Gold Nanoparticle Based Hairpin-Locked-DNAzyme Probe for

Subscriber access provided by CORNELL UNIVERSITY LIBRARY

Article

Gold Nanoparticle Based Hairpin-Locked-DNAzyme Probe for Amplified miRNA Imaging in Living Cells Yanjing Yang, Jin Huang, Xiaohai Yang, Xiaoxiao He, Ke Quan, Nuli Xie, Min Ou, and Kemin Wang Anal. Chem., Just Accepted Manuscript • Publication Date (Web): 15 May 2017 Downloaded from http://pubs.acs.org on May 15, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Gold Nanoparticle Based Hairpin-Locked-DNAzyme Probe for Amplified miRNA Imaging in Living Cells Yanjing Yang, Jin Huang*, Xiaohai Yang, Xiaoxiao He, Ke Quan, Nuli Xie, Min Ou, Kemin Wang *

State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and

Chemical

Engineering,

College

of

Biology,

Key

Laboratory

for

Bio-Nanotechnology and Molecular Engineering of Hunan Province, Hunan University, Changsha 410082, P. R. China.

Tel/Fax: +86-731-88821566, Email: [email protected]; [email protected].

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: A new class of intracellular nanoprobe, termed AuNP-based hairpin-locked-DNAzyme probe, was developed to sense miRNA in living cells. Briefly, it consists of an AuNP and hairpin-locked-DNAzyme strands. In the absence of target miRNA, the hairpin-locked-DNAzyme strand form a hairpin structure by intramolecular hybridization, which could inhibit the catalytic activity of DNAzyme strand and the fluorescence is quenched by the AuNP. However, in the presence of target, the target-probe hybridization can open the hairpin and form the active secondary structure in the catalytic cores to yield an ‘active’ DNAzyme, which then cleaves the self-strand with the assist of Mg2+. The cleaved two shorter DNA fragments are separated with the target. As a result, the fluorophores are released from the AuNP and the fluorescence is enhanced. Meanwhile, the target is also released and binds to another hairpin-locked-DNAzyme strand to drive another cycle of activation. In such a way, the target-recycling amplification leads to significant signal enhancement and thus offers high detection sensitivity.


Page 2 of 26

Page 3 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION

MicroRNAs (miRNAs) are series of single-stranded, small (approximately 19−23 nucleotides), noncoding RNAs that can serve as the key controller of gene expression and play significant roles in a diverse range of cellular processes.1-3 In particular, there is accumulating evidences that the dysregulated expression of miRNAs is associated with various human diseases, such as cancers.4-6 Owing to these properties, miRNAs may function as viable biomarker for cancer diagnosis and prognosis. Thus, sensitive and accurate detection of miRNAs, especially monitoring miRNA expression in living cancer cells in situ would be highly desirable. However, due to the low abundance of miRNAs in cells and complex environment in vivo, an efficient amplification strategy is imperative for intracellular miRNA imaging. DNAzymes are DNA sequences that can catalyze a wide variety of reactions, such as ribonucleic acid cleavage.7 DNAzymes have shown great promise as molecular tools in the design of biosensors and nanodevices, because of their unique characters, including good stability, low nonspecific adsorption, and easy preparation.8-12 Moreover, the multiple enzymatic turnover properties make DNAzymes outstanding signal amplifiers for enzyme-free and highly sensitive detection of many different targets. In the past few years, quite a few amplified sensing platforms based on DNAzymes have been established, such as catalytic and molecular beacon (CAMB) by integrating a molecular beacon with a DNAzyme catalytic beacon,13 DNAzyme-Based Rolling-Circle Amplification DNA Machine reported by Li et al.14 However, the majority of these methods are limited to the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

sensing of targets in extracellular environment, with very few demonstrating the detection in living cells. Especially, the intracellular sensor based on DNAzymes is little explored for imaging miRNA, only Zhu et al have reported a nanodevice based on split MNAzyme, one kind of DNAzyme, for multiplexed imaging of intracellular microRNA.15 However, there are two problems in this design. First, the substrate strand, which isn’t inhibited, could be cleaved even in the absence of target, resulting in the high background signal. Second, the complex and elaborate probe designing processes, which require the surface of mesoporous silica-coated gold nanorods (MSGRs) and several DNA strands to participate in the whole process simultaneously to achieve the amplification detection, would cause a limited amount of active DNAzymes and minimized hydrolysis reaction. To address these problems, we design a facile probe, named gold nanoparticle (AuNP)-based hairpin-locked-DNAzyme probe, for amplified imaging of miRNA in living cells. A key of the probe is by applying a unimolecular design, in which the DNAzyme, substrate, and target-binding sequence are linked together and become an intact hairpin structure. As shown in Figure 1, the probe comprises an AuNP and hairpin-locked-DNAzyme strands. The AuNP core, which possesses the ability to enter cells and distance-dependent optical features, acts a cellular transporter and fluorescence quencher. The hairpin-locked-DNAzyme strands, functionalized with the fluorophore of FAM at the 5’ end and thiol at the 3’ end, consist of four essential structural sections, including a target-binding sequence, a DNAzyme sequence which is a Mg2+-dependent 10-23 DNAzyme,16 substrate sequence containing a cleavage site,


Page 4 of 26

Page 5 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and a linker. Designing the hairpin-locked-DNAzyme probe, the length of target-binding sequence should be considered, because it would influence the activation of DNAzyme and the recycle of the targets. According to the previous literatures,15, 17, 18 (9 + 9) binding arms are chosen. The linker, which is composed of poly T and used to tie together the 10-23 DNAzyme and its substrate, is hybridized to poly A to form the hairpin structure. In the absence of target miRNA, the hairpin-locked-DNAzyme strand could form hairpin structure by intramolecular hybridization, which could inhibit the catalytic activity of DNAzyme strand, and fluorescence is efficiently quenched by the vicinity of the fluorophores to the AuNP surface. While in the presence of target miRNA, target-probe hybridization opens the hairpin and forms the active secondary structure in the catalytic cores to yield an ‘active’ DNAzyme, which then cleaves the self-strand at the facing ribonucleotide moiety with the assist of Mg2+. Because of the lower affinity, the cleaved two shorter fragments are separated with the target. As a result, fluorophores are released and the fluorescence is enhanced. Meanwhile, the intact miRNA strand (target) is released and binds to adjacent hairpin-locked-DNAzyme strand to drive another cycle of activation, cleavage, and turnover. In this method, target-recycling amplification leads to significant signal enhancement and thus offers high detection sensitivity.

EXPERIMENTAL SECTION

Chemicals and Materials. Trisodium citrate was obtained from Sinopharm Chemical Reagent Co., Ltd. (China). Chloroauric acid (HAuCl4·4H2O) was obtained from



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Shanghai Chemical Reagent Company (Shanghai, China). DNase I endonuclease, were from TaKaRa Biotechnology Co., Ltd (Dalian, China). Calcimycin were obtained from Sangon Biotechnology Co., Ltd (Shanghai, China). SYBR Gold was purchased from Invitrogen (USA). All cells were obtained from Cell Bank of the Committee on Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). All other reagents were of analytical grade. Cell culture products were purchased from Clontech (Mountain View, CA). All aqueous solutions were prepared using DEPC-treated ultrapure water. All oligonucleotides were synthesized and HPLC purified by TaKaRa Bio Inc. (Dalian, China). The sequences (from 5′to 3′) of the involved oligonucleotides are listed in as follows: DNAzyme in probe: CAAAAACATCTTTACGCTrAGTCTTTTTTTTTGATCCGAG CCGGACGAAGCGACAGTGTT DNAzyme in L-probe: CAAAAACCATCTTTAGCTrAGTCTTTTTTTTTGATCCGA GCCGGACGAAGCAGACAGTGTTA DNAzyme in Mis-probe: CAAAAACAGCTTTACGCTrAGTCTTTTTTTTTGATCC GAGCCGGACGAAGCGAGAGTGAT miRNA-141 perfectly matched DNA target: TAACACTGTCTGGTAAAGATGG miRNA-141: UAACACUGUCUGGUAAAGAUGG miR-200b: UAAUACUGCCUGGUAAUGAUGA let-7d: AGAGGUAGUAGGUUGCAUAGUU miR-429: UAAUACUGUCUGGUAAAACCGU Apparatus. The transmission electron microscopic (TEM) were performed with a JEM-2100 transmission electron microscope (JEOL Ltd., Japan). The UV-vis


Page 6 of 26

Page 7 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


absorption spectra were measured with a Biospec-nano UV-vis spectrophotometer (Japan). The fluorescence spectra were recorded on a Hitachi F-7000 fluorescence spectrometer (Japan). The cells were visualized under an Olympus IX-70 inverted microscope with an Olympus FluoView 500 confocal scanning system. Cellular TEM images were gained on a FEI Tecnai G2 Spirit at an accelerating voltage of 120 kV. Preparation of probe. Citrate-stabilized gold nanoparticles were prepared by the classical method, which was developed by Michael J. Natan et al.19 Trisodium citrate of 1% solution (3.5 mL) was added to a boiling, rapidly stirred solution of HAuCl4 (100ml, 0.01%). The solution turned blue and finally red. It was kept boiling and stirred for another 10 min during which time its color changed from pale yellow to deep red. Following that, a 0.45 µm Millipore membrane filter was used to filter the solution. The prepared AuNPs were stored at 4 °C. The sizes of the nanoparticles were verified by TEM. After reduced by Tris (2-carboxyethyl) phosphine hydrochloride (TCEP·HCl), thiol-modified oligonucleotides were added to 13 nm gold colloids at a concentration of 3 µM of oligonucleotide per 1 mL of 10nM colloid and shaken overnight. After 16 hours, PBS solution (100 mM phosphate buffer of pH 7.4 with 2 M NaCl) was added to the mixture to reach a 0.01 M phosphate concentration, and the salt concentration of the mixture was slowly increased to 0.3 M NaCl. The final products were centrifuged (13000 rpm, 30 min) and washed three times and then stored in Tris–HCl buffer (25 mM, 100mM NaCl, pH 7.4) for the following experiments. The



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

concentration of the particles was determined by measuring their extinction at 524 nm (ε = 2.7 × 108 L mol-1 cm-1). DNA stands functionalized on AuNPs were quantitated according to the previous protocol.20 Briefly, the solution was treated with mercaptoethanol (20mM) and shaken overnight at room temperature. Then, released DNA probes were separated via centrifugation. The concentration of DNA strands was determined by fluorescence measurements and comparing to a standard curve. Gel electrophoresis. Three aliquots of solution (10 µL) containing 2 µM DNAzyme, 25 mM Tris-HCl buffer (pH 7.4) containing 100 mM NaCl were heated to 95 °C, maintained 5 min, then slowly cooled to room temperature before use. Two aliquots of solution were incubated with MgCl2 in the presence or absence of 500nM target. The products were separated using 12% denaturing polyacrylamide gel for analysis. Fluorescence experiments. For analyte detection, the probe was diluted to the concentration of 2 nM in Tris-HCl buffer and incubated with increasing concentrations of miRNA-141 (0, 200 pM, 500 pM, 1 nM, 2.5 nM, 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 150 nM). After incubation for 8 h at 37 °C, the fluorescence was measured with excitation at 485 nm. In kinetic study, DNA targets of 150 nM were employed. The kinetic study was performed at 37 °C by excitation with a 485 nm excitation wavelength and a 525 nm emission wavelength. For selectivity test, a certain concentration of miR-141, miR-429, miR-21, and let-7d stock solution were added into the probes with a final concentration of 150 nM.


Page 8 of 26

Page 9 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cytotoxicity assay. LOVE-1 cells were dispersed into 96-well plates at a final concentration of 1×105 cells/well and cultured for overnight. Then the culture medium was removed and replaced with new medium containing probes at varying concentrations of 0, 2, and 5 nM. Following that, the cells were incubated for 6, 12, 18, and 24 h respectively. Cell viability was measured by using the MTT assay.21 Cellular TEM images. According to our previous literature,22 LOVE-1 cells seeded in 6-well plate were grown to 80% confluence followed by treatment with 2 nM of nanoprobe. After 8h, the cells were digested with 0.25% trypsin and then centrifuged. For the purpose of fixation, 2.5% glutaraldehyde and 1% osmic acid in PBS was added. Following fixation, the cells were rinsed with PBS and dehydrated in a graded series of acetone (50, 70, 90 and 100%). After dehydration, a mixture of resin and ethanol (in a ratio 50:50) was added for 40 min. Then 100% resin was added to replace the diluted resin mixture and to infiltrate into the cell pellet overnight. Infiltration was performed by addition of 100% epon-araldite. The infiltrated specimen was cut into ultrathin sections in 80nm thickness and stained with 3% uranyl acetate and lead nitrate. Finally, the samples were then imaged with a FEI Tecnai G2 Spirit at an accelerating voltage of 120 kV. Confocal fluorescence imaging. All cell lines were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and 100 U/ml 1% antibiotics penicillin/streptomycin and in a 100% humidified atmosphere containing 5% CO2 at 37 °C. All cells were plated on chamber slides for 24 h.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

In comparative experiment of Mis-probe and miRNA-141-targeting probe, LOVE-1 cells were plated on chamber slides for 24 h. Then, all of the cells were incubated with 4 nM Mis-probe or miRNA-141-targeting probe for 8 h. After the incubation, the cells were washed three times with PBS (pH 7.4) before imaging. For investigation of the expression levels of miRNA-141 in different cells, LOVE-1cells, SMMC-7721 cells, HeLa cells and 22Rv1 cells were prepared. All cells were first incubated with 4 nM probes for 8h, then washed and imaged. The cells were visualized under an Olympus IX-70 inverted microscope with an Olympus FluoView 500 confocal scanning system. The fluorescence images were taken under 100× oil-immersion objective. FAM fluorescence image was recorded in green channel with a 505 nm (±10 nm) bandpass filter. Flow cytometric assay. LOVE-1 cells were incubated with probes and Mis-probes. After 8h, the cells were washed to remove the redundant particles. Cells were then detached from culture dishes using Trypsin-EDTA Solution. The solution containing treated cells was centrifuged (2000 rpm, 4 min) and washed three times. Flow cytometric assay was performed using Beckman Coulter Gallios machine. qRT-PCR. Total cellular RNA samples were extracted from LOVE-1 cells, SMMC-7721 cells, HeLa cells and 22Rv1 cells respectively, using Trizol reagent (Sangon Co.Ltd., Shanghai, China) according to the manufacturer’s protocol. The cDNA synthesis was performed by using the reverse transcription (RT) reaction with AMV First Strand cDNA Synthesis Kit (BBI, Toronto, Canada). qPCR analysis of


Page 10 of 26

Page 11 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


miRNA was carried out with SG Fast qPCR Master Mix(2X) (BBI) on an LightCycler480 Software Setup (Roche). The primers were listed as follows: miR-141 forward: 5’-ACACTCCAGCTGGGTAACACTGTCTGGT-3’; miR-141 reverse: 5’-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCC ATCTTT -3’; U6 forward: 5’- CTCGCTTCGGCAGCACA -3’; U6 reverse: 5’- AACGCTTCACGAATTTGCGT -3’.

RESULTS AND DISCUSSION To prepare the AuNP-based hairpin-locked-DNAzyme probe, 13 nm AuNPs were prepared and functionalized with thiol-terminated hairpin-locked-DNAzyme strands via gold- thiol bond formation (Figure S1). Qauntification of DNA strands loading by fluorescence reveals that the average number of hairpin-locked-DNAzyme strands on each AuNP was determined to be ~31 (Figure S2). Because miR-141 has been reported to be associated with a wide range of common human cancers including breast, lung, colon, and prostate cancer,23 it was chosen as the model in the following assay. We first performed a 12% denaturing polyacrylamide gel to validate this design. The results showed a distinct self-cleavage product upon addition of the synthetic DNA targets, while no cleavage was observed in the absence of target (Figure S3). It was evident that, upon hybridization, the target acted as an allosteric effector to trigger a conformation switching of the uniform DNAzyme strand into a cleavage responsible active DNAzyme structure in an Mg2+-dependent fashion and exhibited



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

the specific cleavage ability. In vitro target binding studies of the probe were performed by addition of different concentrations of miR-141. As shown in Figure 2(a), the probe exhibited a significant fluorescence increase upon addition of targets. To manifest the feature of signal amplification of our probe, we designed a probe with longer binding arms (L-probe) as control, in which one side of the target-binding sequence is longer, resulting in the corresponding higher melting temperature (45 ℃), so that the target could not be released even after the cleavage of the substrate. The results in Figure 2(b) suggested that the changes in fluorescence intensity fold (F/F0) were in a dose-dependent manner. An immediate ~8 fold increase in fluorescent signal was observed at the concentration of 150 nM. The limit of detection was calculated to be ~25 pM based on 3σ method, which yields about 25-fold signal amplification than that of the L-probe. The high sensitivity of the probe was due to the target-recycling amplification. The kinetics of the AuNP-based hairpin-locked-DNAzyme probe was characterized by measuring the fluorescence intensities at different time points (Figure S4). Probe activation was obtained after 6.5 hours reaction and this condition was selected for subsequent miR-141 specificity analysis. As for specificity analysis, a great challenge is to discriminate differences between miRNA family members because of the high sequence similarity among them. miR-141, miR-429, miR-21, and let-7d, all of which belong to the miR-200 family, were selected for investigation the sequence-specificity of probe assay. As shown in Figure 3, the fluorescence intensity produced by miR-141 was approximately 8-fold of that produced by other miRNAs.


Page 12 of 26

Page 13 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The results indicated that the specificities of the probe were high enough to discriminate between the four miR-200 family members and demonstrate potential with regard to application in complex cellular environment. To apply the probe for imaging of miRNAs in living cells, the bio-compatibility, the stability and cellular uptake of the probes are main concerns. MTT assays were carried out to evaluate the potential cytotoxicity of the probe on LOVE-1 cells. It was observed that cells could retain above 90% viability after the treatment of the probe under concentrations up to 5nM (Figure S5). Afterward, a series of experiments were performed to evaluate the nuclease stability of the probe under physiological condition (Figure S6). There was only marginal degradation for the probe with DNase I compared to the probe without DNase I, while DNAzyme with BHQ-1 instead of AuNP was degraded 6 times rapidly than the probe under the same condition. These indicated that the probe possesses low background and high resistance to nuclease with the help of AuNP, and further demonstrated that the fluorescence recovery was indeed due to the target-induced activation-cleavage reaction instead of nuclease degradation. We next investigated whether our probes can enter cells. The probe could naturally permeate the cell membrane of LOVE-1 cells after 6 h of incubation. TEM imaging data indicated that, after cellular entry, the probes resided in the cytosol as individual particles (Figure S7). According to the above results, we next applied the probe for imaging of miRNA-141 in living cancer cells. Positive cell line (LOVE-1) containing a high expression level of miRNA-141, and a control cell line (SMMC-7721) with minimal



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

level of miRNA-141,24 were tested. Considering the important role of Mg2+, which acted as a cofactor to help the DNAzyme sequence to form a catalytic core for the cleavage, we investigated weather our probe could work at physiological conditions. Four groups of cells were prepared. The group (a) and group (c) which were LOVE-1 cells and SMMC-7721 cells respectively, were first treated with 20 mM MgCl2 and 5 µM calcimycin, a divalent cation ionophore which allows Mg2+ to cross the cell membrane,25 and then incubated with the probe. The group (b) and group (d) which were LOVE-1 cells and SMMC-7721 cells treated with the probes only. All groups of cells were incubated with the probes for various duration of time from 0 to 10h, and then imaged by a confocal microscope. Figure 4 showed that the fluorescence intensity in LOVE-1 cells from group (a) and group (b) were gradually increased with the incubation time. In group (a), the fluorescence intensity observed from cells had reached saturation at 8h, while the fluorescence signals increased with the incubation time until about 10h in group (b). No obvious fluorescence was observed, at all times, from the SMMC-7721 cells in group (c) or group (d). The results indicated that the probe could be applied for imaging miRNA in living cells at physiological concentration of Mg2+. To further manifest that the fluorescence observed was due to the target induced self-cleavage of hairpin-locked-DNAzyme strand, a control probe termed Mis-probe was prepared, in which there were three mismatched bases in the target-binding sequence of DNAzymes. LOVE-1 cells were incubated with active probes and Mis-probes, and then imaged using scanning confocal microscopy. In Figure 5(a),


Page 14 of 26

Page 15 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


LOVE-1 cells treated with such Mis-probes showed less fluorescence as compared to those treated with the active probes. Furthermore, the analyses by flow cytometry in Figure 5(b) suggested that the cells using Mis-probes showed less fluorescence than those with active probes. These results demonstrated the specificity of the probe for target miRNA-141 imaging. To investigate whether the fluorescence intensity of the probes were correlated very well with the levels of miRNA-141 expression, we chose two positive cell lines (LOVE-1 cells, 22Rv1 cells) and two control cell lines (SMMC-7721, HeLa cells) to perform the intracellular miRNA-141 detection.24 The concentrations of miR-141 in these different cell lysate samples were measured by the quantitative real-time PCR (qRT-PCR), which is a widely used standard method for analyzing miRNAs from the cell lysate. As shown in Figure 6, the images exhibited bright fluorescence of FAM for miRNA-141 in LOVE-1 cells, 22Rv1 cells were observed, and almost no fluorescence signals in SMMC-7721 cells, HeLa cells were detected. The results suggested that positive cells expressed a relatively higher level of miR-141 than control cells, which were consistent with the results of qRT-PCR (Figure S8). It was evident that the probe had a promise in practical application with great accuracy and reliability for miRNA detection.

CONCLUSIONS

In summary, we developed a new probe with simple design, named AuNP-based hairpin-locked-DNAzyme probe, for amplified detection of specific miRNA and



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

demonstrated its application for imaging of miRNAs in living cells. This new imaging method had been demonstrated simple, sensitive and non-destructive signal amplification of miRNA in live cells. Based on the hairpin design and the quenching ability of AuNP, the probe presented a high signal/noise ratio. Given that the target-binding sequence can be changed to any complementary strand of any given DNA/RNA, so the AuNP-based hairpin-locked-DNAzyme probe could be applied to detection of different miRNAs in living cells, which ensured the wide application of probe. This method may act as a new tool for understanding of miRNAs functionality in a vast range of biological processes, and provide useful in the development of fundamental research and clinical diagnostics.

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (21675046, 21675047), the Foundation for Innovative Research Groups of NSFC (21521063), the National Natural Science Foundation of Hunan Province (2017JJ2039) and the Fundamental Research Funds for the Central University. Supporting Information

Additional figures as noted in the text (PDF). This material is available free of charge via the Internet at http://pubs.acs.org.

REFERENCES


Page 16 of 26

Page 17 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1.

Lu, J.; Getz, G.; Miska, E. A.; Alvarez-Saavedra, E.; Lamb, J.; Peck, D., Sweet-Cordero, A.; Ebert, B. L.; Mak, R. H.; Ferrando, A. A.; Downing, J. R.; Jacks, T.; Horvitz, H. R.; Golub, T. R. Nature 2005, 435, 834-838.

2.

Croce, C. M. Nat. Rev. Genet. 2009, 10, 704-714.

3.

Rossi, J. J. Cell 2009, 137, 990-992.

4.

Tricoli, J. V.; Jacobson, J. W. Cancer Res. 2007, 67, 4553-4555.

5.

Ryan, B. M.; Robles, A. I.; Harris, C. C. Nat. Rev. Cancer 2010, 10, 389-402.

6.

Roa, W.; Brunet, B.; Guo, L.; Amanie, J.; Fairchild, A.; Gabos, Z.; Nijjar, T.; Scrimger, R.; Yee, D.; Xing, J. Clin. Invest. Med. 2010, 33, 124-132.

7.

Gong, L.; Zhao, Z.; Lv, Y. F.; Huan, S. Y.; Fu, T.; Zhang, X. B.; Shen, G. L.; Yu, R. Q. Chem. Commun. 2015, 51, 979-995.

8.

Zhao, X. H.; Gong, L.; Zhang, X. B.; Yang, B.; Fu, T.; Hu, R.; Tan, W.; Yu, R. Q. Anal. Chem. 2013, 85, 3614-3620.

9.

Ali, M. M.; Li, Y. Angew. Chem, Int. Ed. 2009, 121, 3564-3567.

10. Huang, Y.; Ma, Y.; Chen, Y.; Wu, X.; Fang, L.; Zhu, Z.; Yang, C. J. Anal. Chem. 2014, 86, 11434-11439.

11. Lu, L. M.; Zhang, X. B.; Kong, R. M.; Yang, B.; Tan, W. H. J. Am. Chem. Soc. 2011, 133, 11686-11691.

12. Cheng, Y.; Huang, Y.; Lei, J.; Zhang, L.; Ju, H. Anal. Chem. 2014, 86, 5158-5163.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

13. Zhang X.; Wang Z.; Xing H.; Xiang Y.; Lu Y. Anal. Chem. 2010, 82, 5005-5011.

14. Wen, Y.; Xu, Y.; Mao, X.; wei, Y.; Song, H.; Chen, N.; Huang, Q.; Fan, C.; Li, D. Anal. Chem. 2012, 84, 7664-7669.

15. Zhang, P.; He, Z.; Wang, C.; Chen, J.; Zhao, J.; Zhu, X.; Li, C. Z.; Min, Q.; Zhu, J. ACS nano 2014, 9, 789-798.

16. Mei, S. H.; Liu, Z.; Brennan, J. D.; Li, Y. J. Am. Chem. Soc. 2003, 125, 412-420.

17. Sando, S.; Narita, A.; Sasaki, T.; Aoyama, Y. Org. Biomol. Chem. 2005, 3, 1002-1007.

18. Sando, S.; Sasaki, T.; Kanatani, K.; Aoyama, Y. J. Am. Chem. Soc. 2003, 125, 15720-15721.

19. Grabar, K. C.; Freeman, R. G.; Hommer, M. B.; Natan, M. J. Anal. Chem. 1995, 67, 735-743.

20. Demers, L. M.; Mirkin, C. A.; Mucic, R. C.; Reynolds, R. A.; Letsinger, R. L.; Elghanian, R.; Viswanadham, G. Anal. Chem. 2000, 72, 5535-5541.

21. Li, L.; Gao, F. F.; Ye, J.; Chen, Z. Z.; Li, Q.; Gao, W.; Ji, L.; Zhang, R.;

Tang, B. Anal. Chem. 2013, 85, 9721-9727. 22. Huang, J.; Ying, L.; Yang, X. H.; Yang, Y. J.; Quan, K.; Wang, H.; Xie, N. L.; Ou, M.; Zhou, Q. F.; Wang, K. M. Anal. Chem. 2015, 87, 8724-8731.

23. Yin, B. C.; Liu, Y.; Ye, B. C. J. Am. Chem. Soc. 2012, 134, 5064-5067.


Page 18 of 26

Page 19 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


24. Wang, Q.; Li Q.; Yang X. H.; Wang, K. M.; Du, S. S.; Zhang, H; Nie, Y. Biosens. Bioelectron. 2016, 77, 1001-1007.

25. Chaney, M. O.; Demarco, P. V.; Jones, N. D.; Occolowitz, J. L. J. Am. Chem. Soc. 1974, 96, 1932-1933.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. The working mechanism of the AuNP based hairpin-locked-DNAzyme probe for miRNA detection.


Page 20 of 26

Page 21 of 26

(a) Fluorescence intensity(a.u)

2500

150 nM 100 nM 50 nM 25 nM 10 nM 2.5 nM 1 nM 500 pM 200 pM 0

2000

1500

1000

500

0 520

540

560

580

600

Wavelength(nm)

(b) 10 L-probe probe

8

6

F/F0

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4

2

0 10-11

10-10

10-9

10-8

10-7

10-6

Concentration(M)

Figure 2. (a). Fluorescence emission spectra (excitation at 485 nm) of the AuNP based hairpin-locked-DNAzyme probe upon addition of various concentrations of miRNA-141 in vitro at 37 °C. (b). Comparison of calibration curves corresponding to probe and L-probe, respectively, where F0 and F are the FAM fluorescence signals in the absence and the presence of miRNA-141, respectively.



(a) 3000

Fluorescence intensity(a.u)

8

6

F/F0

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 26

4

background miR-141 miR-21 let-7d miR-429

2500 2000 1500 1000 500 0

500

520

540

2

560

580

600

620

Wavelength(nm)

0

miR-141

control

miR-21

let-7d

miR-429

(b) miR-141: miR-21: let-7d: miR-429:

5’-UAACACUGUCUGGUAAAGAUGG-3’ 5’-UAGCUUAUCAGACUGAUGUUGA-3’ 5’-AGAGGUAGUAGGUUGCAUAGUU-3’ 5’-UAAUACUGUCUGGUAAAACCGU-3’

Figure 3. Specificity studies of the probe at 37 °C. (a) Bars represent the fluorescence ratio (F/F0) upon the different miRNAs targets. Inset: Fluorescence emission spectra toward the different miRNAs targets. (b) Sequences of miR-141, miR-21, let-7d and miR-429. The bases that differ from those in miR-141 are marked in red.


Page 23 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2h

4h

6h

8h

10h

LOVE-1

(a) LOVE-1

(b) 7721

(c) 7721

(d) Figure 4. Real-time imaging of intracellular miR-141 in four groups. (a). LOVE-1 cells were first treated with 20 mM MgCl2 and 5 µM calcimycin, and then incubated with the probe. (b) LOVE-1 cells were incubated with the probe only. (c) SMMC-7721 cells were first treated with 20 mM MgCl2 and 5 µM calcimycin and then incubated with the probe. (d) SMMC-7721 cells were incubated with the probe only. Scale bars are 20 µm.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(a)

FAM

Merge

Page 24 of 26

Bright

probe

Mis probe

(b) probe Mis-probe

Figure 5. (a) Fluorescence images of LOVE-1 cells incubated with the probe or Mis-probe. The excitation wavelength was 488 nm, and the images were collected in the range of 505–525 nm. Scale bar is 20 µm. (b) Flow cytometry analysis of LOVE-1 cells treated with the probe or Mis-probe.


Page 25 of 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


FAM

Merge

Bright

LOVE-1

SMMC7721

22Rv1

HeLa

Figure 6. Confocal fluorescence imaging of miRNA-141 in LOVE-1, SMMC-7721, 22Rv1, and HeLa cells. The excitation wavelength was 488 nm, and the images were collected in the range of 505–525 nm. Scale bar is 20 µm.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For TOC only


Page 26 of 26

Gold Nanoparticle Based Hairpin-Locked-DNAzyme Probe for

Recommend Documents