nat. Biotechnol. 2000, 18, 561− 564. (f) Chua, A. L.; Yean, C. Y.; Ravichandran, M.; Lim, B. H.; Lalitha, P. Biosens. Bioelectron. 2011, 26, 3825−3831. (3) (a) Lapierre, M. A.; O’Keefe, M.; Taft, B. J.; O. Kelley, S. Anal. Chem. 2003, 75, 6327−6333. (b) Malanoski, A. P.; Lin, B.; Stenger, D. A. Nucleic Acids Res. 2008, 36, 3194−3201. (c) Kang, T.; Yoo, S. M.; Yoon, I.; Lee, S. Y.; Kim, B. Nano Lett. 2010, 10, 1189−1193. (d) Yang, B.; Gu, K.; Sun, X. R.; Huang, H.; Ding, Y.; Wang, F.; Zhou, G.; Huang, L. L. Chem. Commun. 2010, 46, 8288−8290. (4) (a) Lermo, A.; Campoy, S.; Barbe, J.; Hernández, S.; Alegret, S.; Pividori, M. I. Biosens. Bioelectron. 2007, 22, 2010−2017. (b) Pafundo, S.; Gulli, M.; Marmiroli, N. Anal. Bioanal. Chem. 2010, 396, 1831− 1839. (c) Tichoniuk, M.; Ligaj, M.; Filipiak, M. Sensors 2008, 8, 2118− 2135.

Figure 4. Time responses of fluorescence intensity of the sensing system with the presence of different 5 nM DNA sequences (the signal was scaled by 58.4 au, which was the response of the solution containing MB2 only).

(Supporting Information). As shown in Figure 4, the fluorescence intensities increased with time and could be differentiated based on the DNA sequences. In Figure S4, it is seen that the signals at the emission wavelength of 517 nm for perfectly matched, single-base-mismatched, two-base-mismatched, and random DNA were about 2.03, 1.29, 1.11, and 1.02 times the background signal, respectively. Hence, the current strategy demonstrated the capability for sequencespecific DNA detection. This is because the relatively long stem of the MBs makes the hairpin structure thermodynamically stable, and it is unfavorable for the hybridization between mismatched sequences and the MBs. 5942

dx.doi.org/10.1021/ac3004727 | Anal. Chem. 2012, 84, 5939−5943

Analytical Chemistry

Article

(18) Feng, X. L.; Liu, L. B.; Yang, Q.; Wang, S. Chem. Commun. 2011, 47, 5783−5785. (19) Guo, Q. P.; Yang, X. H.; Wang, K. M.; Tan, W. H.; Li, W.; Tang, H. X.; Li, H. M. Nucleic Acids Res. 2009, 37, e20. (20) (a) Wang, F. A.; Elbaz, J.; Teller, C.; Willner, I. Angew. Chem., Int. Ed. 2011, 50, 295−299. (b) Wang, F. A.; Elbaz, J.; Orbach, R.; Magen, N.; Willner, I. J. Am. Chem. Soc. 2011, 133, 17149−17151. (c) Shimron, S.; Wang, F. A.; Orbach, R.; Willner, I. Anal. Chem. 2012, 84, 1042−1048. (21) (a) Li, B. L.; Ellington, A. D.; Chen, X.. Nucleic Acids Res. 2011, 39, e110. (b) Zheng, X. E.; Li, J.; Wang, J. R.; Song, X. R.; Chen, G. N.; Yang, H. H. Chem. Commun. 2012, 48, 3112−3114. (22) (a) Tang, Z. W.; Liu, P.; Ma, C. B.; Yang, X. H.; Wang, K. M.; Tan, W. H.; Lv, X. Y. Anal. Chem. 2011, 83, 2505−2510. (b) Zheng, J.; Li, J. S.; Gao, X. X.; Jin, J. Y.; Wang, K. M.; Tan, W. H.; Yang, R. H. Anal. Chem. 2010, 82, 3914−3921. (c) Wang, C. M.; Zhu, Z.; Song, Y. L.; Lin, H.; Yang, C. Y. J.; Tan, W. H. Chem. Commun. 2011, 47, 5708−5710. (23) (a) Karolin, J.; Fa, M.; Wilczynska, M.; Ny, T.; Johansson, L. B. Biophys. J. 1998, 74, 11−21. (b) Ping, Z.; Surendhran, K.; Mchaourab, H. S. Biophys. J. 2007, 9, L27−L29.

(5) (a) Conlon, P.; Yang, C. Y. J.; Wu, Y. R.; Martinez, K.; Kim, Y.; Stevens, N.; Marti, A. A.; Jockusch, S.; Turro, N. J.; Tan, W. H. J. Am. Chem. Soc. 2008, 130, 336−342. (b) Zhang, P.; Beck, T.; Tan, W. H. Angew. Chem., Int. Ed. 2001, 40, 402−405. (c) Lin, Y. W.; Ho, H. T.; Huang, C. C.; Chang, H. T. Nucleic Acids Res. 2008, 36, e123. (d) Wang, L.; Yang, C. Y. J.; Medley, C. D.; Benner, S. A.; Tan, W. H. J. Am. Chem. Soc. 2005, 127, 15664−15665. (e) Wang, F. A.; Elbaz, J.; Teller, C.; Willner, I. Angew. Chem., Int. Ed. 2011, 50, 295−299. (6) Zeph, L. R.; Lin, X. Y.; Stotzk, G. Curr. Microbiol. 1991, 22, 79− 84. (7) (a) Weizmann, Y.; Cheglakov, Z.; Willner, I. J. Am. Chem. Soc. 2008, 130, 17224−17225. (b) Weizmann, Y.; Beissenhirtz, M. K.; Cheglakov, Z.; Kotler, M.; Willner, I. Angew. Chem., Int. Ed. 2006, 45, 7384−7388. (c) Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Anal. Chem. 2004, 76, 2152−2156. (d) Niazov, T.; Pavlov, V.; Xiao, Y.; Gill, R.; Willner, I. Nano Lett. 2004, 4, 1683−1687. (e) Bi, S.; Li, L.; Zhang, S. S. Anal. Chem. 2010, 82, 9447−9454. (f) Roda, A.; Mirasoli, M.; Dolci, L. S.; Buragina, A.; Bonvicini, F.; Simoni, P.; Guardigli, M. Anal. Chem. 2011, 83, 3178−3185. (8) (a) Wu, J.; Chumbimuni-Torres, K. Y.; Galik, M.; Thammakhet, C.; Haake, D. A.; Wang, J. Anal. Chem. 2009, 81, 10007−10012. (b) Liu, G.; Wan, Y.; Gau, V.; Zhang, J.; Wang, L. H.; Song, S. P.; Fan, C. H. J. Am. Chem. Soc. 2008, 130, 6820−6825. (c) Zhang, Y. Y.; Tang, Z. W.; Wang, J.; Wu, H.; Maham, A. H.; Lin, Y. H. Anal. Chem. 2010, 82, 6440−6446. (d) Su, X.; Teh, H. F.; Lieu, X. H.; Gao, Z. Q. Anal. Chem. 2007, 79, 7192−7197. (9) (a) Tan, W. H.; Wang, K. M.; Drake, T. J. Curr. Opin. Chem. Biol. 2004, 8, 547−553. (b) Fang, X. H.; Li, J. W. J.; Perlette, J.; Tan, W. H.; Wang., K. M. Anal. Chem. 2000, 72, 747a−753a. (c) Yang, C. Y. J.; Lin, H.; Tan, W. H. J. Am. Chem. Soc. 2005, 127, 12772−12773. (d) Yang, R. H.; Jin, J. Y.; Chen, Y.; Shao, N.; Kang, H. Z.; Xiao, Z. Y.; Tang, Z. W.; Wu, Y. R.; Zhu, Z.; Tan, W. H. J. Am. Chem. Soc. 2008, 130, 8351−8358. (e) Wang, K. M.; Tang, Z. W.; Yang, C. Y. J.; Kim, Y.; Fang, X. H.; Li, W.; Wu, Y. R.; Medley, C. D.; Cao, Z. H.; Li, J.; Colon, P.; Lin, H.; Tan, W. H. Angew. Chem., Int. Ed. 2009, 48, 856−870. (10) Tyagi, S.; Kramer, F. R. Nat. Biotechnol. 1996, 14, 303−308. (11) (a) Fan, C. H.; Plaxco, K. W.; Heeger, A. J. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 9134−9137. (b) Wang, Y. H.; He, X. X.; Wang, K. M.; Ni, X. Q. Biosens. Bioelectron. 2010, 25, 2101−2106. (c) Stoermer, R. L.; Cederquist, K. B.; McFarland, S. K.; Sha, M. Y.; Penn, S. G.; Keating, C. D. J. Am. Chem. Soc. 2006, 128, 16892−16903. (d) Wang, J.; Onoshima, D.; Aki, M.; Okamoto, Y.; Kaji, N; Tokeshi, M; Baba, Y. Anal. Chem. 2011, 83, 3528−3532. (e) Song, S. P.; Liang, Z. Q.; Zhang, J.; Wang, L. H.; Li, G. X.; Fan, C. H. Angew. Chem., Int. Ed. 2009, 48, 8670−8674. (f) Mao, X.; Xu, H.; Zeng, Q. X.; Liu, G. D. Chem. Commun. 2009, 21, 3065−3067. (12) (a) Du, H.; Strohsahl, C. M.; Camera, J.; Miller, B. L.; Krauss, T. D. J. Am. Chem. Soc. 2005, 127, 7932−7940. (b) Lee, K.; Rouillard, J. M.; Kim, B. G.; Gulari, E.; Kim, J. Adv. Funct. Mater. 2009, 19, 3317− 3325. (13) Dubertret, B.; Calame, M.; Libchaber, A. J. Nat. Biotechnol. 2001, 19, 365−370. (14) (a) Santangelo, P. J.; Nix, B.; Tsourkas, A.; Bao, G. Nucleic Acids Res. 2004, 32, e57. (b) Jayagopal, A.; Halfpenny, K. C.; Perez, J. W.; Wright, D. W. J. Am. Chem. Soc. 2010, 132, 9789−9796. (15) (a) Li, X. M.; Huang, Y.; Guan, Y.; Zhao, M. P.; Li, Y. Z. Anal. Chem. 2006, 78, 7886−7890. (b) Li, X. M.; Song, C.; Zhao, M. P.; Li, Y. Z. Anal. Biochem. 2008, 381, 1−7. (c) Wang, L.; Blasic, J. R.; Holden, M. J.; Pires, R. Anal. Biochem. 2005, 344, 257−265. (d) Zhang, W. D.; Cohenford, M.; Lentrichia, B.; Isenberg, H. D.; Simson, E.; Li, H. J.; Yi, J. Z.; Zhang, D. Y. J. Clin. Microbiol. 2002, 40, 128−132. (16) (a) Li, J. W. J.; Chu, Y. Z.; Lee, B. Y. H.; Xie, X. S. Nucleic Acids Res. 2008, 36, e36. (b) Kong, R. M.; Zhang, X. B.; Zhang, L. L.; Huang, Y.; Lu, D. Q.; Tan, W. H.; Shen, G. L.; Yu, R. Q. Anal. Chem. 2011, 83, 14−17. (17) Zuo, X. L.; Xia, F.; Xiao, Y.; Plaxco, K. W. J. Am. Chem. Soc. 2010, 132, 1816−1818. 5943

dx.doi.org/10.1021/ac3004727 | Anal. Chem. 2012, 84, 5939−5943