Ferrimagnetic Vortex Nanoring-Mediated Mild Magnetic Hyperthermia

Jul 22, 2019 - Ferrimagnetic Vortex Nanoring-Mediated Mild Magnetic Hyperthermia Imparts Potent Immunological Effect for Treating Cancer Metastasis ...
0 downloads 0 Views 3MB Size
Download PDF
Subscriber access provided by Nottingham Trent University

Article

Ferrimagnetic Vortex Nanorings-Mediated Mild Magnetic Hyperthermia Imparts Potent Immunological Effect for Treating Cancer Metastasis Xiaoli Liu, Jianjun Zheng, Wei Sun, Xiao Zhao, Yao Li, Ningqiang Gong, Yanyun Wang, Xiaowei Ma, Tingbin Zhang, Ling-Yun Zhao, Yayi Hou, Zhibing Wu, Yang Du, Haiming Fan, Jie Tian, and Xing-Jie Liang ACS Nano, Just Accepted Manuscript • DOI: 10.1021/acsnano.9b01979 • Publication Date (Web): 22 Jul 2019 Downloaded from pubs.acs.org on July 22, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Ferrimagnetic Vortex Nanorings-Mediated Mild Magnetic Hyperthermia Imparts Potent Immunological Effect for Treating Cancer Metastasis Xiaoli Liu,†,‡,⊥ Jianjun Zheng,‖,⊥ Wei Sun,‖,⊥ Xiao Zhao,†,⊥ Yao Li,† Ningqiang Gong,† Yanyun Wang,‡ Xiaowei Ma,† Tingbin Zhang,§ Ling-Yun Zhao,∇ Yayi Hou,# Zhibing Wu,¶ Yang Du,*,Δ Haiming Fan,*,§ Jie Tian,*,Δ and Xing-Jie Liang*,† † CAS Key Laboratory for Biomedical Effects of Nanomaterials and Nanosafety, CAS Center for Excellence in Nanoscience, National Center for Nanoscience and Technology of China, No. 11, First North Road, Zhongguancun, Beijing 100190, China University of Chinese Academy of Sciences, Beijing 100049, China E-mail: [email protected]; ‡ The College of Life Sciences, Northwest University, Xi’an, Shaanxi 710069, China Δ CAS Key Laboratory of Molecular Imaging, the State Key Laboratory of Management and Control for Complex Systems, Institute of Automation, Chinese Academy of Sciences, Beijing 100190, China E-mail: [email protected]; [email protected]; § Key Laboratory of Synthetic and Natural Functional Molecule Chemistry of the Ministry of Education, College of Chemistry and Materials Science, Northwest University, Xi’an 710127, China E-mail: [email protected]; ‖ Department of Radiology, Hwa Mei Hospital, University of Chinese Academy of Sciences, (Ningbo No.2 Hospital), Ningbo, Zhejiang 315010, China ∇ Key Laboratory of Advanced Materials, School of Material Science & Engineering, Tsinghua University, Beijing, 100084, China # The State Key Laboratory of Pharmaceutical Biotechnology, Division of Immunology, Medical School, Nanjing University, Nanjing, 210093, China; Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, 210093, China ¶ Department of Radiation Oncology, Zhejiang Hospital, Hangzhou, Zhejiang 310013, China

1 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: Cancer metastasis is a serious concern and a major reason of treatment failure. Herein, we have reported the development of an effective and safe nanotherapeutic strategy which can eradicate primary tumors, inhibit metastasizing to lung, and control the metastasis/growth of distant tumors. Briefly, ferrimagnetic vortex-domain iron oxide nanorings (FVIOs)-mediated mild magnetic hyperthermia caused calreticulin (CRT) expression on the 4T1 breast cancer cells. The CRT expression transmitted an "eat-me" signal and promoted phagocytic uptake of cancer cells by immune system to induce an efficient immunogenic cell death, further leading to the macrophages polarization. This mild thermotherapy promoted 88% increase of CD8+ cytotoxic T lymphocytes infiltration in distant tumors and triggered immunotherapy by effectively sensitizing tumors to the PD-L1 checkpoint blockade. The percentage of CD8+ cytotoxic T lymphocytes can be further increased from 55.4% to 64.5% after combining with PD-L1 blockade. Moreover, the combination treatment also inhibited the immunosuppressive response of anti-tumor, evidenced by significant down-regulation of myeloid-derived suppressor cells (MDSCs). Our results revealed that the FVIOs-mediated mild magnetic hyperthermia can activate the host immune systems and efficiently cooperate with PD-L1 blockade to inhibit the potential metastatic spreading as well as the growth of distant tumors.

KEYWORDS: ferrimagnetic vortex-domain iron oxide nanorings, mild magnetic hyperthermia, PD-L1 blockade immunotherapy, immunological effect, cancer metastasis

2 ACS Paragon Plus Environment

Page 2 of 40

Page 3 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Triple negative breast cancer (TNBC) is a highly aggressive and metastatic cancer, with poor prognosis. Effective targeted and specific therapy is not available and thus, this subtype is almost always fatal.1-3 Development of therapeutic strategies having low toxicity, high specificity, guaranteed tumor eradication, preventing metastases, and recurrence are the ultimate goal in the fight against cancer. At present, surgical interventions,4 radiation therapy,5 and chemotherapies6 are the mainstays of treatment for patients with solid tumors. However, high risk of mortality is commonly reported with this metastatic disease. In recent years, the therapies that can stimulate the host immune system to activate the antitumor immune system to specifically attack tumor cells and inhibit metastatic tumor growth have brought a tremendous infusion of hope as the next generation cancer treatment strategies.7-9 These cancer immunotherapies including checkpoint-blockade therapy,10-12 chimeric antigen receptor T (CAR-T) cell therapy,13,

14

and cytokine therapy15 have demonstrated exciting

results in clinics. Amongst them, checkpoint blockade therapy has attracted the attention of the researchers due to its effective nature against cancer.16 Immunosuppressive environments have been modulated within the tumors through cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) blockade or programmed death 1/programmed death ligand 1 (PD-1/PD-L1) blockade.17 They have already been approved for the treatment of cancers by the U.S. Food and Drug Administration (FDA).12,

18, 19

However, the durable responses generated by

checkpoint blockade therapy remains low.20 For example, the PD-L1 immune checkpoint blockade therapy is effective only for certain types of cancer having either pre-existing tumorspecific T cells expressing PD-1 or high expression of PD-L1 on tumors. PD-L1 blockade therapy in the case of TNBC are limited owing to insufficient activation of the host immune system.20 Sagiv-Barfi et al.21 has clearly reported the ineffectiveness of anti-PD-L1 against 4T1 breast tumor, the therapy neither obstruct the growth of primary tumor nor increase the survival rate in animal. All together lead to a disappointing anti-tumor effect of PD-L1 immune checkpoint blockade therapy in TNBC. In yet another aspect, statistical data showed 3 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 40

the effectiveness of combinational therapy having a striking anti-tumor effect in more than 75% of trials, i.e., a clinic combination of additional therapy with PD-1/PD-L1 blockade.22 Available experimental results suggested that chemotherapy, radiotherapy, photodynamic therapy, and/or photothermal therapy can sensitize tumors to immune checkpoint therapy with improved response rates by inducing immunogenic tumor microenvironments.19,

20, 23-25

Nevertheless, the side effects inherited from these additional therapies such as poor selectivity,16, 26 potential toxicity,27, 28 and tissue penetration limitation have not been given adequate attention. Altogether, they impose restrictions on immune checkpoint based combination therapy for cancer metastasis. Magnetic nanoparticles-medicated thermotherapy is innovative nanotechnology for antitumor therapy. It has been already approved by European regulatory (CE conformity marking) for the treatment of glioblastoma multiforme and for prostate cancer is now in a phase-II study.29-34 This technology can evade the disadvantages of additional therapies, especially biosafety related problems. In comparison with photothermal ablation therapy (above 50 °C),35,

36

magnetic thermotherapy is safe and mild thermotherapy with a

temperature below 44 °C within the tumor site by the administered magnetic nanoparticles, selectively kill the tumor cells. Biocompatible magnetic iron oxide nanoparticles such as the FDA-approved ferumoxytol and other commercial iron oxide nanoparticles are commonly “off label” used for magnetic thermotherapy. They play the essential role of a nanoscale mediator to convert an external alternating magnetic field (AMF) into heat through a hysteresis process.37, 38 More importantly, magnetic field has higher tissue penetration which improved the treatment possibility of cancer metastasis enormously, especially for lesion areas inaccessible by light. In contrast, photobleaching and phototoxicity have long been recognized as a potential safety issue, and is often deemed to a severe limitation for photobased treatment techniques with high light dosages.28

4 ACS Paragon Plus Environment

Page 5 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Rapid development in materials science has largely relieved the anxiety of poor conversion efficiencies of traditional superparamagnetic iron oxide (SPIO) mediator, promoting highefficient antitumor magnetic thermotherapy.39-42 One of the typical examples is ferrimagnetic vortex-domain iron oxide nanorings (FVIOs), this can achieve an extremely high specific absorption rate (SAR) over 3000 W/g, one order magnitude of FDA-approved iron oxide nanoparticle (ferumoxytol, ~250 W/g).38 Moreover, recent studies revealed that the magnetic iron oxides nanoparticle can also mediate chemodynamic therapy due to Fenton-like reaction in the tumor microenvironment and can certainly be improved under AMF.43 This Fentonreaction activity can further activate the immune response such as macrophage polarization,44, 45

providing an additional advantage to magnetic thermotherapy. Despite the great progress

being made, mono-magnetic hyperthermia treatment still faces the basic problems: tumor recurrence and metastasis. Recently, it was reported that iron nanoparticles induced magnetic hyperthermia in combination with immune checkpoint blockade would result in systemic therapeutic responses to inhibit the occurs of tumor metastasis.17 Inspired by the striking therapeutic outcomes in both clinical trials and experimental studies of the PD-L1 blockade and its combination with at least one additional therapy, along with the competitive advantages of both magnetic hyperthermia and clinically used iron oxide nanomaterials,

46, 47

we propose a strategy of combining magnetic hyperthermia with PD-L1 blockade immunotherapy to achieve superior anti-tumor effects, including effective inhibition of tumor recurrence and metastasis. There appears to be a major opportunity to develop a valued focal therapy that can be utilized to inhibit growing cancer, keeping it non-aggressive, and preventing metastasis for high-risk TNBC in an effective and safe manner. This work is to assess the efficacy of the combined clinical therapy of magnetic hyperthermia and immune checkpoint therapy on combating TNBC tumors. We employed biocompatible PEGylated FVIOs as efficient nanomediator to generate moderate heat within the tumor site under AMF, leading to the induction of cell apoptosis and the calreticulin (CRT) 5 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

exposure on the surface of 4T1 cells. The combination of FVIOs-mediated mild magnetic hyperthermia with anti-PD-L1 treatment eradicate the primary tumors treated locally with AMF in an orthotopic 4T1 tumor model, and also prevented lung metastases significantly. The exact treatment mechanism is still elusive, however, it is considered to be immune modulation. The combination of these two therapies produced an efficient abscopal effect, leading to the regression of the distant tumors. The activation of systemic tumor-specific Tcell response, infiltration of tumor-infiltrating CD4+ helper T lymphocytes, and CD8+ cytotoxic T lymphocytes along the down-regulation of myeloid-derived suppressor cells (MDSCs) collectively improved the efficacy of the treatment system. RESULTS AND DISCUSSION Preparation and characterization of PEGylated FVIOs. In our previous work,38 highly biocompatible FVIOs modified with linear phosphorylated methoxy poly (ethylene glycol) (mPEG) have been reported. It possesses a magnetic vortex-domain structure and efficient heat induction due to vortex-to-onion magnetization reversal process, representing a breakthrough in magnetic thermotherapy.27 To further improve the colloidal stability in physiological environments, branch 4arm-polyethylene glycol5k-amine (4arm-PEG-NH2) was used here to modify FVIO with dense polymer shell 48 through an established ligand exchange method.49 The obtained 4arm-PEG-NH2-modified FVIOs (abbreviated as PEGylated FVIOs) are water-soluble with little or no aggregation and could be quickly aggregated by an external magnetic field (Figure S1A, Supporting Information). This suggested that the PEGylated FVIOs with shape-induced vortex-domain structure can simultaneously achieve good suspension and fast magnetic response, which have been impossible for the commercially available single-crystal SPIOs. Since the physicochemical properties and magnetic thermal performance of nanomaterials are tightly associated with their surface characteristics,30 a series of characterizations of PEGylated FVIOs were carried out to ensure that the PEGylated FVIOs has a stable vortex domain and superior magnetic thermal behaviour. All the X-ray 6 ACS Paragon Plus Environment

Page 6 of 40

Page 7 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

diffractions of the PEGylated FVIOs can be indexed to the cubic spinel structure of Fe3O4 (JCPDS No. 19-0629) and no other impurities were observed (Figure S1B, Supporting Information). Transmission electron microscopy (TEM) images revealed that these FVIOs are well-dispersed and uniformly ring-shaped with an average outer diameter of ~70 nm, an inner diameter of ~40 nm and a height of ~50 nm (Figure 1A). The high-resolution TEM (HRTEM) image (Figure 1B) showed defined lattice fringe of ≈4.7 Å that corresponding to (111) plane of Fe3O4 and revealed the single-crystal nature of PEGylated FVIOs. The magnetic vortex structure of the PEGylated FVIOs was confirmed by Lorenz TEM analysis (Figure 1C), which endowed negligible magnetic interaction between PEGylated FVIOs in suspension. The hydrodynamic size of the PEGylated FVIOs was ~150.9 nm (Figure 1D) measured by dynamic light scattering (DLS). The stability of the FVIOs suspension was then tested in PBS and culture medium containing 10% FBS to mimic blood plasma in vivo. Figure 1E showed the hydrodynamic diameter of the FVIOs suspension did not show an obvious change in these media for 24 days, indicating the good colloidal stability of the PEGylated FVIOs in a physiological environment. The magnetic hysteresis curves further confirmed that the magnetic vortex structure of PEGylated FVIOs, showing a high saturation magnetization (70 emu/g) with the negligible remanence Mr and coercivity Hc (Figure 1F). The magnetic heating properties and temperature changes were further characterized by induction heating system fitted with a fiber thermocouple. The PEGylated FVIOs with greater conversion efficiency leads to a faster temperature rise than frequently used SPIOs (12 nm, Figure S2, Supporting Information). As shown in Figure 1G, SAR values for the PEGylated FVIOs at each designated fields were much higher than that of SPIOs. The highest SAR of PEGylated FVIOs measured was 3337 W/g Fe at 46 kA/m and 365 kHz. Since most of the magnetic nanoparticles with high SAR experience a massive SAR decrease due to the reduction of the Brownian contribution once internalized in tissues and cells50, 51, the SAR value of FVIOs was re-examined in agarose gel dispersion (to simulate the in vivo environments of tissue or 7 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 40

cellular environment) for actual values within a tissue-equivalent phantom. The SAR was retained up to 2602 W/g at 365 kHz and 46 kA/m (78% retention) (Figure S3, Supporting Information). This indicates that PEGylated FVIOs exhibit better heating capacity even when internalized to cells or subjected to tissue phantoms. Taken together, the results clearly indicate that the PEGylated FVIOs retain a stable vortex structure, good suspension stability, and extremely high heat transfer efficiency. Thus, PEGylated FVIOs can be utilized to provide a viable FVIOs-mediated magnetic thermotherapy for combination with checkpoint blockade immunotherapy. FVIOs-mediated mild magnetic hyperthermia induces immunogenic cell death and promotes phagocytosis. Whether FVIOs-mediated moderate heat can trigger antitumor immunity and harness it for sensitizing tumors by anti-PD-L1 therapy, firstly the efficacy to induce cell apoptosis/necrosis was investigated. PEGylated FVIOs showed little cytotoxic effects (100 µg/mL) without AMF exposure (Figure S4A, Supporting Information). PEGylated FVIOs were internalized into vesicles after co-culture with 4T1 cells.52,

53

Quantitative study of cellular uptake at dosage of 50 µg/mL showed that the maximum accumulation of PEGylated FVIOs occurred at a co-incubation time of 8 h, which could be optimal time window for cell hyperthermia (Figure S4B, Supporting Information).54 As shown in Figure S4C, the cell viability reduced to 41% for FVIOs plus AMF treatment for 10 min under 30 kA/m AMF at 365 kHz frequency. On the contrary, 82% and 88% cell viability was observed for both FVIOs-treated and AMF-treated 4T1 cells, respectively. The treated 4T1 cells were stained with acridine orange/ethidium bromid. Green fluorescence was appeared almost the entire visual field for FVIOs-treated and AMF-treated alone, indicating that there was no noticeable cell death. By contrast, most of the 4T1 cells incubated with FVIOs for 8 h and then exposed to AMF were induced apoptosis and/or necrosis, evidenced with strong orange fluorescence (Figure S4D, Supporting Information). Flow cytometry of 4T1 cells stained with an Annexin V-FITC/PI cell apoptosis detection kit is to evaluate 8 ACS Paragon Plus Environment

Page 9 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

apoptosis/necrosis by FVIOs with AMF exposure. The results showed that cells incubated with FVIOs (50 µg/mL Fe) after AMF exposure of 5 min induced 38.42% early apoptosis and 48.96% late apoptosis. Cells treated with FVIOs plus AMF to 10 min largely increased the number of treated cells that underwent late apoptosis to 52.5% as well as inducing necrosis to 9.94%, respectively, demonstrating AMF exposure time dependence (Figure S5, Supporting Information). It is worth noting that no significant environmental temperature increase was observed during the FVIOs plus AMF treatment, indicating FVIO-mediated magnetic thermotherapy was carried out under mild temperature rather than the high temperature required by thermal ablation. Calreticulin (CRT) is considered as an "eat-me" signal and promotes phagocytic uptake of cancer cells by the immune system to induce immunogenic cell death (ICD).23 We further analysed the CRT exposure of the 4T1 tumor cells to verify whether FVIOs under AMF exposure could induce immunogenic phenotypes. CRT expression levels were investigated by both flow cytometry and RT-PCR. After incubation with FVIOs and AMF exposure, 4T1 tumor cells were stained with antibody (Alexa Fluor® 488 anti-CRT) and analyzed by flow cytometry, in accordance with CRT geometry mean fluorescence intensity. As shown in Figure S6A-B, FVIOs plus AMF induced CRT expression of 37.3% geometry mean fluorescence intensity, while only induced CRT expression of 12.6% and 12.6% geometry mean fluorescence intensity on FVIOs or AMF alone, respectively, suggesting that FVIOsmediated magnetic hyperthermia induces 4T1 tumor cell immunogenic properties. CRT expression was also determined by RT-PCR (Figure S6C, Supporting Information). The relative quantification of CRT is 3.4±0.4 for FVIOs plus AMF group, which is higher than that of FVIOs (2.2±0.4) or AMF alone (2.6±0.1), respectively, further suggesting that FVIOsmediated magnetic hyperthermia may induce the ICD of 4T1 tumor cells. Cytokine secretion is important to mediate sequential biological events of immune responses. Blood collected from 4T1 tumor bearing mice was analysed to assess the level of 9 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

immune response evoked by FVIO-mediated magnetic hyperthermia after receiving FVIOs plus AMF up to 17 days. The production of cytokines (IL-6, TNF-α, IFN-γ, and IL-18) in the serum was analyzed by enzyme-linked immunosorbent assay (ELISA). As shown in Figure S7A-D, the secretion of cytokines IL-6, TNF-α, IFN-γ, and IL-18 induced by magnetic thermals was obviously higher than that of FVIOs injection alone or AMF, indicating that FVIOs-mediated mild magnetic hyperthermia can elicit the phagocytosis of cancer cells by the immune system. FVIOs-mediated magnetic hyperthermia may induce the ICD of 4T1 tumor cells. The posttreatment residues of tumors may act as antigens to stimulate effector cells (such as macrophages, DC) and trigger immune responses. Firstly, we measure the distribution of particles in the tumor and analyze which cells in the tumor region take up the particles, FITClabeled FVIOs were directly injected into tumors (3 mice per group), after 24 h, the tumors were excised from the mice. The tumors were digested to single-cell suspension, and further was incubated with CD45-Alexa Fluor 700, CD 11c-BV 605, F4/80-PerCp Cyanine 5.5, CD11b-viole Fluor450 and Gr-1-APC. As shown in Figure S8, the percentages of tumor cells (CD 45-), T lymphocyte (CD45+CD3+), DC cells (CD 11c+), macrophage (CD 11b+F4/80+) and MDSCs (CD11b+Gr-1+) in the total tumor cells for taking up FITC-labeled FVIOs is 4.6%, 0.9%, 12.9% and 5.3%, respectively. Macrophages might be the principal populations to uptake FVIOs; and most of FVIOs might be kept within the extracellular matrix. And then, we investigated whether tumor residues may stimulate macrophages polarization (Figure S9, Supporting Information). 4T1 tumor cells were treated by FVIOs+AMF, after 12 h, their residues were co-culture with macrophages (RAW264.7) for 6 h, flow cytometry was used to analyze phenotypes of macrophages. Compared to macrophages co-culturing with untreated 4T1 cells residues, 4T1 cells were treated by FVIOs+AMF, their residues could promote M1 polarization. This suggested that the tumor residues post-FVIOs mediated hyperthermia

10 ACS Paragon Plus Environment

Page 10 of 40

Page 11 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

generated tumor-associated antigens which could trigger effective macrophages M1 polarization. FVIOs-mediated mild magnetic hyperthermia in combination with anti-PD-L1 eradicates the primary 4T1 tumors without recurrence. To test whether the antitumor immunity of FVIOs-mediated mild magnetic hyperthermia can sensitize tumors to immune checkpoint therapy, in vivo antitumor activity of FVIOs-mediated magnetic hyperthermia combined with anti-PD-L1 on 4T1 tumors was investigated. The time axis of the animal experiment is shown in Figure S10. When the tumor volumes were up to 100 mm3, orthotopic 4T1 tumor were subjected to five injections of FVIOs plus AMF treatments, as well as antiPD-L1 each over a period of 17 days. After the intratumoral injection of FVIOs (0.1 mg Fe/cm3 tumor) on days 5, 7, 10, 13, and 16, the tumors in anesthetized mice were exposed to an AMF with a frequency of 365 kHz for 10 min. Later anti-PD-L1 (75 µg/mouse) was intraperitoneally injected on alternate days (6, 9, 12, 15 and 17 day). As monitored by infrared thermal camera (Fotric 225), the temperature of tumor injected with FVIOs maintained in the range from ~43 ℃ to 44 ℃ during the treatment (Figure 2A and 2B). After treatment, the mice were intraperitoneally injected with anti-PD-L1 every other day. Figure 2C-E indicated that the delay of 4T1 tumor progression suffered a great failure in the PD-L1 blockade, FVIOs or AMF group. By contrast, FVIOs-mediated magnetic hyperthermia alone or FVIOsmediated magnetic hyperthermia combined with PD-L1 blockade treatment significantly prevented 4T1 tumor growth, indicating that the anti-tumor efficacies of the combination of FVIOs-mediated magnetic hyperthermia and PD-L1 blockade treatment were greater than that of either FVIOs or PD-L1 blockade treatment alone. To confirm the combination of FVIOs-mediated magnetic hyperthermia and PD-L1 blockade treatment, we further used bioluminescence imaging (BLI)

68, 70, 71

to dynamically

monitor the antitumor efficiency on orthotopic 4T1-fLuc tumor-bearing mice. The rapid enhancement of the BLI signal for PBS control, FVIOs only, and AMF exposure only 11 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

indicated that the tumors grew quickly after treatment in those groups and that those treatments were incapable of inhibiting tumor growth (Figure S11A-C, Supporting Information). Compared with the PBS control group, PD-L1 blockade alone slightly suppressed tumor growth because the BLI signal was weaker than that in the control group. Tumors subjected to treatment with FVIOs-mediated mild magnetic hyperthermia turned into a black scar at the tumor site. There was no BLI signal at the tumor site from day 8 until day 14, indicating that the FVIOs-mediated magnetic hyperthermia effectively eliminated the 4T1-fLuc tumor, consistent with the tumor volume changes described above. However, a small BLI signal was observed, it was presumed to be arising from recurrence of the 4T1fLuc tumor at the tumor site on day 17 after the FVIOs-mediated magnetic hyperthermia. It is obvious that the BLI signal intensity increased gradually with the recurrence of tumors surrounding the scar. However, for the FVIOs-mediated magnetic hyperthermia combined with PD-L1 blockade treatment, there was no detectable level of BLI signal during the 20-day experimental period, indicating that complete remove of the tumors was achieved. Further extend the observational period to 32 days, there is still no detectable level of BLI signal for the FVIOs-mediated magnetic hyperthermia combined with PD-L1 blockade treatment. (Figure S12, Supporting Information). In addition, no body weight loss (Figure S13, Supporting Information) and no obvious pathological changes in the main organs (Figure S14, Supporting Information) were observed in the FVIOs-mediated magnetic hyperthermia plus PD-L1 blockade-treated group, indicating the relative safety of the combination treatment. In general, the above data identified that the therapeutic efficiency of FVIOs-mediated magnetic hyperthermia plus anti-PD-L1 immunotherapy improved the inhibitory effect on tumor recurrence compared to FVIOs-mediated magnetic hyperthermia alone. FVIOs-mediated mild magnetic hyperthermia in combination with anti-PD-L1 prevents lung metastasis of 4T1 tumors. Breast cancer has a high rate of metastasis, which are particularly opportunistic in the lungs.55, 56 Encouraged by the excellent performance of 12 ACS Paragon Plus Environment

Page 12 of 40

Page 13 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

FVIOs-mediated magnetic hyperthermia combined with PD-L1 blockade in an orthotopic 4T1 tumor model, we next attempted to investigate the anti-metastatic effect of the combination therapy. The animal experiment design has been shown in Figure 3A. Consistent with the above results, by comparison with PD-L1 blockade treatment group, FVIOs-mediated magnetic hyperthermia alone or FVIOs-mediated magnetic hyperthermia in combination with PD-L1 blockade treatment significantly inhibited the growth of 4T1 tumor (Figure 3E). We further attempted to investigate whether metastases occurs before the treatment. After five days of tumor inoculation, the sacrificed mice was assessed for the extent of lung metastasis by using white light and BLI imaging. As shown in Figure S15, there are no tumor nodules found in the lung of the mice before receiving the treatment. Twenty days after tumor inoculation, the mice in the different treatments were sacrificed to study the extent of metastasis to the lungs using white light, BLI imaging, and histology. As shown in Figure 3B and 3F, the white-light images showed that there were more than 20 tumor nodules in the PBS, FVIOs-only and AMF-only groups, whereas the number of tumor nodules was reduced to approximately 10 and only one or two in the lungs of the mice receiving PD-L1 blockade alone or FVIOs-mediated magnetic hyperthermia, respectively. More interestingly, tumor nodules were not found in the lung of the mice receiving the combination treatment. BLI was further utilized to accurately and sensitively observe the tumor nodules in the lung; only metastatic cancer cells specifically engineered to emit visible light can be detected in this analysis. No BLI signal was detected in the combination treatment, but a signal was detected in the PBS control, FVIOs-only, AMF-only, anti-PD-L1 alone and FVIOs-mediated magnetic hyperthermia groups (Figure 3C). Compared to the PBS control, FVIOs only and AMF only, FVIOs-mediated magnetic thermotherapy or anti-PD-L1 alone enabled prevention of lung metastasis to a certain extent, whereas in the combination treatment, the tumor nodules completely disappeared according to the BLI signal. Finally, the lungs were dissected and stained with H&E to quantify the proportion of metastasis in the whole lung. Figure 3D and 13 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3G showed approximately 51%, 34%, 33%, 17%, and 12% of the lungs were metastasis by tumors in the PBS control, FVIOs-only, AMF-only, anti-PD-L1 alone and FVIOs-mediated magnetic hyperthermia groups, respectively. These data showed that the combination treatment can eradicate most of the metastatic tumors in the lung, evidenced by the significant decrease in both numbers and area percentage of metastases from 52 % and 25 % to both less than 1%. Hence, FVIOs+AMF+anti-PD-L1 combination therapy prevents them from being metastasized. The secretion of cytokines induced by FVIOs+AMF was obviously higher than that of FVIOs injection alone or AMF, indicating that can elicit the phagocytosis of cancer cells by the immune system. This produced tumor-specific immunity and further improved the efficacy of anti-PD-L1 therapy, leading to the prevention of metastasis to the lung. Saeid Zanganeh et al.

44

reported that ferumoxytol was able to reduce pulmonary metastasis in the

mouse model of small-cell lung cancer (SCLC) liver metastases. It is possible that metastatic cells may contain FVIOs, and protect from development of lung metastases by inducing proinflammatory macrophage responses. FVIOs-mediated mild magnetic hyperthermia in combination with anti-PD-L1 inhibits abscopal tumor growth. A bilateral orthotopic 4T1 tumor model was utilized to assess whether the antitumor immune response induced by FVIOs-mediated magnetic hyperthermia plus anti-PD-L1 is effective for the distant tumors. The experimental design for animal is shown in Figure 4A. We orthotopically inoculated 4T1 tumor cells into the left and right fat pads of mouse. Left flanks tumors were designated the primary tumors for FVIOsbased magnetic hyperthermia, and the distant tumors in the right flanks were not subjected to treatment to provide an artificial model of pre-existing secondary metastatic tumors. These mice were divided into 4 groups: (1) PBS; (2) anti-PD-L1 alone; (3) FVIOs-mediated magnetic hyperthermia; and (4) FVIOs-mediated magnetic hyperthermia plus anti-PD-L1. The primary tumor was treated by FVIOs+AMF on days 5, 7, 10, 13 and 16. The mice were then intraperitoneally injected with a PD-L1 antibody on days 6, 9, 12, 15, and 17. The 14 ACS Paragon Plus Environment

Page 14 of 40

Page 15 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

growth of both the primary and the secondary tumor for the different treatment groups was measured by a Vernier caliper and also detected by BLI. FVIOs were only directly injected into the primary tumor and under the AMF exposure. Figure 4B-D revealed the little effect of anti-PD-L1 alone on the inhibition of both primary and distant secondary tumors. In mice with primary tumors treated by FVIOs+AMF, the primary tumors were effectively inhibited, but the growth of the distant tumors was partially delayed. However, the combination treatment completely eradicated the magnetic thermotherapy-treated primary tumors and significantly slowed the growth of the magnetic thermotherapy-untreated distant tumors (particularly in the first 20 days) in mice. In comparison with the PBS control group, PD-L1 blockade and FVIOs-mediated magnetic thermotherapy alone inhibited 4T1 distant tumor growth with 15% and 51% reductions of tumor volume, respectively, whereas a significant reduction of 71% in tumor volume was observed for the combination treatment. The mice from different treatment groups did not display an obvious body weight loss, and there no statistical significance among the groups (Figure S16, Supporting Information). The inhibitory effects on both primary and distant tumors in 4T1-fLuc tumor-bearing mice were simultaneously monitored by BLI. Figure 5A-E showed the increased BLI signals of both primary and distant tumors with time in the groups treated with PBS and anti-PD-L1 alone, indicating that those groups failed to inhibit tumor growth. In comparison with PBS group, the anti-PD-L1, FVIOs-mediated magnetic thermotherapy and combination treatments produced reduction of 25%, 50% and 87% in the BLI average light intensity signal in the distant tumors, as well as 10%, 50% and 75% reductions of the BLI overall light intensity, respectively. Overall, the combination therapy has the potential to completely eradicate the primary tumors as well as significantly inhibit the growth of distant secondary tumors. FVIOs-mediated mild magnetic hyperthermia in combination with anti-PD-L1 activates antitumor immunity of tumor-specific T cells in vivo. In consistence with previous literature reports, the 4T1 tumor has shown a relatively poor response to anti-PD-L1 15 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

therapy.5 The response rated and the sensitizing of 4T1 tumors to checkpoint therapy might be improved by inducing immunogenic tumor microenvironments with enhanced infiltration of T cell. Currently, it has been reported that the efficacy of checkpoint blockade immunotherapy could be improved by combining with other immunogenic nanotechnology-based therapies such as photothermal therapy and/or photodynamic therapy.19, 20, 23-25 As a clinically approved therapy, magnetic nanoparticles-mediated mild thermotherapy possesses competitive advantages in terms of high tissue penetration, safety, and selectivity. We hypothesized that the FVIOs-mediated magnetic thermotherapy may induce the host immune response to inhibit the growth of tumor and metastasis. In order to assess the effects of the combination of magnetic thermotherapy with PD-L1 blockade on antitumor immunity, we firstly analysed the tumor-infiltrating leukocytes for 7 days after the first cycle treatment (FVIOs+AMF+anti-PD-L1) for both primary and distant tumors in all groups (Figure S17, Supporting Information). The mice treated with FVIOs+AMF+anti-PD-L1 showed an insignificant difference in all immune cell types except for CD45+ cells in lymphocytes of both primary and distant tumors as well as CD3+ cells in CD45+ cells of primary tumors. The percentage of CD45+ cells in lymphocytes in primary tumors of FVIOs+AMF+anti-PD-L1 treated mice increased with respect to FVIOs+AMF only treated group. The percentage of CD3+ cells in CD45+ cells in the primary tumors and CD45+ cells in lymphocytes in the distant tumors significantly increased for FVIOs+AMF+anti-PDL1 treated mice, respectively. The tumor-infiltrating leukocyte were further analysed for distant tumors after the fifth cycle treatment. At this stage, the primary tumor disappeared after the combination therapy. Hence, antitumor immune response was validated by determining the presence or absence of tumor-specific T lymphocytes only for the distant tumors. Figure 6A showed that the percentage of CD45+ cells in lymphocytes increased by 2.38-fold in the combination treatment group (63.05±5.946%) compared to the PBS control group (18.65±3.945%). The percentages of CD3+ T cells among total CD45+ cells increased 16 ACS Paragon Plus Environment

Page 16 of 40

Page 17 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

by approximately 2.25-fold in the combination treatment group (25.84±12.23%) in comparison with the PBS group (7.955±1.921%) (Figure 6B). Specifically, the percentage of CD4+ helper T lymphocytes increased in anti-PD-L1 group (44.65±1.447%) in comparison with the PBS group (26.86±1.567%) (Figure 6C), whereas the percentage of CD8+ cytotoxic T cells significantly increased in FVIOs+AMF group (55.4±5.306%) in comparison with the PBS group (29.45±2.089%) (Figure 6D). The percentages of CD8+ T lymphocytes (64.48±6.648%) and CD4+ T lymphocytes (54.24±1.699%) all increased in the combination treatment group compared to the anti-PD-L1 treated group (CD8+ T cells, 34.52±7.828%; CD4+ T cells, 44.65 ± 1.447%) and FVIOs+AMF group (CD8+ T cells, 55.4±5.306%; CD4+ T cells, 26.63±2.696%). These results indicated that both PD-L1 checkpoint blockade and FVIOs-mediated magnetic thermotherapy play important roles in promoting dramatically increased tumor-specific T cell infiltration in distant tumors. It is obvious that percentages of CD3+ T cells among total CD45+ cells, CD8+ T lymphocytes and CD4+ T lymphocytes increases in the distant tumors as time after FVIOs+AMF+anti-PD-L1 treatment. PD-L1 checkpoint blockade and FVIOs-mediated magnetic hyperthermia accelerate the increase in the infiltration and accumulation of both CD8+ cytotoxic T lymphocytes and CD4+ helper lymphocytes at distant tumor sites, respectively, whereas the combination treatment potentiates the activation of tumor-specific T lymphocytes responses to control the growth of distant tumors. An improved and efficient immune response activation of both CD4+ and CD8+ T lymphocytes is required. The infiltration of tumor-specific cytotoxic T cells has been associated with better patient survival in cancers.57,

58

Hence, high numbers of CD8+ T

lymphocytes infiltration at the tumor site would be desirable. However, the presence of CD4+ T cells is considered to be a double-edged sword because CD4+ T cells is a key point in the initiating and keeping antitumor immune responses.59 The generation of a specific cytotoxic T-cell response is thought to be dependent on the adequate assist from activated CD4+ T cells. Hence, CD4+ T lymphocytes should be required to be existed as CD8+ T cells always demand 17 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

CD4+ T cells to optimally function. Hence, the increase of both CD4+ and CD8+ T cells in the combination treatment resulted in the controlling of distant tumor progression. The antitumor immune response elicited by the combination therapy was further investigated by multispectral immunofluorescence imaging assay. We found that the combination therapy enhanced CD3+ T cell infiltration in the distant tumors, whereas little CD3+ T cells were observed in the PBS group. In addition, a high proportion of the tumorinfiltrating CD3+ T cells were CD8+ and CD4+ (Figure 7A), indicating the ability of FVIOsmediated magnetic thermotherapy plus anti-PD-L1 to drive effective T-cells infiltration into tumors. In this study, as shown in Figure 7B, the overall mean proportion of CD3+CD4+ T cells and CD3+CD8+ T cells in the combination treatment group was significantly higher than that in the PBS group (2.228±0.29 versus 0.47±0.19; 1.125±0.11 versus 0.137±0.01), respectively. Moreover, the increase ratio of CD3+CD8+ T cells for the combination therapy group is 7.24, which is 97% higher than the increase ratio of CD3+CD4+ T cells for the combination treatment group (3.68), further indicating the combination treatment induced an efficient immune response for destroying tumor cells. FVIOs-mediated mild magnetic hyperthermia in combination with anti-PD-L1 also inhibits the immunosuppresive response of anti-tumor in vivo. Regulatory T (Treg) cells are frequently found in tumor tissues for various types of cancers such as breast. Treg cells mainly prevent anti-tumor immune response. The infiltration of a large number of Treg cells into tumor is in conjunction with poor prognosis. Our results showed that the percentage of CD25+ in CD4+ T lymphocytes in tumors treated with FVIOs-mediated magnetic thermotherapy (15.50±3.559%) and with the combination treatment (15.77± 6.26%) were reduced in comparison with the PBS control group (42.50 ± 3.978%) (Figure 6E). It is wellknown that cancer progression is tightly linked with the tumor microenvironment (TME). One of the major cell components in TME is myeloid-derived suppressor cells (MDSCs). The function of MDSCs is to drive directly or indirectly tumor growth, recurrence and metastasis. 18 ACS Paragon Plus Environment

Page 18 of 40

Page 19 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Of note, we found that MDSCs in the TME were obviously down-regulated in the combination treatment group (Figure 6F). These data suggest that the combination therapy not only initiates activation of tumor-specific T lymphocytes, but also inhibits immunosuppresive response of anti-tumor. Collectively, we demonstrated that FVIOs-mediated magnetic thermotherapy could sensitize tumors to checkpoint blockade therapy (Figure 8): FVIOs-mediated magnetic thermotherapy can activate anti-tumor immune response effectively through both induced ICD and released tumor-specific antigens to stimulate the polarization of macrophages and production of tumor-specific T lymphocytes. In addition, FVIOs-mediated magnetic thermotherapy could elicit an inflammatory environment to further enhance the T lymphocytes infiltration in distant tumors. As a result, FVIOs-mediated magnetic thermotherapy combined with anti-PD-L1 can realize an efficient treatment, which not only eliminated the primary 4T1 tumors, but also inhibited 4T1 tumor relapse and prevented metastasis to lung. The combination therapy also produced an inhibition of the magnetic thermotherapy-untreated distant tumors by activating a systemic antitumor immune response. In addition, immunosuppressive cell, including MDSC and Treg, are associated with immune escape. The elevated levels of MDSCs, Treg, and immune checkpoints (IC) are observed in the TME. Therapeutic agents have been reported to target MDSC and block IC for activating anti-tumor immunity and preventing the tumor immune escape. Therefore, it is vital to investigate the anti-tumor immune mechanism of FVIOs-mediated magnetic thermotherapy combined with PD-L1 blockade in future research. CONCLUSIONS In summary, we have designed a safe and effective approach by biocompatible FVIOsmediated mild magnetic hyperthermia in combination with PD-L1 blockade, which could activate antitumor immunity of tumor-specific T lymphocytes and inhibits the immunosuppressive response of antitumor in vivo. Favourable anti-tumor and anti-metastasic 19 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

efficacies were also observed when this strategy was used to treating orthotopic 4T1 breast tumor, preventing lung metastasis and inhibiting distant tumor progression in abscopal tumor model by generating systemic antitumor immunity. Subsequent flow cytometry and multiplex immunohistochemistry imaging demonstrate that this combinational strategy could curb tumor growth mainly by the activation of systemic tumor-specific T lymphocytes with simultaneous infiltration of CD8+ and CD4+ T lymphocytes along with the down-regulation of MDSCs. Considering that magnetic hyperthermia treatment has been already clinically available, the proposed combination treatment technique may have bright prospects for future clinical translation. In particular, this combination technique would benefit for the small proportion of cancer patients who poorly respond to current immune checkpoint treatments. The results encourage the potential clinical translation. To the end, future evaluations in large animal models are expected to optimize particle amount and treatment frequency. EXPERIMENTAL SECTION Cell Lines and Animals. Murine mammary carcinoma 4T1 cells were purchased from American Type Culture Collection (ATCC, USA). 4T1 cells were grown in 1640 Medium (Life Technologies, USA), supplemented with 10% foetal calf serum (FCS) (Life Technologies, USA). The environment was in 5% CO2 at 37 °C. 4T1-fLuc cells were transfected with luciferase-containing viruses. Female Balb/c mice (5 weeks, 15-18 g) were provided by the Peking University Health Science Center (Department of Experimental Animals), China. The protocol was reviewed and approved by the Institutional Animal Care and Use Committee of Peking University under Permit Number 2011-0039. Preparation and Characterization of the PEGylated FVIOs. Fe3O4 nanorings were fabricated according to our previous report.60, 61 4arm-PEG-NH2 was capped on the surface of FVIOs to obtain PEGylated FVIOs suspension. Fe3O4 nanorings (0.5 mg) were dispersed into 1 mL DI water under ultrasonication. 4arm-PEG-NH2 (100 mg) was mixed with the 20 ACS Paragon Plus Environment

Page 20 of 40

Page 21 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

suspension, and stirred under magnetic stirrer. The mixture was refluxed at 100°C for 4 h at a constant Ar gas flow. The PEGylated FVIOs were obtained at 8000r/min centrifugation for 10 min. PEGylated FVIOs were dispersed in water after removing the supernatant. Fe concentration of PEGylated FVIOs was analysed by GGL-ICP-MS (NexION 300X). The crystal phase was characterized by XRD patterns (Bruker D8 Advanced Diffractometer System). The sample morphology was examined by TEM (JEOL 100CX). The magnetic domain structures were measured by Lorentz TEM. Combined with magnetic transport-ofintensity (TIE) equation calculation, the lateral magnetization distribution was mapped out with the colour wheel representing the magnetization direction at every point. The hydrodynamic sizes were characterized by a Malvern Zetasizer Nano-ZS. The magnetic properties were characterized by a Vibrating Sample Magnetometer (VSM) (LakeShore Model 7407). Cytotoxicity Assay, Cellular Uptake and Apoptosis Analysis In Vitro. a. The cytotoxicity of PEGylated FVIOs was measured on 4T1 cells. 4T1 cells (5×103 cells/well) were seeded in 96-well plates for 24 h. Then, FVIOs@PEG suspension at different Fe concentrations was added in the cell culture medium and co-cultured with cells for 24 h. Cell viability was measured by CCK-8 assay (Promega, Madison, WI). b. 4T1 cells (1×105 viable cells/mL/well) were cultured in 6 well plates for 24 h. FVIOs suspension with designated Fe concentrations replace the medium. After designated incubation time (1 h, 2 h, 4 h, 8 h, and 24 h), cells were washed three times with 1×PBS to remove redundant FVIOs suspension. Cells were immersed in aqua regia. After 1 h incubation under gentle shaking, GGL-ICP-MS (NexION 300X) was used to analyse the Fe concentration. c. 4T1 cells (1×105 viable cells/mL/well) were cultured in 6 well plates for 24 h. FVIOs suspension with designated Fe concentrations replace the medium. After 8 h incubation, cells were washed three times with 1×PBS and detached from the wells. The cell suspension was 21 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 40

exposed to AMF at 365 kHz frequency for 10 min. At last, cells were re-seeded in 96 well plates for incubation 24 h to perform the CCK-8 assay. Acridine orange and ethidium bromide stained 4T1 cells after treatment. Microscope (Nikon Eclipse TS100, Nikon Corporation, Japan) was used to observe the live and dead cells. Annexin V-FITC/PI cell apoptosis detection kit stained 4T1 cells after treatment. Flow cytometry of 4T1 cells is to evaluate apoptosis/necrosis by FVIOs with AMF exposure. In Vitro Calreticulin Assay and Macrophages Polarization. Flow cytometry is to analyse CRT exposure which induced by FVIOs-mediated magnetic thermotherapy. 4T1 breast cancer cells were cultured with FVIOs (50 µg/mL) for 8 h. Then, cells were exposed to an AMF with a frequency of 365 kHz for 10 min. The cells were collected after incubation for 4 h, and further incubated with Alexa Fluor® 488 anti-CRT antibody for 2 h. CRT exposure induced by FVIOs-mediated magnetic thermotherapy was also evaluated by RT-PCR. Firstly, total RNA was isolated by using the TRIzol Reagent (Invitrogen). The primers are designed in the following Table 1. RT-PCR was carried out by One Step TB Green® PrimeScriptTM RT-PCR Kit II (Perfect Real Time). Table 1. Primers for RT-PCR assay Name

Forward Primer

Reverse Primer

GAPDH

GTCAAGGCTGAGAACGGGAA

AAATGAGCCCCAGCCTTCTC

CRT

ACAAGGGCAAGAATGTGCTG

GGTGGCAGAAAGTCCCAATC

For in vitro macrophages stimulation experiments, we co-cultured macrophages RAW264.7 with 4T1 cancer cells’ residues after FVIOs plus AMF treatment. RAW264.7 stained with anti-CD86-FITC, and then analyzed by flow cytometry. Anti-Tumor and Anti-Metastatic activity of Different Treatments in an Orthotopic 4T1 Tumor-Bearing Mouse Model. 2×106 4T1-fLuc cells were injected into the mammary fat pad of Balb/c mice to establish tumors. When the tumor volumes reached approximately 100 mm3, mice were divided into six groups (n=6) randomly: PBS (control), FVIOs only, 22 ACS Paragon Plus Environment

Page 23 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

AMF only, anti-PD-L1 only, FVIOs+AMF, and FVIOs+AMF+anti-PD-L1. The design of our animal experiment is shown as the following time axis. Tumor-bearing mice were subjected to five injections of FVIOs and AMF treatments, as well as anti-PD-L1 each over a period of 17 days. After the intratumoral injection of FVIOs (0.1 mg Fe/cm3 tumor) on days 5, 7, 10, 13 and 16, the mice under anesthetized condition by using 2% (v/v) isoflurane were exposed to an AMF with a frequency of 365 kHz for 10 min. Later anti-PD-L1 (75 µg/mouse) was intraperitoneally injected on days 6, 9, 12, 15 and 17. The tumor volume was calculated by the equation (width2×length)/2. The length and width were measured by a digital caliper. Body weights were monitored throughout the whole experimental period. At the end, the tumors were resected, weighed as well as photographed. Lungs were also resected, and were observed metastatic nodules by light microscopy, or sectioned and stained with H&E for quantification of the area of metastasis. Cytokines Release In Vivo. 2×106 4T1-fLuc cells were injected into the mammary fat pad of Balb/c mice to form tumors. When the tumor volume reached approximately 100 mm3, the tumor-bearing mice were divided into four groups (n=6) in random: PBS (control), FVIOs only, AMF only, and FVIOs+AMF. After the intratumoral injection of FVIOs (0.1 mg Fe/cm3 tumor) on days 5, 7, and 10, the mice under anesthetized condition by using 2% (v/v) isoflurane were exposed to an AMF with a frequency of 365 kHz for 10 min. Blood was collected on day 17, and TNF-α, IL-6, IL-18, and IFN-γ production was measured by enzyme linked immunosorbent assay (DENLEY DRAGON Wellscan MK 3). Abscopal Effect on an Orthotopic 4T1 Model. 2×106 4T1-fLuc cells are injected into the left mammary fat pad (primary tumor) and 1×105 4T1-fLuc cells into the right mammary fat pad (secondary tumor). When the primary tumors reached 100 mm3, the tumor-bearing mice were divided into four groups (n=4) in random: PBS as a control, anti-PD-L1 only, FVIOs+AMF, and FVIOs+AMF+anti-PD-L1. FVIOs (0.1 mg Fe/cm3 tumor) were injected directly into the primary tumor, and AMF was exposure every 2 days with a frequency of 365 23 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

kHz for 10 min, for a total of five treatments. After AMF exposure, PD-L1 blockade at a dose of 75 µg/mouse was injected intraperitoneally with every other day. The tumor volume was calculated according to the measured tumor length and width by a digital caliper. In Vivo BLI of Tumors and Lungs. BLI was dynamically observed the solid tumors and lung metastasis in vivo using the photonIMAGER optima system (Biospace Lab SA, France). The mice were injected intraperitoneally D-luciferin solution (40 mg/mL, 100 μL). The BLI light intensity was analysed by the M3Vision software (Biospace Lab SA, France). The region of the tumors or lung metastasis for each mouse was analysed based on BLI light intensity. The BLI were normalized and reported as photons per centimetre squared per second. Flow Cytometry Analysis. For analysing the immune cells on the both side tumors of mice, the tumors were resected from the mice and digested using collagenase I (0.05 mg/mL, Sigma), DNase (30 U/mL, Sigma), and hyaluronidase (Sigma) at 37 °C for 30 min. The cells were filtered and washed with PBS. CD45-Alexa Fluor 700 (Biolegend), CD3-PE561 (Biolegend), CD4-BV510 (Biolegend), CD8-PE Cyanine 7 (Biolegend), CD25-FITC (Biolegend), CD11b- PerCP-Cyanine 5.5 and Gr-1-APC Cyanine 7 were added in the single cell suspension. The cells were then washed with PBS for three times. Flow cytometry analysis was performed by using FACSAria II (BD Biosciences) and FlowJo 10.0.7 software (Tree Star, Ashland, OR). The gating strategy is shown in the Supporting Information Figure S18. To analyze which cells in the tumor take up the particles and on the distribution of particles in the tumor, FITC-labeled FVIOs directly injected into tumors (3 mice per group), after 24 h, the tumors were resected from the mice and digested. The single cell suspension was incubated with CD45-Alexa Fluor 700, CD 11c-BV 605, F4/80-PerCp Cyanine 5.5, CD11bviole Fluor450 and Gr-1-APC. The cells were washed with PBS. The flow cytometry is for analysis.

24 ACS Paragon Plus Environment

Page 24 of 40

Page 25 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Multiplex Immunohistochemistry. To conduct multiplexed staining, we followed the previously described OPAL serial immunostaining protocol. The markers are: CD8 (1:500, ab209775, abcam) with by using Opal-570; CD4 (1:1000, ab182685, abcam) with subsequent visualization using Opal-520; CD3 (1:100, ab5690, abcam) with subsequent visualization using Opal-690. DAPI staining (0.5 μg/mL, Sigma, D9542) was used to visualize nuclei. Antifade Mounting Medium (I0052; NobleRyder, Beijing, China) was utilized to cover-slip all of sections. Each of the indibidually stained section (CD8/Opal-570, CD4/Opal-520, CD3/Opal-690, and DAPI) were used to set up the fluorophores spectral library for multi-spectral analysis. Vectra slide scanner (PerkinElmer) under fluorescent conditions was used to scan the slides. Statistics. Statistical analysis was performed by using Graph Pad Prism Version 5.0 Software. Two-tailed paired and unpaired student’s t tests were used to analyze differences within groups and between groups. Data are reported as mean values ±SEM. *indicates Pvalues of