Genetically Encodable Design of Ligand “Bundling” on the Surface of

Letter pubs.acs.org/Langmuir

Genetically Encodable Design of Ligand “Bundling” on the Surface of Nanoparticles Yao Lu,† Jianpeng Wang,† Jianhao Wang,†,§ Lin Wang,‡ Shannon Wing-Ngor Au,‡ and Jiang Xia*,† †

Department of Chemistry and ‡School of Life Sciences, The Chinese University of Hong Kong, Shatin, Hong Kong, China § School of Pharmaceutical Engineering and Life Science, Changzhou University, Changzhou, Jiangsu, China 213164 S Supporting Information *

ABSTRACT: Polyhistidine peptide dendrimer self-assembles on CdSe/ZnS quantum dots (QDs) with very high affinity and stability, a property ascribable to its multivalent geometry. Here we designed a fluorescent protein, GCNmCherry, that exists as an oligomeric bundled structure in solution as well as on the surface to imitate the structure of a synthetic dendrimer. GCN-mCherry forms a very stable assembly with QDs, which can resist displacement by 500 mM imidazole and the dendrimer peptide, as measured by the Förster resonance energy transfer from QD to mCherry. Our work manifested a prominent stability enhancement of protein−nanoparticle assembly through directional ligand−ligand interaction on the surface.

■

GCAAACTGTATCATATTGAAAACGAACTGGCGCGTATTAAAAAGCTGCTGGGCGAACGCGGCAGCGGCGGC, was synthesized by Life Technologies Limited, Hong Kong. The mCherry gene was amplified by PCR from an expression plasmid (a generous gift from Prof. Ivy Fitzgerald, University of Chicago). GCN and mCherry were subcloned into a pET28a vector (Novagen) between NdeI and EcoRI sites and between EcoRI and HindIII sites sequentially to yield the pGM plasmid. Alternatively, mCherry was subcloned into the pET28a vector between EcoRI and HindIII sites to yield the pmCherry plasmid. Both plasmids were confirmed by a sequencing analysis at BGI - Hong Kong Co., Ltd. (Figure S1). pmCherry and pGM plasmids were transformed into E. coli BL21 (DE3) cells to express Histag-mCherry and GCN-mCherry proteins, respectively. All other relevant information can be found in the Supporting Information.

INTRODUCTION Ligand exchange on the surface of nanoparticles such as semiconductor nanocrystals (quantum dots, QDs) grants nanoparticles beneficial surface properties for practical application, including stability, solubility, biocompatibility, and targeting properties.1,2 However, unintentional ligand exchange on the surface may lead to adverse effect of nanoparticles in vivo or with respect to the environment.3,4 For example, plasma proteins can displace surface ligands and form a protein “corona” around particles, a possible route to uncontrolled or ever detrimental biological effects.5−10 Designing ligands with superior surface exchange/binding properties is thus desirable. Guided by the principle of multivalency-assisted affinity enhancement, we designed a four-arm polyhistidine peptide dendrimer (PHPD) and observed a 50-fold increase in its affinity for CdSe/ZnS QDs as well as a marked improvement in the association rate in contrast to that for hexahistidine.11,12 Its success notwithstanding, because dendrimeric geometry is not genetically encodable, such a strategy is applicable only to synthetic ligands but not proteins.11−14 In this report, we designed a protein ligand that “bundles” by appending to the N terminus of a fluorescent protein a coiledcoil domain that tetramerizes in a parallel fashion. This design brings about a genetically encodable mimic of the four-arm PHPD. Besides a novel surface biofunctionalization strategy achieving very high stability, our designprotein bundling on CdSe/ZnS QDsalso illustrated how protein−protein interaction affects protein−surface assembly, an area largely unexplored so far.

■

■

RESULTS AND DISCUSSION As shown in Figure 1, fusion protein GCN-mCherry was designed on the basis of the crystal structures of peptide GCN4-pLI that forms a tetrameric parallel coiled-coil (PDB ID 1GCL)15 and fluorescent protein mCherry (PDB ID 2H5Q).16 GCN indicates that the tetrameric peptide originated from the leucine zipper region of the yeast transcriptional activator GCN4, GCN4-p1 leucine zipper.17 The design of GCN4-pLI, a peptide with a sequence of RMKQIEDKLEEILSKLYHIENELARIKKLLGER, represented a culmination of the studies of coiled coils based on the GCN4-p1 leucine zipper.15 The mutation of a residues of the four heptads in GCN4-p1 (V9, N16, V23, and V30) to leucine and four d residues (L5, L12, L19, and L26) to isoleucine resulted in the GCN4-pLI peptide, which forms a very stable parallel coiled-coil tetramer, as

MATERIALS AND METHODS: CONSTRUCTION OF PLASMIDS

Received: July 18, 2012 Revised: September 10, 2012 Published: September 11, 2012

A DNA fragment, GCN, coding GCN4-pLI together with the linker, CGCATGAAACAGATTGAAGATAAACTGGAAGAGATTTTGA© 2012 American Chemical Society

13788

dx.doi.org/10.1021/la302902m | Langmuir 2012, 28, 13788−13792

Langmuir

Letter

We then examined the photoluminescence property of the two variants of the mCherry protein. GCN-mCherry and Histag-mCherry showed identical absorption and emission spectra, with maximal absorption at 587 nm and maximal emission at 610 nm (λex = 587 nm, Figure 3A). Correspondingly, the glutathione (GSH)-coated CdSe/ZnS QDs (QD565, around 3.5 nm in diameter) that we used exhibited their maximal emission at 565 nm (λex = 420 nm). The marked overlap of the emission spectra of QDs (donor) and absorption spectra of mCherry (acceptor) ensures Förster resonance energy transfer (FRET) from QDs to mCherry with the Förster distance R0 calculated to be about 56 Å.23,24 The assembly of the mCherry proteins with QDs in different ratios was then monitored by fluorimetry in a cuvette (Figures 3B and S2). The appreciable FRET signals in both assemblies indicate the efficient binding of both proteins to the surface of QDs, with a saturation ratio of about 16:1 (protein/QDs) and the average donor−acceptor separation distance at saturation r16 calculated to be 65 ± 3 Å (Figures 3C and S2, see Supporting Information for details of the calculation).11,25 Therefore, both variants of mCherry proteins readily assemble with CdSe/ZnS QDs. The mechanism of metal-affinity-driven self-assembly of His-tagged proteins on the surface of GSH-coated CdSe/ZnS QDs could be described by a ligand displacement process.11,12,26 The primary evidence is that both GSH and oligohistidine peptide (through the imidazole moiety of histidines) bind to the same binding sites on the ZnS shell of QDs, with GSH binding to Zn2+ through Zn2+-S and Zn2+-N coordination bonds27 and imidozole binding to Zn2+ through the Zn2+-N coordination bond.28 Therefore, GSH and oligohistidine (also imidazole) are competitive ligands for CdSe/ZnS QDs. Furthermore, GSHstabilized water-soluble QDs were fabricated in a large excess of GSH, ensuring all of the available Zn coordination sites on the surface of the QDs to be occupied by GSH. Therefore, the association of competitive ligands such as His-tagged proteins or imidazole on QDs inevitably results in the displacement of prebound GSH. Imidazole (Im) can efficiently compete with His-tag for binding sites on the surface of Ni-NTA or cobalt resins, thus eluting immobilized His-tagged proteins off of the solid support, a well-adopted strategy for protein purification (i.e.,

Figure 1. Schematic depiction of the design of GCN-mCherry to mimic PHPD. The self-assembly of GCN-mCherry with glutathione (GSH)-coated CdSe/ZnS QDs results in Föster resonance energy transfer (FRET).

confirmed by solution analysis as well as X-ray crystallography.15 A member of the second-generation red fluorescent proteins (mRFPs) or mFruits, mCherry, with a maximal absorbance at around 587 nm and emission at around 610 nm, is monomeric, highly resistant to photobleaching, and very stable in solution.16,18 These properties render mCherry an ideal Förster resonance energy transfer (FRET) acceptor with CdSe/ZnS core−shell QDs.19−22 We inserted the geneencoding GCN4-pLI peptide between the N terminal hexahistidine tag and mCherry to construct the gene that encodes GCN-mCherry (Figure 1 and Figure S1 in the Supporting Information). For comparison, a control protein, Histag-mCherry, that is absent from the GCN sequence and exists in solution as a monomer was also constructed. GCNmCherry will oligomerize through the GCN-pLI sequence in a parallel manner such that each His-tag of the four GCNmCherry proteins points to the same side of the complex, effecting a protein bundle that resembles the polyhistidine dendrimer (Figure 1). Both proteins were expressed in E. coli with a high expression yield, purified via Ni-NTA chromatography to a homogeneity of >90%, buffer exchanged, and concentrated to 8−10 mg/mL in 50 mM Tris buffer at pH 7.4. As expected, GCN-mCherry forms an oligomer in solution, as evidenced by the much higher molecular weight as compared to that of Histag-mCherry in native gel electrophoresis analysis as well as analytical gel filtration chromatography (Figure 2).

Figure 2. Characterization of GCN-mCherry and Histag-mCherry. (A) SDS-PAGE under denaturing conditions. Lane 1: GCN-mCherry (33.5 KDa). Lane 2: molecular weight marker. Lane 3: Histag-mCherry (30.5 KDa). The arrow indicates the position of 29 kDa. (B) Gel electrophoresis under native conditions. Lane 1: Histag-mCherry. Lane 2: GCN-mCherry. (C) Analytical gel filtration chromatography using a Superdex 200 column. (a) GCN-mCherry. (b) Histag-mCherry. 13789

dx.doi.org/10.1021/la302902m | Langmuir 2012, 28, 13788−13792

Langmuir

Letter

Figure 3. FRET from QDs to GCN-mCherry. (A) Normalized photoluminescence (PL) spectra of QDs (a) and absorption and emission spectra of GCN-mCherry (b, c) and Histag-mCherry (d, e) measured in borate buffer (10 mM Na2B4O7·H2O, pH 7.4). (a) λex = 420 nm; (c, e) λex = 480 nm. (B) PL spectra of QDs with an increasing ratio of GCN-mCherry/QD. (a) QD, (b) 1:1, (c) 2:1, (d) 4:1, (e) 8:1, (f) 16:1, (g) 32:1, and (h) 64:1. (C) FRET ratio, calculated as I610/I565, at varying ratios of GCN-mCherry/QD. λex = 420 nm.

Figure 4. Im ligand displacement on (A) QD-Histag-mCherry and (B) QD-GCN-mCherry assemblies. [Im]: (a) 0, (b) 100, (c) 200, (d) 300, (e) 400, and (f) 500 mM, measured in borate buffer (10 mM Na2B4O7·H2O, pH 7.4). λex = 420 nm.

immobilized metal affinity chromatography (IMAC)).29 Im could also displace surface-bound ligands on CdSe/ZnS QDs.11,26 For GSH-coated QD565, a high concentration of Im leads to fluorescence quenching as well as particle aggregation, indicating a drastic decrease in the stability of QDs in aqueous solution (Figure S3). Histag-mCherry -coated QDs are also vulnerable to Im displacement because increasing concentrations of Im lead to a gradual diminishing of the FRET signal (displacement) as well as a decrease in the overall fluorescence signal (quenching; Figures 4A and S4 and Scheme S1). In sharp contrast, GCN-mCherry-coated QDs showed a negligible loss in either the FRET signal or the overall fluorescence signal, even in 500 mM Im (Figure 4B). Because the high resistance to Im displacement was first observed in the assembly between the PHPD ligand and QDs,11 this indicates that the structural resemblance renders the same function between PHPD and GCN-mCherry, namely, a very high binding affinity to QDs. Because both PHPD and GCN-mCherry are categorized as high-affinity ligands to QDs, we then performed a direct comparison of these two ligands through a series of competition experiments. The first experiment was to displace surface-bound dendrimer peptide by proteins. A 32-fold excess of a nonfluorescent PHPD peptide (Figure S5) was incubated with QDs until equilibrium to form QD-PHPD; a 16-fold excess of GCN-mCherry or Histag-mCherry (with QD as 1 part) was then added to the solution, allowing for the

displacement of the surface-bound peptide dendrimer by the fluorescent proteins (final ratio, QD/peptide/protein = 1:32:16). GCN-mCherry displaced a significant portion of the surface ligand despite its concentration being smaller than that of PHPD, as revealed by the emergence of a pronounced FRET signal at 610 nm, whereas Histag-mCherry failed to bind to QDs (Figure 5A). In the second experiment, we reversed the order by displacing surface-bound mCherry proteins with PHPD. Fluorescent protein was incubated with QDs in a ratio of 16:1 to form stable protein/QD complex QD-mCherry, followed by the addition of a 32-fold dendrimer peptide (with QD as 1 part). Remarkably, all of the Histag-mCherry was displaced by PHPD as indicated by the total disappearance of the FRET signal, whereas only a small portion of GCNmCherry was out competed (Figure 5B, with more than 70% of the FRET signal retained). Third, we examined their simultaneous competition for the binding sites by mixing dendrimer peptide and mCherry proteins with QDs (in a final ratio of QD/mCherry/PHPD = 1:16:32). When dendrimer peptide and Histag-mCherry coexist, only PHPD binds and saturates the surface of QDs, consistent with the previous report that PHPD preferentially binds QDs in the presence of His-tagged proteins.11 On the contrary, GCN-mCherry outcompeted PHPD, establishing a significant FRET signal (Figure 5C). In summary, first GCN-mCherry could displace the surface-bound PHPD ligand, but Histag-mCherry failed. 13790

dx.doi.org/10.1021/la302902m | Langmuir 2012, 28, 13788−13792

Langmuir

Letter

Figure 5. Competition between PHPD and mCherry variants for binding sites on QDs. (A) mCherry proteins displace PHPD on QD−PHPD. Control: QD-PHPD only (QD/PHPD = 1:32). Histag-mCherry: QD-PHPD + Histag-mCherry (QD/PHPD/mCherry = 1:32:16). GCN-mCherry: QD-PHPD + GCN-mCherry (QD/PHPD/mCherry = 1:32:16). The inset shows the PL ratio I610/I565. (B) PHPD displaces mCherry proteins on QD-mCherry and the corresponding FRET changes. Control a: QD-Histag-mCherry (QD/ mCherry = 1:16). Histag-mCherry: QD-HistagmCherry + PHPD (QD/mCherry/PHPD = 1:16:32). Control a′: QD-GCN-mCherry (QD/mCherry = 1:16). GCN-mCherry: QD-GCN-mCherry + PHPD (QD/mCherry/PHPD = 1:16:32). The inset shows the changes in the FRET ratio before and after PHPD addition, calculated as (I610/ I565)mCherry/(I610/I565)control. (C) Assembly of PHPD together with mCherry on QDs. Control: QD + PHPD (QD/PHPD = 1:32). Histag-mCherry: QD + Histag-mCherry + PHPD (QD/mCherry/PHPD = 1:16:32). GCN-mCherry: QD + GCN-mCherry + PHPD (QD/mCherry/PHPD = 1:16:32). The inset shows PL ratio I610/I565. In the schematic illustrations, stars represent mCherry proteins and circles represent nonfluorescent PHPD.

Second, PHPD could out compete surface-bound HistagmCherry but had no effect on surface-bound GCN-mCherry. Finally, in the presence of PHPD, GCN-mCherry could win the competition for the binding sites on QDs, but Histag-mCherry could not. The competition between PHPD and mCherry variants thus shows that the bundled GCN-mCherry protein has a markedly higher binding affinity than monomeric HistagmCherry by the standard of PHPD, an exceptionally highaffinity ligand.

■

genetically encodable mimic of the dendrimeric structure by appending a GCN-pLI sequence to the N terminus of a fluorescent mCherry protein. The GCN-pLI peptide bundles mCherry in a parallel manner, clustering the terminal His-tags to resemble the peptide dendrimer. This facile genetic manipulation turned fluorescent protein mCherry into a highaffinity ligand for CdSe/ZnS QDs. The assembly of GCNmCherry and QDs effectively resists the displacement of 500 mM Im, as well as winning the competition over excess highaffinity dendrimeric peptide. Hereby, we presented a strategy for the precise control of ligand bundling on the surfaces of inorganic materials. The much higher designability of proteins in contrast to that of synthetic polymers, in terms of its feasibility to engineer directional interligand interaction, allowed us to reveal how ligand−ligand interaction affects ligand−surface interaction for the first time. Besides, we discovered a novel strategy to achieve high-affinity protein

CONCLUSIONS

Dendrimeric peptide with branched oligohistidines binds over 50 times more tightly to QDs, opening the door for selective self-assembly between the peptide and QDs in complex biological solutions. However, selective self-assembly inside the cells remains enigmatic because such dendrimeric geometry does not exist in expressed proteins. Here we engineered a 13791

dx.doi.org/10.1021/la302902m | Langmuir 2012, 28, 13788−13792

Langmuir

Letter

(11) Wang, J.; Xia, J. Preferential binding of a novel polyhistidine peptide dendrimer ligand on quantum dots probed by capillary electrophoresis. Anal. Chem. 2011, 83, 6323−6329. (12) Wang, J.; Jiang, P.; Han, Z.; Qiu, L.; Wang, S.; Zheng, B.; Xia, J. Fast self-assembly kinetics of quantum dots and a dendrimeric peptide ligand. Langmuir 2012, 28, 7962−7966. (13) Liu, L.; Guo, X.; Li, Y.; Zhong, X. Bifunctional multidentate ligand modified highly stable water-soluble quantum dots. Inorg. Chem. 2010, 49, 3768−3775. (14) Uyeda, H. T.; Medintz, I. L.; Jaiswal, J. K.; Simon, S. M.; Mattoussi, H. Synthesis of compact multidentate ligands to prepare stable hydrophilic quantum dot fluorophores. J. Am. Chem. Soc. 2005, 127, 3870−3878. (15) Harbury, P. B.; Zhang, T.; Kim, P. S.; Alber, T. A switch between two-, three-, and four-stranded coiled coils in GCN4 leucine zipper mutants. Science 1993, 262, 1401−1407. (16) Shu, X.; Shaner, N. C.; Yarbrough, C. A.; Tsien, R. Y.; Remington, S. J. Novel chromophores and buried charges control color in mfruits. Biochemistry 2006, 45, 9639−9647. (17) O’Shea, E. K.; Butkowski, R.; Kim, P. S. Evidence that the leucine zipper is a coiled coil. Science 1989, 243, 538−542. (18) Shaner, N. C.; Campbell, R. E.; Steinbach, P. A.; Giepmans, B. N. G.; Palmer, A. E.; Tsien, R. Y. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat. Biotechnol. 2004, 22, 1567−1572. (19) Dennis, A. M.; Bao, G. Quantum dot-fluorescent protein pairs as novel fluorescence resonance energy transfer probes. Nano Lett. 2008, 8, 1439−1445. (20) Boeneman, K.; Delehanty, J. B.; Susumu, K.; Stewart, M. H.; Deschamps, J. R.; Medintz, I. L. Quantum dots and fluorescent protein FRET-based biosensors. Adv. Exp. Med. Biol. 2012, 733, 63−72. (21) Boeneman, K.; Mei, B. C.; Dennis, A. M.; Bao, G.; Deschamps, J. R.; Mattoussi, H.; Medintz, I. L. Sensing caspase 3 activity with quantum dot−fluorescent protein assemblies. J. Am. Chem. Soc. 2009, 131, 3828−3829. (22) Boeneman, K.; Delehanty, J. B.; Susumu, K.; Stewart, M. H.; Medintz, I. L. Intracellular bioconjugation of targeted proteins with semiconductor quantum dots. J. Am. Chem. Soc. 2010, 132, 5975− 5977. (23) Lakowicz, J. R. Principles of Fluorescnece Spectroscopy, 2nd ed.; Kluwer Academic/Plenum: New York, 1999. (24) Clapp, A. R.; Medintz, I. L.; Mauro, J. M.; Fisher, B. R.; Bawendi, M. G.; Mattoussi, H. Fluorescence resonance energy transfer between quantum dot donors and dye-labeled protein acceptors. J. Am. Chem. Soc. 2004, 126, 301−310. (25) Sapsford, K. E.; Pons, T.; Medintz, I. L.; Higashiya, S.; Brunel, F. M.; Dawson, P. E.; Mattoussi, H. Kinetics of metal-affinity driven selfassembly between proteins or peptides and CdSe−ZnS quantum dots. J. Phys. Chem. C 2007, 111, 11528−11538. (26) Wang, J.; Xia, J. Capillary electrophoretic studies on displacement and proteolytic cleavage of surface bound oligohistidine peptide on quantum dots. Anal. Chim. Acta 2012, 709, 120−127. (27) Díaz-Cruz, M. S.; Mendieta, J.; Monjonell, A.; Tauler, R.; Esteban, M. Study of the zinc-binding properties of gluathione by differential pulse polarography and multivariant curve resolution. J. Inorg. Biochem. 1998, 70, 91−98. (28) Linder, D. P.; Rodgers, K. R. A theoretical study of imidazoleand thol-based zinc binding groups relevant to inhibition of metzincins. J. Phys. Chem. B 2004, 108, 13839−13849. (29) Hochuli, E.; Bannwarth, W.; Döbeli, H.; Gentz, R.; Stüber, D. Genetic approach to facilitate purification of recombinant proteins with a novel metal chelate adsorbent. Nat. Biotechnol. 1988, 6, 1321− 1325.

surface immobilization, which paved the way to controlled protein−nanoparticle self-assembly inside cells.

■

ASSOCIATED CONTENT

* Supporting Information S

General materials and instruments. Expression and purification of Histag-mCherry and GCN-mCherry. Synthesis of watersoluble quantum dots. Fluorescent measurement assays. Analytical gel filtration. Peptide synthesis and purification. Calculation of the Förster distance R0, FRET efficiency E, and average donor−acceptor separation distance at saturation r16. Sequencing results of plasmid encoding GCN-mCherry and Histag-mCherry. FRET from QDs to His-mCherry. Imidazole quenching of QD565 fluorescence. Im-displacement-induced fluorescence change in QD assemblies. PHPD structure and MS characterization. Two-step kinetics of Im-displacementinduced ligand displacement and fluorescence quenching in QD-Histag-mCherry. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We acknowledge financial support from a direct grant for research 2010/11 of the Chinese University of Hong Kong (CUHK 2060385) and the Research Grants Council of Hong Kong (GRF grant CUHK 403711).

■

REFERENCES

(1) Yu, D.; Wang, C.; Guyot-Sionnest, P. N-type conducting CdSe nanocrystal solids. Science 2003, 300, 1277−1280. (2) Dong, A.; Ye, X.; Chen, J.; Kang, Y.; Gordon, T.; Kikkawa, J. M.; Murray, C. B. A generalized ligand-exchange strategy enabling sequential surface functionalization of colloidal nanocrystals. J. Am. Chem. Soc. 2011, 133, 998−1006. (3) Colvin, V. L. The potential environmental impact of engineered nanomaterials. Nat. Biotechnol. 2003, 21, 1166−1170. (4) Lynch, I.; Dawson, K. A.; Linse, S. Detecting cryptic epitopes created by nanoparticles. Sci. STKE 2006, 327, pe14. (5) Milani, S.; Bombelli, F. B.; Pitek, A. S.; Dawson, K. A.; Rädler, J. Reversible versus irreversible binding of transferrin to polystyrene nanoparticles: soft and hard corona. ACS Nano 2012, 6, 2532−2541. (6) Monopoli, M. P.; Walczyk, D.; Campbell, A.; Elia, G.; Lynch, I.; Bombelli, F. B.; Dawson, K. A. Physical−chemical aspects of protein corona: relevance to in vitro and in vivo biological impacts of nanoparticles. J. Am. Chem. Soc. 2011, 133, 2525−2534. (7) Walczyk, D.; Bombelli, F. B.; Monopoli, M. P.; Lynch, I.; Dawson, K. A. What the cell “sees” in bionanoscience. J. Am. Chem. Soc. 2010, 132, 5761−6768. (8) Lundqvist, M.; Stigler, J.; Elia, G.; Lynch, I.; Cedervall, T.; Dawson, K. A. Nanoparticle size and surface properties determine the protein corona with possible implications for biological impacts. Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 14265−14270. (9) Cedervall, T.; Lynch, I.; Lindman, S.; Berggård, T.; Thulin, E.; Nilsson, H.; Dawson, K. A.; Linse, S. Understanding the nanoparticle− protein corona using methods to quantify exchange rates and affinities of proteins for nanoparticles. Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 2050−2055. (10) Klein, J. Probing the interactions of proteins and nanoparticles. Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 2029−2030. 13792

dx.doi.org/10.1021/la302902m | Langmuir 2012, 28, 13788−13792