Article pubs.acs.org/JAFC
Impact of Postharvest Nitric Oxide Treatment on Lignin BiosynthesisRelated Genes in Wax Apple (Syzygium samarangense) Fruit Yuqi Hao, Fahe Chen,* Guangbin Wu, and Weiya Gao College of Food and Biological Engineering, Jimei University, Xiamen, China ABSTRACT: The role of nitric oxide (NO) during storage in wax apple through NO (10 μL/L) fumigate fruit was investigated. Wax apple fruit treated with NO had a significantly lower rate of weight loss, a softening index, and loss of firmness during storage. The transcriptional profile of 10 genes involved in lignin biosynthesis has been analyzed using quantitative real-time polymerase chain reaction (qRT-PCR). The qRT-PCR analysis showed nine genes regulated in the wax apple (p < 0.05) upon NO fumigation, which coincided with the enzyme activity results (NO group lower than control group in peroxidase, phenylalanine ammonia-lyase, and 4-coumarate-CoA ligase), whose total lignin content decreased upon treatment with NO. These results indicate that NO treatment can effectively delay the softening and senescence of wax apple fruit and play an important regulatory role in lignin biosynthesis. KEYWORDS: wax apple, nitric oxide, lignin, gene expression, enzymes
■
phenylalanine to cinnamic acid is the first step of the phenylpropanoid pathway. A series of enzymatic hydroxylations and methylations lead to the generation of coumaric acid and other acids with a phenylpropane (C6−C3) unit. Conversion of these acids to their corresponding esters and aldehydes and further reduction provide monolignols. These monolignols are incorporated into lignin and used as plant secondary cell walls. Different abiotic stresses, such as nitric oxide,10 mineral deficiency,11 drought,12 ultraviolet-B (UV-B) radiation,13 and low temperatures,14 as well as biotic stresses, such as infection by bacteria or fungi,15 cause changes in the lignin contents of various plants.16 The emission of nitric oxide (NO) from plants and its effects on plant growth were described in the early 1970s.17 NO plays important roles in plant cells, with well-known functions in enzyme regulation, anti-apoptotic response, and signal transduction.18 The short-term application of NO gas at low concentrations was found to extend the postharvest life of a range of vegetables and fruits by delaying ripening or inhibiting senescence.19 NO treatment extends the postharvest life of some fresh horticultural produce, including lettuce,20 banana,21,22 longan,23 peach,18 and papaya.24 NO might have a profound effect on fruit by inhibiting ethylene production,21 reducing oxygen and elevating carbon dioxide levels,20 and affecting energy metabolism.22 Previous reports have suggested that NO may impact the activity of enzymes related to lignin biosynthesis and regulate their gene transcription level. Böhm et al. revealed that treatment with the NO donor sodium nitroprusside induced an increased level of lignification and activities of related enzymes (PAL and POD) in soybean seedlings.25 The results of Georgina et al. showed that a finetuning regulation of NO levels could regulate lignin
INTRODUCTION Wax apple is a characteristic fruit resource with excellent quality and special flavor in Southeast Asia. It undergoes massive physiochemical changes in a very short period of time as a consequence of the activation of biochemical pathways. Several fruit qualities, including appearance, flavor, and nutritional value, decline quickly after fruit is harvested. Our previous research shows that the cell wall, sugar metabolism, and level of energy charge have a certain relevance with respect to the cottony softening process of wax apple fruit. 1−3 The corresponding digital gene expression (DGE) results showed that phenylalanine metabolism was significantly enhanced, and sugar metabolism and phenylalanine metabolism significantly decreased the level of expression during the early storage of NO-treated fruits.4 The effects of postharvest treatments with different concentrations of NO (0−200 μL/L) on physiological changes were investigated. Treatment with 10 μL of NO/L could extend shelf life, maintain a higher ATP content, delay the activity peak of ploygalacturonase (PG) and cellulase (Cx), and inhibit disintegration of the cell wall.1,3The phenomenon of softening in pulp after harvest was correlated with cell wall structural changes during storage.5 Lignin, an aromatic heteropolymer, has an effect on the hydrophobicity, strength, and rigidity of plant secondary cell walls.6 The p-coumaryl alcohol, coniferyl alcohol, and sinapyl alcohol are three monolignol monomers with different degrees of methoxylation. These lignols are converted to three forms of lignin, the phenylpropanoids guaiacyl (G), syringyl (S), and phydroxyphenyl (H), respectively.7 Lignin can be quantified by removing all other cell wall constituents (for example, Klasone lignin determination).8 Biosynthesis of the monolignols through the phenylpropanoid pathway is currently a wellestablished method.9 The proposed phenylpropanoid biosynthetic pathway in plants is shown in Figure 1. Phenylpropanoids have a wide variety of functions as both structural and signaling molecules, which are synthesized from phenylalanine. Phenylalanine ammonia-lyase (PAL) converting © XXXX American Chemical Society
Received: July 23, 2016 Revised: October 12, 2016 Accepted: October 13, 2016
A
DOI: 10.1021/acs.jafc.6b03281 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
Figure 1. Biosynthesis pathway of lignin in plants. Abbreviations: PAL, phenylalanine ammonia-lyase (EC 4.3.1.24); POD, peroxidase (EC 1.11.1.7); GLU, β-glucosidase (EC 3.2.1.21); C3H, p-coumarate 3-hydroxylase (EC 1.14.13.-); CAD, cinnamyl-alcohol dehydrogenase (EC 1.1.1.195); F5H, ferulate-5-hydroxylase (EC 1.14.-.-); 4CL, 4-coumarate−CoA ligase (EC 6.2.1.12); CCoAOMT, caffeoyl-CoA O-methyltransferase (EC 2.1.1.104); CA, coniferyl-aldehyde dehydrogenase (EC 1.2.1.68); C4H, trans-cinnamate 4-monooxygenase (EC 1.14.13.11). was determined using a TMS-PRO texture analyzer (Food Technology Corp.) with a 5 mm diameter probe at a speed of 60 mm/min and expressed in newtons.28 Measurements were taken on both the cottony and noncottony softening areas of each individual fruit. Softening index was recorded by the percentage of longitudinal cottony softening area in the total longitudinal area (cut wax apple longitudinally from the middle and estimated softening index). Six random fruits were used for each postharvest period. Klason Lignin Determination and Enzyme Assays. The Klason method calls for 10 g (m) of sample to be hydrolyzed in 12 mL of 70% H2SO4 for 1 h at 40 °C. The slurry was then diluted to 4% H2SO4 and refluxed at 100 °C for 1 h.29 The materials were then washed and transferred to flasks. At the end of the reaction, solids were retained using filter papers (oven maintained at 60 °C until the samples were weighed, m0). The samples were then washed and dried utilizing an oven maintained at 60 °C until they were weighed (m1).30 Klason lignin is calculated by the following formula:
composition by affecting genes related to lignin biosynthesis such us cinnamyl alcohol dehydrogenases (CADs), caffeoylCoA O-methyltransferase (CCoAOMT), 4-coumarate−CoA ligase (4CL), etc., in plants.26 In this study, we determined the potential impact of NO in regulating fruit ripening, evaluated the expression levels of genes related to phenylpropanoid biosynthesis with reference to transcriptome data in different samples using quantitative real-time polymerase chain reaction (qRT-PCR), and analyzed related enzymes. This work improves our understanding of the relationship between NO-induced cottony softening delay and lignin biosynthesis in wax apple fruits.
■
MATERIALS AND METHODS
Plant Material and Treatment. Wax apple fruits were harvested at commercial maturity from Taiji Orchard in Taiwan, China. The fruits were selected for uniform size (the fruit is bell-shaped and 6−8 cm long in wild plants), maturity (commerce maturity), and an appearance that was free of defects and mechanical damage. Wax apple fruits (84 per group) remained untreated (control fruit) or were treated with NO (NO-treated fruit). The fruits were sealed in glass containers and flushed with nitrogen gas (to displace all oxygen due to rapid oxidation of NO to nitrogen dioxide), and for NO treatment, pure NO gas (provided by Linde Industrial Gases, Xiamen, China) was added to the chambers to a final NO concentration of 10 μL/L, based on our previous work.27 The containers remained sealed for up to 2 h, after which the fruit was stored at 3 ± 0.5 °C and 85 ± 2% relative humility for 12 days. Samples were initially taken at 2 day intervals during storage. Weight loss, flesh firmness, and softening index were immediately measured, and the samples were frozen in liquid nitrogen and stored at −80 °C until they were used. Each treatment was repeated three times. Measurement of Weight Loss, Firmness, and Softening Index. Weight loss was determined by subtracting the final weight from the initial weight of the clusters and then expressed as the percent weight loss with reference to the initial weight. Fruit firmness
lignin content (%) = (m1 − m0)/m × 100% POD activity was measured in samples (4 g) from six fruits that were homogenized in 12 mL of 50 mM phosphate buffer (pH 7.0) containing 1% polyvinylpyrrolidone. The homogenate was centrifuged for 25 min at 12000 rpm and 4 °C, and the supernatant was collected for the enzyme assay. POD activity was assayed using the method of Duan et al.23 The POD reaction system included 2.4 mL of 0.05 M phosphate buffer (pH 7.0), 0.1 mL of enzyme extract, 0.1 mL of 1% H2O2, and 0.4 mL of 1% guaiacol.31 The increased absorbance at 470 nm due to guaiacol oxidation was recorded for 2 min. One unit of enzyme activity was defined as the amount that caused a change of 0.01 in the absorbance per minute. For the PAL activity assay,32 tissues (10 g) from six fruits were homogenized in 10 mL of 50 mM borate buffer (pH 8.0) containing 0.5% polyvinylpyrrolidone. The homogenate was centrifuged for 30 min at 8000 rpm and 4 °C, and the supernatant was collected for the enzyme assay. The PAL reaction system included 0.2 mL of enzyme extract and 2 mL of 50 mM borate buffer (pH 8.0) containing 2 mM Lphenylalanine. The reaction mixture was kept at 30 °C for 1 h. Then, the increased absorbance at 290 nm was measured. One unit of B
DOI: 10.1021/acs.jafc.6b03281 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry Table 1. Phenylpropanoid Metabolism Genes, Respective Enzyme Functions, and Their Reference Genes gene
definition
orthologous genes (accession no.)
identity (%)
forward/reverse primer
amplicon length (bp)
PAL
phenylalanine ammonia-lyase (EC 4.3.1.24)
Eucalyptus grandis (XP_010067318.1)
97
5′-TTGAGGCGAACATTCTATCCG-3′
228
POD
peroxidase (EC 1.11.1.7)
E. grandis (XP_010048668.1)
91
5′-GGTCCTGCTTTGGCTACTGG-3′ 5′-CAACGCTGCCGAGAAAGAC-3′
169
GLU
β-glucosidase (EC 3.2.1.21)
E. grandis (XP_010044986.1)
93
5′-CCCTGCCAACGAAACGAC-3′ 5′-CTGGGATAAACAAAGAGCGAAT-3′
161
123
130
C3H
p-coumarate 3-hydroxylase (EC 1.14.13.-)
Eucalyptus globulus (ADG08112.1)
95
5′-GGCTTGAACTACTACACTGCGAAC3′ 5′-TGCTTCGCATACTGGTCCC-3′
CA
cinnamyl-alcohol dehydrogenase (EC 1.1.1.195)
Rubus deliciosus (AKL59767.1)
78
5′-CTGCTTGTCGTGCTCGTTGA-3′ 5′-TCCCAGCCACAATCTTCGTC-3′
F5H
ferulate-5-hydroxylase (EC 1.14.-.-)
E. globulus (ACU45738.1)
91
4CL
4-coumarate−CoA ligase (EC 6.2.1.12)
E. grandis (XP_010018612.1)
91
5′-GTGCTCCCAATGTTGCCTTT-3′ 5′-AAATCGTCGGACTCGTTCACT-3′ 5′-TTGGTGCCTTCAACATAGCC-3′ 5′-ACAATCCCGCCCATAGTCC-3′
CoCOAOMT
caffeoyl-CoA O-methyltransferase (EC 2.1.1.104)
Gossypium arboreum (KHF99603.1)
86
5′-TCATCCCGTAGCCCAGTCC-3′ 5′-TCGGCTACAACAACACCCAG-3′
101
CA
coniferyl-aldehyde dehydrogenase (EC 1.2.1.68)
E. grandis (XP_010049713.1)
92
5′-GAGTTCCAGCACGAAGTCCC-3′ 5′-TTCCACAGCCAAATCCACATAC-3′
185
C4H
trans-cinnamate 4-monooxygenase (EC 1.14.13.11)
Eucalyptus urophylla (AGJ71350.1)
96
5′-CGAACGGGAGCCTGAAGTAGTA-3′ 5′-GCCAGTTCAGCTTGCACATATT-3′
102
EF-1α
elongation factor 1α
E. grandis (XM_010068976.1)
93
5′-CAACAGCCACCGAAAGTTAGAGT-3′ 5′-AAGCCACTCCGCCTTCCCTTAC-3′
104
250 181
5′TGACAACCATACCAGGCTTGAGGAT3′
enzyme activity was defined as the amount that caused a change of 0.01 in the absorbance per minute. The 4CL activity was measured using a spectrophotometric assay to detect the formation of CoA esters of various cinnamic acid derivatives.33 Pulp (10 g) from six fruits was homogenized in 15 mL of 0.2 M Tris buffer (pH 8.0) containing 25% glycerinum. The homogenate was centrifuged for 20 min at 10000 rpm and 4 °C, and the supernatant was collected for the enzyme assay. The 4CL reaction system included 1.6 mL of 0.2 M Tris buffer (pH 8.0), 0.45 mL of 15 mM MgCl2, 0.5 mL of 50 mM ATP, and 0.15 mL of 5 mM pcoumarate. The reaction mixture was kept at 40 °C for 10 min. Then, the increased absorbance at 330 nm was measured; one unit of enzyme activity was defined as the amount that caused a change of 0.01 in the absorbance per minute. RNA Isolation and cDNA Synthesis. Different samples (200 mg) were ground with a mortar and pestle in liquid nitrogen. RNA was isolated separately using the E.Z.N.A Plant Total RNA Kit (OMEGA Bio-Tek) according to the manufacturer’s instructions. The quality of the RNA was verified by a demonstration of intact ribosomal bands following agarose gel electrophoresis, in addition to the absorbance ratios (A260/A280) of 1.8−2.0 in the NanoPhotometer spectrophotometer (IMPLEN).34 cDNAs were synthesized using the PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa) following the provided protocol. Sequence and Quantitative Real-Time PCR Analysis. In our previous study, to overcome the lack of a reference wax apple genome, we used RNA-seq data to de novo assemble a reference transcriptome. To identify the phenylpropanoid biosynthetic gene sequences in our wax apple NGS database (raw RNA-seq reads for wax apple transcriptome are deposited in NCBI SRA with a project accession
number of PRJNA284092 and SRA accession number of SRR2027825), all generated sequences were blasted against related phenylpropanoid biosynthetic genes in GenBank. The deduced amino acid sequences of the phenylpropanoid biosynthetic genes were analyzed for homology by blasting against the GenBank database.35 In these databases, some genes have been annotated as encoding putative enzymatic steps in lignin biosynthesis. Our detailed analysis revealed 10 genes: phenylalanine ammonia-lyase (PAL), trans-cinnamate 4monooxygenase (C4H), p-coumarate 3-hydroxylase (C3H), βglucosidase (GLU), 4-coumarate−CoA ligase (4CL), cinnamyl-alcohol dehydrogenase (CAD), peroxidase (POD), coniferyl-aldehyde dehydrogenase (CA), ferulate-5-hydroxylase (F5H), and caffeoyl-CoA Omethyltransferase (CCoAOMT). Real-time PCR primers were designed using Primer 5.0 (Table 1), with melting temperatures between 58 and 62 °C, GC contents of 45−65%, and amplicon lengths of 80−250 bp. These genes were amplified using wax apple primers that were specific to the most highly expressed gene isoforms. The expression of target genes was normalized with the elongation factor 1α (EF-1α) housekeeping gene. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines aided in the design of the experiments, keeping track of the experimental data and improving the analysis.36 qRT-PCR was performed in a 20 μL reaction mixture, including 10 μL of 1× SYBR Green Real-time PCR Master Mix (TIANGEN), 4 μL of template cDNA, 0.6 μL of each primer (10 μM), and DEPC-treated water. Thermal cycling conditions were as follows: 95 °C for 15 min and 40 cycles of 95 °C for 10 s and 60 °C for 31 s. The PCRs were performed on an ABI7300 Real Time System. The expressed quantitative variation was calculated as 2−ΔΔCt. Three replications C
DOI: 10.1021/acs.jafc.6b03281 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry per sample were used for the real-time PCR analysis, and the values are expressed as means ± the standard deviation.37
■
RESULTS AND DISCUSSION Effect of NO on Weight Loss, Flesh Firmness, and Softening Index. As shown in Figure 2, the wax apple weight
Figure 4. Flesh firmness in the control and NO-treated wax apple fruit during storage.
biosynthesis and the transcription of their genes.16 Lignin is composed of different phenylpropanoids and fills the spaces in the cell wall among cellulose, pectin components, and hemicellulose. Therefore, the aim of this report was to investigate how NO is associated with lignin biosynthesis in wax apple fruit. During storage, wax apple undergoes rapid changes in weight loss, flesh firmness, and softening index, which may have been due to lignin biosynthesis. In this work, the enzymes participating in the lignin biosynthetic pathway were selected and studied in detail, and the activity of POD, 4CL, and PAL was observed. The wax apple samples from the NO treatment and control groups were examined. The NO treatment group presented a low lignin content in the range from 0.65 to 0.70%. The control group comprised samples with a high lignin content, in the range from 0.70 to 0.79% (Figure 5). These findings are of
Figure 2. Weight loss in the control and NO-treated wax apple fruit during storage.
loss rate increased gradually during storage and reached 3.45% in control fruit on day 12, but this increase was significantly reduced by NO treatment (P < 0.01). The softening index increased rapidly from 12.50 to 21.59%, which reflected the increase in the intensity of cottony softening during fruit storage. However, NO treatment markedly delayed the trend (Figure 3) (P < 0.05). Wax apple pulp firmness decreased
Figure 3. Softening index in the control and NO-treated wax apple fruit during storage. Figure 5. Changes in lignin content in the control and NO-treated wax apple fruit during storage.
slightly during postharvest; in the NO-treated fruit, pulp firmness was higher than in the control fruit (Figure 4) (P < 0.05). This finding indicated that NO exerts its effects on prolonging fruit storage and maintaining fruit quality. These findings were consistent with those of Guo et al.,24 who reported that NO resulted in a smaller loss of firmness during storage and induced cell wall softening-related enzymes in papaya. Moreover, Yang et al.38 revealed that treatment with NO significantly inhibits the decrease in firmness in bamboo shoot. In our study, the quality parameters of fruits, including weight loss, flesh firmness, and softening index, were controlled by NO. Hence, NO can be selectively utilized to extend postharvest life. Effect of NO on Total Lignin Content and Enzyme Assays. NO may affect the activity of enzymes related to lignin
particular interest because of the role of lignin during storage with NO treatment. Reports have demonstrated that NO changes the lignin content of soybean seedlings.25 Lignin biosynthesis is a specialized branch of phenylpropanoid metabolism.39 Enzymes participating in the phenylpropanoid pathway were selected, and the activity of three enzymes was observed. Peroxidase has been implicated in several physiological roles, especially in the cross-linking of cell wall components such as lignin formation and suberin.29 The activity of POD was 26.49 units on day 2 and then increased gradually, reaching a maximum on day 8. Thereafter, a decline occurred, with a slight increase on day 10 in control fruit. At first, POD activity in NO-treated fruit was significantly lower D
DOI: 10.1021/acs.jafc.6b03281 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry than that in control fruit and was then slightly higher than in control fruit after day 10 (Figure 6) (P < 0.01). Several studies
Figure 8. Changes in 4CL specific activity in the control and NOtreated wax apple fruit during storage.
evidence suggests that many lignin biosynthetic enzymes are regulated at the transcriptional level.39 The expression of genes encoding enzymes involved in lignin biosynthesis was analyzed by qRT-PCR (Figure 9).
Figure 6. Changes in POD specific activity in the control and NOtreated wax apple fruit during storage.
report the direct implication of peroxidase isoenzymes in the oxidation of monolignols, which constitutes the last step in the lignin biosynthesis pathway.40 Phenylalanine ammonia-lyase (PAL) converts phenylalanine to cinnamic acid in the first step of phenylpropanoid biosynthesis.6 Figure 7 shows the effect of NO treatment on
Figure 9. Lignin biosynthesis-related gene expression in the control and NO-treated wax apple fruit during storage.
Genes regulating the synthesis of ferulic acid and sinapic acid, such as CA, showed levels of expression higher than those of other genes during storage in both the NO treatment and control groups. The level of expression of the CA gene increased gradually during storage, reached a maximum on day 8, and then decreased during storage. The expression level of CA was significantly higher after NO treatment compared to that of the control fruit on day 8. Changes in the mRNA abundance of CCoAOMT and C3H in wax apple fruit showed a pattern similar to that of CA. CCoAOMT catalyzes the methylation of caffeoyl-CoA to feruloyl-CoA and 5-hydroxyferuloyl-CoA to sinapoyl-CoA. C3H was shown to preferentially convert the shikimate and quinate esters of p-coumaric acid into the corresponding caffeic acid conjugates.7 Interestingly, changes in the mRNA abundance of C4H in wax apple fruit showed a different pattern between the NO treatment and control groups. However, the level of expression of C4H was significantly lower after NO treatment during storage compared to that of the control fruit, except on day 0. The level of expression of F5H in control fruit increased gradually, reached a peak at day 8, and then decreased during storage in control fruit. During storage (from day 2 to 8), the level of expression of F5H was higher with NO treatment than that for the control. F5H is involved in the synthesis of 5hydroxyferulic acid methyl ester, 5-hydroxyconiferaldehyde, and 5-hydroxyconiferyl alcohol. C3H, C4H, and F5H belong to the
Figure 7. Changes in PAL specific activity in the control and NOtreated wax apple fruit during storage.
the activity of PAL. The activity of PAL was maintained at a stable value during storage. However, the PAL activity in NOtreated fruit was generally lower than that in the control. The phenylpropanoid enzyme 4-coumarate−CoA ligase (4CL) is considered necessary to activate the hydroxyl cinnamic acids for the biosynthesis of the sinapyl and coniferyl alcohols that are subsequently polymerized into lignin. The 4CL activity first increased, reached a peak on day 8, and then decreased, but the 4CL activity in NO-treated fruit was significantly lower than that in the control fruit at all storage times examined (Figure 8). POD, PAL, and 4CL were likely to be the key enzymes controlling the accumulation of lignin in wax apple fruit after NO treatment, as observed in Fagopyrum tataricum sprouts.34 Three enzymes of the general phenylpropanoid pathway have been proven to be important for lignin biosynthesis in some plants.41 Expression Profile of Genes Related to Lignin Biosynthesis. Lignin is synthesized by the phenylpropanoid pathway, which is involved in the synthesis of phenolic compounds and a wide range of secondary products in plants.25 A large body of E
DOI: 10.1021/acs.jafc.6b03281 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry cytochrome P450-dependent monooxygenases.42 C4H is the rate-limiting step in the phenylpropanoid pathway and is highly specific for cinnamate. Blocking this step impairs the ability of plants to produce lignin. The 3-hydroxylation occurs primarily on the 4-coumaroyl-shikimate level, thereby linking the farupstream shikimate pathway with the committed step toward S and G lignin. The last hydroxylation step occurs on the level of the aldehyde or alcohol and defines flow into S lignin.43 A decrease in the level of C3H gene expression may therefore increase the number of p-coumaryl (H) subunits in lignin.44 The PAL gene serves in the synthesis of cinnamic acid.45 Figure 9 shows the effect of NO treatment on PAL gene mRNA abundance during storage. The level of expression of the PAL gene sharply increased, reached a peak at day 6, and then decreased during storage in control fruit. However, the PAL mRNA level in NO-treated fruit remained at a significantly low level compared to that of the control fruit during storage (from day 2 to 10). The results coincided with the enzyme results from previous work. The fluctuation of rosmarinic acid content directly correlated with the level of PAL expression. Moreover, the downregulation of PAL affected the expression of C4H and 4CL and caused a reduction in rosmarinic acid content in Salvia miltiorrhiza.46 The level of expression of the 4CL gene increased gradually during storage, reached a maximum on day 8, and then decreased during storage. The transcript levels of the 4CL gene in NO-treated fruit remained at a level significantly lower than that of the control fruit at all time points examined except on day 12. These results coincided with the activity of 4CL from previous work, in which it was shown to be involved in the synthesis of p-coumaryl alcohol, caffeyl alcohol, coniferyl alcohol, 5-hydroxyconiferyl alcohol, and sinapyl alcohol. Li et al. reported that the downregulation of 4CL dramatically reduced the lignin content in stem wood.47 The POD transcript levels exhibited a trend similar to that of activity: in control fruit, they increased gradually and reached maxima on day 8. Thereafter, the levels slightly decreased. The POD mRNA levels in NO-treated fruit remained significantly lower than that of the control fruit until day 10. POD is involved in the synthesis of the last p-hydroxyphenyl lignin, guaiacyl lignin, 5-hydroxy-guaiacyl lignin, and syringyl lignin. Fernández-Pérez et al.48 revealed that the suppression of the last step of lignin formation affects the whole phenylpropanoid biosynthesis and agrees with the previously reported decrease in the level of S lignins in interfascicular fibers. The level of expression of CAD was increased slightly, reaching a peak on day 10, and then decreased during storage in control fruit. The levels in fruit with NO treatment were lower than those of the control from day 0 to 10. CAD catalyzes the last step in the biosynthesis of the monolignols, which is the reduction of cinnamaldehydes to cinnamyl alcohols.8 The downregulation of CAD activity had essentially no effect on either the lignin content or the S/G ratio, but it did enhance the incorporation of hydroxycinnamyl aldehydes into lignin as both end groups and cross-coupling moieties.49 The genes encoding the GLU showed no significant change in expression during storage and are therefore unlikely to have a role in regulating lignin biosynthesis. The result of the coordinated action of many related enzymes in the phenylpropanoid pathway might be attributed to lignin biosynthesis in wax apple after NO treatment, as observed in strawberry.50 In conclusion, treatment with 10 μL of nitric oxide/L can extend the storage and marketing life of wax apple. Our results indicate that the exogenous application of NO induces
significant changes in wax apple fruit lignin synthesis during storage, which alters the expression of the genes related to lignin biosynthesis. The transcript levels of CA, CCoAOMT, F5H, and C3H genes in NO-treated fruit remained significantly higher than that of the control fruit. However, the profiles of PAL, POD, 4CL, and CAD genes were lower in the NO group than in the control. Here, we show that a 10 μL/L NO fumigation treatment could regulate related genes and affect the activity of enzymes involved in lignin biosynthesis, leading to a changing structure of the cell well in wax apple. This may be the mechanism of NO-induced cottony softening delay. This report provides the first evidence of the molecular mechanism of NO impact lignin biosynthesis in wax apple, which may allow us to develop study models to improve our understanding of the molecular mechanism of the impact of NO on postharvest physiology in wax apple fruits.
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Funding
This work was supported by grants from the National Natural Science Foundation of China (31171777). Notes
The authors declare no competing financial interest.
■
ABBREVIATIONS USED PAL, phenylalanine ammonia-lyase (EC 4.3.1.24); POD, peroxidase (EC 1.11.1.7); GLU, β-glucosidase (EC 3.2.1.21); C3H, p-coumarate 3-hydroxylase (EC 1.14.13.-); CAD, cinnamyl-alcohol dehydrogenase (EC 1.1.1.195); F5H, ferulate-5-hydroxylase (EC 1.14.-.-); 4CL, 4-coumarate−CoA ligase (EC 6.2.1.12); CCoAOMT, caffeoyl-CoA O-methyltransferase (EC 2.1.1.104); CA, coniferyl-aldehyde dehydrogenase (EC 1.2.1.68); C4H, trans-cinnamate 4-monooxygenase (EC 1.14.13.11)
■
REFERENCES
(1) Ye, J. B. Effect of Nitric Oxide on Physiology and Quality of Postharvest Wax Apple (Syzygiumsamarangense Merr.et Perry). Ph.D. Thesis, Jimei University, Xiamen, China, 2012. (2) Chen, J. Study on Cottony Softening of Postharvest wax apple. Ph.D. Thesis, Jimei University, Xiamen, China, 2013. (3) Huang, R. Study on Effect of Nitric Oxide and Gibberellic Acid on Cottony Softening of Postharvest Wax-apple. Ph.D. Thesis, Jimei University, Xiamen, China, 2014. (4) Yin, Z. Z. The Transcriptome of Postharvest Wax apple provide insight to cottony softing influence by Nitric Oxide(NO). Ph.D. Thesis, Jimei University, Xiamen, China, 2015. (5) Paniagua, C.; Blancoportales, R.; Barcelómuñoz, M.; Garcíagago, J. A.; Waldron, K. W.; Quesada, M. A.; Muñozblanco, J.; Mercado, J. A. Antisense down-regulation of the strawberry β-galactosidase gene FaβGal4 increases cell wall galactose levels and reduces fruit softening. J. Exp. Bot. 2016, 67, 619−631. (6) Bonawitz, N. D.; Chapple, C. The genetics of lignin biosynthesis: Connecting genotype to phenotype. Annu. Rev. Genet. 2010, 44, 337− 363. (7) Raes, J.; Rohde, A.; Christensen, J. H.; van de Peer, Y.; Boerjan, W. Genome-wide characterization of the lignification toolbox in arabidopsis. Plant Physiol. 2003, 133, 1051−1071. (8) Baucher, M.; Halpin, C.; Petit-Conil, M.; Boerjan, W. Lignin: Genetic engineering and impact on pulping. Crit. Rev. Biochem. Mol. Biol. 2003, 38, 305−350. F
DOI: 10.1021/acs.jafc.6b03281 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry (9) Boerjan, W.; Ralph, J.; Baucher, M. Lignin biosynthesis. Annu. Rev. Plant Biol. 2003, 54, 519−546. (10) Corti Monzón, G.; Pinedo, M.; di Rienzo, J.; Novo-Uzal, E.; Pomar, F.; Lamattina, L.; de la Canal, L. Nitric oxide is required for determining root architecture and lignin composition in sunflower. Supporting evidence from microarray analyses. Nitric Oxide 2014, 39, 20−28. (11) Fernandes, J. C.; García-Angulo, P.; Goulao, L. F.; Acebes, J. L.; Amâncio, S. Mineral stress affects the cell wall composition of grapevine (Vitis vinifera L.) callus. Plant Sci. 2013, 205−206, 111−120. (12) Moura-Sobczak, J.; Souza, U.; Mazzafera, P. Drought stress and changes in the lignin content and composition in eucalyptus. BMC Proc. 2011, 5, P103. (13) Schenke, D.; Böttcher, C.; Scheel, D. Crosstalk between abiotic ultraviolet-b stress and biotic (flg22) stress signalling in arabidopsis prevents flavonol accumulation in favor of pathogen defence compound production. Plant, Cell Environ. 2011, 34, 1849−1864. (14) dos Santos, A. B.; Bottcher, A.; Vicentini, R.; Sampaio Mayer, J. L.; Kiyota, E.; Landell, M. A. G.; Creste, S.; Mazzafera, P. Lignin biosynthesis in sugarcane is affected by low temperature. Environ. Exp. Bot. 2015, 120, 31−42. (15) Zhang, S.-H.; Yang, Q.; Ma, R.-C. Erwinia carotovora ssp. Carotovora infection induced “defense lignin” accumulation and lignin biosynthetic gene expression in chinese cabbage (Brassica rapa L. Ssp. pekinensis). J. Integr. Plant Biol. 2007, 49, 993−1002. (16) Moura, J. C. M. S.; Bonine, C. A. V.; de Oliveira Fernandes Viana, J.; Dornelas, M. C.; Mazzafera, P. Abiotic and biotic stresses and changes in the lignin content and composition in plants. J. Integr. Plant Biol. 2010, 52, 360−376. (17) Neill, S. J.; Desikan, R.; Hancock, J. T. Nitric oxide signalling in plants. New Phytol. 2003, 159, 11−35. (18) Jing, G.; Zhou, J.; Zhu, S. Effects of nitric oxide on mitochondrial oxidative defence in postharvest peach fruits. J. Sci. Food Agric. 2016, 96, 1997−2003. (19) Wills, R. B. H.; Soegiarto, L.; Bowyer, M. C. Use of a solid mixture containing diethylenetriamine/nitric oxide (DETANO) to liberate nitric oxide gas in the presence of horticultural produce to extend postharvest life. Nitric Oxide 2007, 17, 44−49. (20) Soegiarto, L.; Wills, R. B. H. Effect of nitric oxide, reduced oxygen and elevated carbon dioxide levels on the postharvest life of strawberries and lettuce. Aust. J. Exp. Agric. 2006, 46, 1097−1100. (21) Cheng, G.; Yang, E.; Lu, W.; Jia, Y.; Jiang, Y.; Duan, X. Effect of nitric oxide on ethylene synthesis and softening of banana fruit slice during ripening. J. Agric. Food Chem. 2009, 57, 5799−5804. (22) Wang, Y.; Luo, Z.; Khan, Z. U.; Mao, L.; Ying, T. Effect of nitric oxide on energy metabolism in postharvest banana fruit in response to chilling stress. Postharvest Biol. Technol. 2015, 108, 21−27. (23) Duan, X.; Su, X.; You, Y.; Qu, H.; Li, Y.; Jiang, Y. Effect of nitric oxide on pericarp browning of harvested longan fruit in relation to phenolic metabolism. Food Chem. 2007, 104, 571−576. (24) Guo, Q.; Wu, B.; Chen, W.; Zhang, Y.; Wang, J.; Li, X. Effects of nitric oxide treatment on the cell wall softening related enzymes and several hormones of papaya fruit during storage. Food Sci. Technol. Int. 2014, 20, 309−317. (25) Böhm, F. M. L. Z.; Ferrarese, M. D. L. L.; Zanardo, D. I. L.; Magalhaes, J. R.; Ferrarese-Filho, O. Nitric oxide affecting root growth, lignification and related enzymes in soybean seedlings. Acta Physiol. Plant. 2010, 32, 1039−1046. (26) Corti Monzon, G.; Pinedo, M.; Di Rienzo, J.; Novo-Uzal, E.; Pomar, F.; Lamattina, L.; de la Canal, L. Nitric oxide is required for determining root architecture and lignin composition in sunflower. Supporting evidence from microarray analyses. Nitric Oxide 2014, 39, 20−28. (27) Ye, J.-b.; Chen, F.-h.; Wu, G.-b. Effect of Nitric Oxide on Physiology and Quality of Postharvest Wax Apple (Syzygium samarangense Merr et Perry) Fruits. Journal of Jimei University: Natural Sciences Edition 2012, 17, 180−185. (28) Cai, H.; Yuan, X.; Pan, J.; Li, H.; Wu, Z.; Wang, Y. Biochemical and proteomic analysis of grape berries (Vitis labruscana) during cold
storage upon postharvest salicylic acid treatment. J. Agric. Food Chem. 2014, 62, 10118−10125. (29) Nicholson, D. J.; Leavitt, A. T.; Francis, R. C. A three-stage klason method for more accurate determinations of hardwood lignin content. Cellul. Chem. Technol. 2014, 48, 53−59. (30) Horst, D. J.; Ramírez Behainne, J. J.; de Andrade Júnior, P. P.; Kovaleski, J. L. An experimental comparison of lignin yield from the klason and willstatter extraction methods. Energy Sustainable Dev. 2014, 23, 78−84. (31) Zhang, Z.; Pang, X.; Xuewu, D.; Ji, Z.; Jiang, Y. Role of peroxidase in anthocyanin degradation in litchi fruit pericarp. Food Chem. 2005, 90, 47−52. (32) Koukol, J.; Conn, E. E. The metabolism of aromatic compounds in higher plants. J. Biol. Chem. 1961, 236, 2692−2698. (33) Sun, H.; Li, Y.; Feng, S.; Zou, W.; Guo, K.; Fan, C.; Si, S.; Peng, L. Analysis of five rice 4-coumarate:Coenzyme a ligase enzyme activity and stress response for potential roles in lignin and flavonoid biosynthesis in rice. Biochem. Biophys. Res. Commun. 2013, 430, 1151− 1156. (34) Thwe, A. A.; Kim, Y. B.; Li, X.; Seo, J. M.; Kim, S.-J.; Suzuki, T.; Chung, S.-O.; Park, S. U. Effects of light-emitting diodes on expression of phenylpropanoid biosynthetic genes and accumulation of phenylpropanoids in Fagopyrum tataricum sprouts. J. Agric. Food Chem. 2014, 62, 4839−4845. (35) Zhao, S.; Park, C. H.; Li, X.; Kim, Y. B.; Yang, J.; Sung, G. B.; Park, N. I.; Kim, S.; Park, S. U. Accumulation of rutin and betulinic acid and expression of phenylpropanoid and triterpenoid biosynthetic genes in mulberry (Morus alba L.). J. Agric. Food Chem. 2015, 63, 8622−8630. (36) Taylor, S. C.; Mrkusich, E. M. The state of RT-quantitative PCR: Firsthand observations of implementation of minimum information for the publication of quantitative real-time PCR experiments (MIQE). J. Mol. Microbiol. Biotechnol. 2014, 24, 46−52. (37) Zhao, L.; Yang, S.; Zhang, Y.; Zhang, Y.; Hou, C.; Cheng, Y.; You, X.; Gu, X.; Zhao, Z.; Muhammad Tarique, T. New analytical tool for the detection of ractopamine abuse in goat skeletal muscle by potential gene expression biomarkers. J. Agric. Food Chem. 2016, 64, 1861−1867. (38) Yang, H.; Zhou, C.; Wu, F.; Cheng, J. Effect of nitric oxide on browning and lignification of peeled bamboo shoots. Postharvest Biol. Technol. 2010, 57, 72−76. (39) Rogers, L. A. Light, the circadian clock, and sugar perception in the control of lignin biosynthesis. J. Exp. Bot. 2005, 56, 1651−1663. (40) Marjamaa, K.; Kukkola, E. M.; Fagerstedt, K. V. The role of xylem class III peroxidases in lignification. J. Exp. Bot. 2009, 60, 367− 376. (41) Tuan, P. A.; Park, W. T.; Xu, H.; Park, N. I.; Park, S. U. Accumulation of tilianin and rosmarinic acid and expression of phenylpropanoid biosynthetic genes in Agastache rugosa. J. Agric. Food Chem. 2012, 60, 5945−5951. (42) Franke, R.; McMichael, C. M.; Meyer, K.; Shirley, A. M.; Cusumano, J. C.; Chapple, C. Modified lignin in tobacco and poplar plants over-expressing the arabidopsis gene encoding ferulate 5hydroxylase. Plant J. 2000, 22, 223−234. (43) Alber, A.; Ehlting, J. Cytochrome p450s in lignin biosynthesis. In Lignins: Biosynthesis, Biodegradation and Bioengineering; Jouann, L., Lapierre, C., Eds.; Elsevier BV: San Diego, 2012; Vol. 61, pp 113−143. (44) Ralph, J.; Akiyama, T.; Kim, H.; Lu, F.; Schatz, P. F.; Marita, J. M.; Ralph, S. A.; Reddy, M. S. S.; Chen, F.; Dixon, R. A. Effects of coumarate 3-hydroxylase down-regulation on lignin structure. J. Biol. Chem. 2006, 281, 8843−8853. (45) Costa, M. A.; Collins, R. E.; Anterola, A. M.; Cochrane, F. C.; Davin, L. B.; Lewis, N. G. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 2003, 64, 1097−1112. (46) Song, J.; Wang, Z. RNAi-mediated suppression of the phenylalanine ammonia-lyase gene in Salvia miltiorrhiza causes G
DOI: 10.1021/acs.jafc.6b03281 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry abnormal phenotypes and a reduction in rosmarinic acid biosynthesis. J. Plant Res. 2011, 124, 183−192. (47) Li, L.; Zhou, Y.; Cheng, X.; Sun, J.; Marita, J. M.; Ralph, J.; Chiang, V. L. Combinatorial modification of multiple lignin traits in trees through multigene cotransformation. Proc. Natl. Acad. Sci. U. S. A. 2003, 100, 4939−4944. (48) Fernández-Pérez, F.; Pomar, F.; Pedreño, M. A.; Novo-Uzal, E. Suppression of arabidopsis peroxidase 72 alters cell wall and phenylpropanoid metabolism. Plant Sci. 2015, 239, 192−199. (49) Baucher, M.; Chabbert, B.; Pilate, G.; van Doorsselaere, J.; Tollier, M. T.; Petit-Conil, M.; Cornu, D.; Monties, B.; van Montagu, M.; Inze, D.; Jouanin, L.; Boerjan, W. Red xylem and higher lignin extractability by down-regulating a cinnamyl alcohol dehydrogenase in poplar. Plant Physiol. 1996, 112, 1479−1490. (50) Xu, F.; Cao, S.; Shi, L.; Chen, W.; Su, X.; Yang, Z. Blue light irradiation affects anthocyanin content and enzyme activities involved in postharvest strawberry fruit. J. Agric. Food Chem. 2014, 62, 4778− 4783.
H
DOI: 10.1021/acs.jafc.6b03281 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
