Graphene Oxide Scaffold - American Chemical Society

Subscriber access provided by READING UNIV

Article

Electrospun Poly (3-Hydroxybutyrate-Co-4-Hydroxybutyrate)/Graphene Oxide Scaffold: Enhanced Properties and Promoted in Vivo Bone Repair in Rats Tengfei Zhou, Guo Li, Shiyu Lin, Taoran Tian, Quanquan Ma, Qi Zhang, Sirong Shi, Changyue Xue, Wenjuan Ma, Xiaoxiao Cai, and Yunfeng Lin ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b14267 • Publication Date (Web): 17 Nov 2017 Downloaded from http://pubs.acs.org on November 18, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Electrospun Poly (3-Hydroxybutyrate-Co-4-Hydroxybutyrate)/Graphene Oxide Scaffold: Enhanced Properties and Promoted in Vivo Bone Repair in Rats

Tengfei Zhou§, Guo Li§, Shiyu Lin, Taoran Tian, Quanquan Ma, Qi Zhang, Sirong Shi, Changyue Xue, Wenjuan Ma, Xiaoxiao Cai, Yunfeng Lin* State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, China § These two authors contributed equally to this work *Corresponding author Tel: 86-28-85503487; Fax: 86-28-85503487; Email: [email protected]

ABSTRACT Bone tissue engineering emerges as an advantageous technique to achieve tissue regeneration. Scaffolds for it must present excellent biomechanical properties where bare polymers poorly perform. Development for new biomaterials with high osteogenic

capacity

is

urgently

pursued.

In

this

poly(3-hydroxybutyrate-co-4-hydroxybutyrate/graphene

study, oxide

an

electrospun (P34HB/GO)

nanofibrous scaffold is successfully fabricated and characterized. The effects of GO amount on scaffold morphology, biomechanical properties, and cellular behaviors are investigated. GO reduces the fiber diameter and enhances porosity, hydrophilicity, mechanical properties, cellular performance, and osteogenic differentiation of scaffolds. P34HB/GO triumphs over P34HB in in vivo bone regeneration in critical-sized calvarial defect of rats. We believe this study is the first to evaluate the capability of in vivo bone repair of electrospun P34HB/GO scaffold. With facile fabrication process, favorable porous structures, enhanced biomechanical properties and fast osteogenic capability, P34HB/GO scaffold hold practical potentials for bone tissue engineering application.

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

TOC GRAPHIC

KEYWORDS: p34hb, graphene oxide, electrospinning, scaffold, bone tissue engineering, cell homing

1. INTRODUCTION Bone defects, resulting from trauma, abnormalities, osteomyelitis, necrosis and tumors, have posed tremendous challenges for clinical management.1-3 Traditional clinical methods for repair involve allo-/autografts, artificial materials and distraction osteogenesis (DO), which may have provided positive results, but with obvious limitations such as donor morbidity, inferior healing capability, immune complications and cosmetic concerns.4 Thus, tissue engineering and regenerative medicine have emerged as promising approaches to overcome these aforementioned shortcomings with a combination of biodegradable scaffold, cytokines, and functional seeding cells.5 Scaffolds have been considered a key factor of bone tissue engineering (BTE). Not only do scaffolds provide a shelter for cells, they also regulate cellular behaviors via a porous microenvironment.6 Besides, a scaffold for BTE purposes calls for specific pore size, pore interconnectivity and desirably high porosity.7-8 Importantly, scaffolds


Page 2 of 32

Page 3 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for BTE should possess enough strength at loading-bearing sites and match the mechanical properties of the recipient tissue.9-10 Additionally, scaffolds should be nontoxic,

biodegradable,

and

biocompatible,

which

calls

for

excellent

hydrophilicity.11 Electrospinning technique has been applied as an effective tool to fabricate fibrous scaffolds with better mimicry of the natural extracellular matrix (ECM) and advantages such as higher porosity, and enlarged specific surface area.12-20 The

latest

generation

of

polyhydroxyalkanoate

(PHA)

family,

poly(3-hydroxybutyrate-co-4-hydroxybutyrate) co-polymer (P34HB), has attracted more

attention

in

the

biomedical

field

than

its

predecessors

like

poly(3-hydroxybutyrate-co-3-hydroxybutyrate) (PHBV) and poly-hydroxybutyrate (PHB).21-22 So far, researches about P34HB have mainly focused on the central nervous system, cartilage and cardiovascular tissues.23-27 Our group also conducted studies on its properties in different fields.24-25, 28-29 Fu et al. compared two types of P34HB (the electrospun scaffold and deposited film) and proved that the scaffold held better cellular performance in adipose-derived stem cells (ASCs).28 Additionally, cellular behaviors on the deposited films and its capacity of in vivo cartilage regeneration were also evaluated and confirmed.24 Moreover, Li et al. further proved that a cell-seeded electrospun P34HB/TGF-β1 scaffold could promote in vivo cartilage repair in rabbits.25 However, to the best of our knowledge, the performance of this material in BTE application has barely been explored and its bone repair potential has not been confirmed with in any animal models in vivo. Additionally, the intrinsic deficiency in mechanical properties and unfavorable hydrophobicity of P34HB co-polymer strongly limited its application in the BTE field. Graphene oxide (GO), modified based on graphene (GNS), has emerged as a promising inorganic material in fields like bioimaging, biosensors, drug delivery and tissue engineering.29-37 It possesses remarkable mechanical strength due to its sp2 strongly bonded, hexagonal carbon structure.30 Besides, modification of hydroxyl and carboxyl groups helps reversing the hydrophobicity of GNS and make GO favorably hydrophilic.38 Studies on the modification of polymers with GO abound in the past



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

few decades.39-40 Similar researches have been conducted to reveal how GNS or GO influence physical, chemical, and thermal properties of PHBV or PHB polymer (not P34HB). However, the products were fabricated by simple solution casting evaporation, which were actually not the porous scaffolds for effective tissue engineering application.41-42 Furthermore, it has been revealed that GNS and GO could promote osteogenic differentiation to some degree.43-44 Nevertheless, in terms of modification, specific in vivo and in vitro influences of GO on performance of electrospun P34HB scaffold remain unclear. Bone marrow mesenchymal stem cells (BMSCs), multipotent and self-renewing, have been preferred for cell therapy and BTE application.45-46 Cell-homing based BTE achieves bone regeneration by inducing specific behaviors of host cells with biomaterials and cytokines.6 Additionally, it has outshone its rivals with reduced pain and more simplified procedures over the past few years.47 However, only few studies investigated the potential of

BMSCs on P34HB scaffold for BTE purposes.

In this study, we successfully fabricated and characterized an electrospun three-dimensional nanofibrous P34HB/GO scaffold for the first time. The effect of the GO amount on the scaffold properties and BMSC behaviors, including osteogenic differentiation, were investigated. In vivo bone regeneration with acellular scaffolds in full-thickness rat calvarial defects was assessed radiographically and histologically. Under the background of GO amount, osteogenic capability of electrospun P34HB and P34HB/GO scaffolds was evaluated, in vitro and in vivo. This study further reveals scaffold fabrication and modification of PHB family and shed some light on its potential for bone tissue engineering application.

2. EXPERIMENTAL SECTION

Ethics statement The animal experimental protocol was censored with approval by the institutional review board (IRB) of State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases. Our experimental procedures also followed the relevant ethical principles.


Page 4 of 32

Page 5 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Materials P34HB (molecular weight: 3 × 105, 1% 4HB, and 99% 3HB) was ordered from Blue PHA (Beijing, China) and graphene oxide (GO) was purchased from Hengqiu Technologies (Suzhou, China). Paraffin, EDTA and all staining reagents were purchased from Sigma-Aldrich. Other analytical grade chemical reagents and solvents were all obtained from State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases (West China Hospital of Stomatology, Sichuan University, Chengdu, China) and used as received.

Fabrication of electrospun P34HB/GO scaffolds GO suspensions were prepared by a three-hour ultrasonic dispersion in 5 mL chloroform to achieve gradient w/v concentrations of 0.5 mg/mL, 1 mg/mL, and 2 mg/mL. The final electrospun solutions were obtained by homogeneously dissolving 0.75 g P34HB powder in the above solutions via magnetic stirring for 2 h. Variable-controlling method was adopted to readjust technique parameters based on our previous study on pure P34HB.24 Fabrication was performed in a hood with dry air convection (23–27 ℃, 35–45% relative humidity). The electrospun solution was pumped by a 10 mL syringe with a 21-G metallic needle (0.81 and 0.54 mm for outer and internal diameter). Other parameters were as follows: 15 kV, powered by a high-voltage supply (SS-2535, Ucalery Company, Beijing, China); distance of 15–20 cm between the copper roller and needle tip; pumping speed of 0.1 mm/min; rolling speed of 6 m/min. Taylor pendant drops were formed, elongated under an electric field, and sprayed onto collecting roller. Scaffold membranes were collected for hours and separated from silver papers. Finally, membranes were perforated into circular tablets and dried for 48 hours in a vacuum oven to evaporate any residual organic solvent. All tablets were further sterilized with 75% ethanol for 0.5 hour and ultraviolet radiation exposure for another 0.5 hour before in vitro experiments.

Scanning electron microscopy We conducted SEM (HITACHI S-4800, TOKYO, Japan) to characterize scaffold samples. 20 kV was applied as an accelerating voltage. A software (Image-Pro Plus, Mediacy, USA) was employed to evaluate fiber diameters by calculating the average



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

diameter of 100 fibers in a randomly selected field.

Atomic force microscopy We employed AFM to characterize GO (Veeco Instrument, Plainview, NY, USA). A nanoscope imaging software was applied to assess its surface morphology and thickness.

Transmission electron microscopy For fine structure characterization, a transmission electron microscope (TEM, PHILIPS CM 20) was adopted. Fibers were sprayed onto a copper grid for further analysis.

Component analysis For component assessment, X-ray powder diffraction (XRD) was performed on GO, P34HB and P34HB/GO scaffolds using a X’Pert pro X-ray diffractometer (Philip, Netherlands) at 45 kV and 40 mA. The analysis was performed with 2θ of 0–90° at 0.02°/step and 2°/min. Diffraction patterns were drawn with OriginPro 2016 software.

Porosity testing The liquid displacing method was adopted to determine the porosity of the scaffolds (n = 4 for each scaffold group). Briefly, samples (weighing Wi initially) were immersed into a container of ethanol until no bubbling was observed, ensuring the ethanol penetrated all pores. The total volume was V1 and then V2 was obtained after removing samples. The volume of the sample could be calculated as (V1 – V2) and the liquid-filled scaffold weighed Wf. Finally, the porosity of scaffold could be determined using the following equation: Porosity = (Wf / ρ－Wi / ρ) / (V1－V2), ρ = density of ethanol.

Hydrophilicity evaluation Static contact angle of water droplets on the scaffold (n = 5 for each group) was determined with an optical measuring instrument (JGA-360A, Chengde Chenghui testing co., China). Four different points of a droplet on each sample were measured and images were captured with a CCD camera (KGV-5000, Japan). Results were analyzed with the manufacturer’s software.


Page 6 of 32

Page 7 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Analysis of mechanical properties Tensile loading tests were performed with a tabletop uniaxial testing instrument (Instron 5565, USA). The loading was 50 N and crosshead speed was set at 5 mm/min. Samples were sliced into rectangles of 25 mm × 15 mm and scaffolds with GO concentration of 0, 0.5, 1 and 2 mg/mL were tested (n = 4 for each group). Stress-strain curves and parameters like Young’s modulus and tensile strength were also obtained.

Isolation and in vitro cell culture Euthanization of female Sprague–Dawley rats (three-week-old, 100–120 g) were performed by cervical dislocation. Femurs and tibias were harvested in phosphate buffer saline (PBS) to further remove muscles. Low glucose Dulbecco’s Modified Eagle Medium, containing streptomycin of 100 µg/mL and penicillin of 100 U/mL (L-DMEM), was prepared to flush the bone marrow cavity thoroughly. Marrows were collected in petri dish. Cell suspension was centrifuged at 800 r/min for 5 min after being filtrated with a 200-mesh screen. The aforementioned L-DMEM with extra 10% Fetal Bovine Serum (FBS) was used to suspend cells. Finally cells were transferred into a 25-cm2 plastic culture flask for incubation (37℃, 5% CO2). BMSCs were consequently isolated, cultured, and passaged for three generations before the cellular assays.

Cell seeding Scaffold tablets with a 5-mm diameter were placed into a 96-well plate for sterilization under ultraviolet light for 0.5 hour before cell seeding. The aforementioned BMSCs were trypsinized and suspended with DMEM. For scaffold cytotoxicity evaluation, 250 µL/well suspensions were added to achieve a concentration of 4×105 per well, and 4000 per well for adhesion and proliferation assay, respectively.

Evaluation of the scaffolds’ cytotoxicity Quantitative assessment of cytotoxicity of scaffolds was performed using cell counting kit-8 assay (CCK-8) at 24 hours after cell seeding according to manufacturer’s instructions.48 Cells seeded on scaffold-free wells functioned as the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

blank group, while cells on GO-free scaffold worked as the control group. Cytotoxicity of scaffolds with 0.5 mg/mL, 1 mg/mL, and 2 mg/mL GO were tested.

Cell adhesion The morphology of the cells cultured on scaffolds was assessed by SEM (HITACHI S-4800, TOKYO, Japan). Cellular scaffolds of 1st, 3rd, 5th, and 7th day after seeding underwent the following process before SEM observation: fixation for 3 hours with 3% glutaraldehyde; rinsing in PBS thrice to remove the remaining glutaraldehyde; dehydration with ethanol of graded v/v concentration from 30%, 50%, 75%, 85%, 95%, to 100%; treatment in hexamethyldisiloxane (HMDS) and air drying in a fume hood.

Cell proliferation assay Proliferation of cells cultured on scaffolds was quantified by CCK-8 at 1st, 3rd, 5th, and 7th day after seeding following the manufacturer’s tutorial as above.48

In vitro osteogenic differentiation To determine the osteogenic differentiation property of the scaffolds, quantitative real-time PCR was conducted with the SYBR Premix Ex Taq II PCR Kit (TAKARA, Shiga, Japan) was performed 3 days after cell seeding. The expression of the osteogenesis-related genes, including Runx 2, Alp, Ocn, Opn, Bmp-2, and Bmp-4, was examined following the manufacturer’s instruction.49 Cells on bare wells were used as the control group. The RNeasy Plus Mini Kit (Qiagen, Venlo, Netherlands) was employed to extract RNA from BMSCs on scaffolds. A kit for cDNA synthesis (Mbi, Glen Burnie, USA) in an ultimate 20 µL volume was then applied to produce cDNA after purifying the total RNA. 1 µmol/L of primers (reverse and forward) (Table 1), and 2 µL of cDNA added to the final reaction mix of 25 µL. The reaction was processed using an ABI 7300 instrument (ABI, Foster City, USA) and mRNA levels was quantified by double standard curve method. Cycle threshold (∆CT) was adopted to determine the copy numbers of genes using glyceraldehyde-3-phosphate dehydrogenase (Gapdh) as the normalized standard and internal control. Table 1. Primers in RT-PCR analysis.


Page 8 of 32

Page 9 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Genes

Forward primers

Reverse primers

GAPDH

TGGCCTCCAAGGAGTAAGAA

TGTGAGGGAGATGCTCAGTG

RUNX2

CCGAACTGGTCCGCACCGAC

CTTGAAGGCCACGGGCAGGG

ALP

CCTGACTGACCCTTCCCTCT

CAATCCTGCCTCCTTCCACT

OPN

GATCGATAGTGCCGAGAAGC

TGAAACTCGTGGCTCTGATG

OCN

GTCCTATGGCGGGGAGGACTGG

TGGCAGCTGCAAGCTCTCTGTA

BMP2

TCAAGCCAAACACAAACAGC

CCACGATCCAGTCATTCCA

BMP4

GACTTCGAGGCGACACTTCT

AGCCGGTAAAGATCCCTCAT

Animal model of in vivo calvarial defects Twenty healthy SD rats (male, 12-week-old, 320 g in average) from Sichuan University Animal Center were used in this study. They were allowed to acclimatized for seven days prior to surgery. Critical-sized calvarial defects were established as previously described.50 After anesthesia with chloral hydrate through intraperitoneal injection at 0.3–0.35 mL/100 g, a sagittal incision of 1.5–2 cm was performed. The calvarium was revealed and two full-thickness defects of 5 mm were created symmetrically on both sides of the middle ridge using a trephine at 1500 rpm. Surgeries were performed with animals lying on a heating pad set at 37 °C during operation. Rats were randomly allocated to four groups (P34HB and P34HB/GO group, 4 weeks and 8 weeks).

In vivo scaffold transplantation Cell-free scaffold membranes were shaped into tablets of 5 mm diameter by hole punching and disinfected as indicated above. Overlapped scaffold layers (P34HB and P34HB with 1 mg/mL GO) were immediately transplanted into the resulting right defects, with all left defects remaining untreated. Finally, the periosteum, muscles, and skin were sutured separately for closure. Rats possessed free access to food and water after surgery. Penicillin intramuscular injection (10000 U/day) was performed immediately after surgery and lasted for 3 days.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 32

Radiological analysis Animals were euthanized with an overdose of anesthetic at predetermined timepoints, and their calvarium bone were harvested for evaluation (10 samples for each timepoint and 5 samples for each group at specific time point). Soft tissues were all carefully dissected and samples were fixed in 4% paraformaldehyde for 2 days. µCT scan (SCANCO Medical AG, Switzerland) was performed on samples at a spatial resolution of 15 µm (500 projections/180°,1 mm aluminum filter, 100 kV, 100 mA). Image layers were adopted to reconstruct three-dimensional geometries of samples with VGS Studio Max software. Frontal and lateral cutting views were also reconstructed for distinct description of the regenerated calvarium bone. The 3D reconstructed images were exhibited with a red-green color mode, in which tissue density (Hounsfield unit, Hu) could be distinctly marked by red to green, with density from high to low. Cylinders, with 5 mm in diameter and about 1 mm in height were selected to cover defect areas as the volume of interest (VOI). Bone mineral density (BMD) and bone volume/tissue volume (BV/TV) were calculated for quantitative analysis of bone formation within the VOIs.

Histological evaluation Immediately after µCT scanning, all specimens were prepared for histological evaluation:

Specimens

were

decalcified

for

15

days

with

15%

ethylenediaminetetraacetate (EDTA)-buffered saline solution, dehydrated with gradient ethanol solutions, embedded in paraffin blocks, sectioned perpendicularly to their longitudinal axis into 5-µm-thick slices. Masson trichrome and hematoxylin and eosin (H&E) were used to stain these slices. Analysis was conducted with the built-in software (Aperio, Image Scope, Vista, CA, USA) under 2× and 15× magnification after specimens were scanned with a tissue scanner equipment (Aperio, ScanScope XT, USA).

Statistics Independent Student’s t test (double-tailed) was conducted to determine the differences between groups, with all values presented as means ± standard deviations. P (< 0.05) was set as the statistical significance level.


Page 11 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3. RESULTS Morphological characterization of P34HB/GO scaffolds Novel 3D nanofibrous P34HB/GO scaffolds were successfully fabricated by electrospinning and applied for in vivo bone repair for the first time (Figure 1a). GO manifested as layers with thickness of 1–2 nm (Figure 1b). Electrospun solutions and their resulting scaffold products turned darker as GO increased (Figure 1d-e).

Figure 1. Fabrication of P34HB/GO scaffolds. (a) Schematic illustration of P34HB/GO scaffold project. (b) AFM characterization of GO. (c) Materials of P34HB and GO. (d) Electrospun solutions with 0, 0.5, 1, 2 mg/mL GO. (e) Electrospun scaffolds with 0, 0.5, 1, 2 mg/mL GO.

All fibers were smoothly elongated without fracture or collapse, and randomly oriented with polygonal and interconnected pores (Figure 2). Diameters remarkably thinned down from 1.3–1.5 µm in the P34HB scaffold to 420–500 nm in the scaffold



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

modified with 2 mg/mL GO (Figure 2e-h). Diameters of the scaffolds with 0 mg/mL, 0.5 mg/mL, 1 mg/mL, and 2 mg/mL GO were 1558.5, 867.6, 678.7, and 491.9 nm, respectively (Figure 2i-l). Black blocks were randomly scattered inside the fibers, indicating the incorporation of GO segments (Figure 2m-p). Component analysis with XRD (Figure 2q) indicated that GO presented a typical diffraction peak at 10° and patterns of P34HB/GO highly resembled those of P34HB. A new peak stood out at 10°, which could not be detected in the P34HB scaffold, suggesting the successful incorporation of GO blocks.

Figure 2. Scaffolds characterization. (a-d) SEM characterization of scaffolds (scale bars: 100 µm). (e-h) SEM characterization of scaffolds. The increased GO reduced fiber diameter (scale bars: 5 µm). (i-l) TEM characterization of scaffolds (scale bars: 0.5 µm). (m-p) Magnified TEM characterization (scale bars: 0.5 µm). (q) XRD component analysis. The new diffraction peak at 10° in P34HB/GO verified typical existence of GO.

Properties of P34HB/GO scaffolds Bare P34HB scaffold behaved hydrophobically with a contact angle of about 92.02 ± 1.64° (Figure 3a). The angles decreased from 42.9 ± 1.84°(p < 0.0001) to 38.16 ± 1.04°(p < 0.0001) as GO increased from 0.5 to 1 mg/mL (Figure 3b-d). Besides, the scaffold modified with 2 mg/mL GO was too absorptive to capture an image. The bare


Page 12 of 32

Page 13 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


P34HB scaffold held a porosity of 73.83 ± 2.17%, while scaffolds with 0.5, 1, and 2 mg/mL GO presented a porosity of 79.4 ± 3.4 (p = 0.0327), 86.03 ± 1.88 (p = 0.0001) and 88.85 ± 2.48%, respectively (p < 0.0001) (Figure 3e). Strain-stress curves are depicted in Figure 3f and tensile parameters in Figure 3g. The bare P34HB scaffold held a Young’s modulus of 32.58 ± 2.41 MPa and a tensile strength of 1.08 ± 0.21 Mpa. For scaffolds modified with 0.5, 1, and 2 mg/mL GO, Young’s modulus was 46.11 ± 3.30 (p = 0.0006), 74.86 ± 2.61 (p < 0.0001), and 85.11 ± 2.86 MPa (p < 0.0001), respectively. Tensile strength was 1.40 ± 0.08 (p = 0.0291), 1.27 ± 0.09 (p > 0.05), and 2.02 ± 0.24 (p = 0.0011), respectively.

Figure 3. Scaffolds properties. (a-c) Water contact angle of scaffolds with 0, 0.5, 1 mg/mL GO. (d) Hydrophilicity analysis. Hydrophilicity improved with the increase of GO. (e) Porosity analysis. (f) Strain-stress curves of scaffolds. (g) Tensile strength and Young’s modulus of scaffolds. Scaffold were remarkably strengthened with increased



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

GO. * p < 0.05.

In vitro cellular assays In vitro cellular response to our scaffolds is presented in Figure 4. Compared with the bare P34HB scaffold in Figure 4a-d, much more BMSCs attached to the scaffold modified with 1 mg/mL GO, with larger and more spreading morphology (Figure 4e-h). Figure 4i shows that BMSCs on all P34HB-related scaffolds showed better cell viability compared to the blank group (p < 0.0001). GO promoted cell viability. Compared to P34HB, cell viability increased up to 22.5% when cells were grown on the scaffold modified with 1 mg/mL GO (optimal concentration) (p < 0.0001). P34HB-related scaffolds stimulated rapid BMSC proliferation and the scaffold modified with 1 mg/mL GO outshone P34HB with an increase of 21.1% at 7 days after seeding (p < 0.0001).

Figure 4. Cellular behaviors on scaffolds. (a-d) Cell adhesion on P34HB scaffold at 1, 3, 5, 7 days. (e-h) Cell adhesion on P34HB/GO scaffold at 1, 3, 5, 7 days. More


Page 14 of 32

Page 15 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


BMSCs attached to P34HB/GO scaffold with spreading morphology (scale bars: 100 µm). (i) Cytotoxicity of scaffolds. 1 mg/mL GO held optimal cell viability. (j) Cell proliferation on scaffolds. BMSCs proliferated much faster on P34HB/GO scaffold (scale bars: 100 µm, * p < 0.05).

BMSCs osteogenic differentiation was documented via the expression of 6 osteogenesis-related genes by real-time PCR at 3 days after seeding (Figure 5). Gene expression was upregulated in P34HB and P34HB/GO groups. However, P34HB/GO group held significantly higher upregulation than P34HB group (in the order of P34HB and P34HB/GO. Alp: 1.28 ± 0.13 folds, p = 0.02; 4.34 ± 0.22 folds, p < 0.0001; Ocn: 1.29 ± 0.27 folds, p > 0.05; 3.51 ± 0.52 folds, p = 0.0011; Opn: 1.96 ± 0.09 folds, p < 0.0001; 6.35 ± 0.59 folds, p < 0.0001; Runx2: 2.44 ± 0.72 folds, p > 0.05; 8.37 ± 0.97 folds, p = 0.0002; Bmp2: 1.35 ± 0.32 folds, p > 0.05; 7.90 ± 1.75 folds, p = 0.0009; Bmp4: 1.34 ± 0.19 folds, p = 0.0334; 6.05 ± 0.67 folds, p = 0.0002).

Figure 5. Osteogenic differentiation of BMSCs on scaffolds at 3 days. (a) ALP expression. (b) OCN expression. (c) OPN expression. (d) RUNX2 expression. (e) BMP2 expression. (f) BMP4 expression. P34HB/GO scaffold highly promoted in vitro osteogenic differentiation of BMSCs. * p < 0.05.

In vivo bone repair of calvarial defects



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Animal models of in vivo critical-sized calvarial defects were successfully created in rats. Scaffold layers (P34HB and P34HB with 1 mg/mL GO) were implemented for evaluation of in vivo bone repair. No visible inflammation and infection was observed on the harvested specimens. Bone regeneration within defects were three-dimensionally reconstructed and quantitatively analyzed by using micro-CT. Blank groups (left defects in all individual images) were poorly healed at 4 and 8 weeks, presenting a large green area (low mineralized fibrous tissue). P34HB/GO scaffolds performed superiorly showing a smaller green area (Figure 6a-b, e-f). The defect was almost fully repaired as shown in red (mineralized bone) in the P34HB/GO group at 8 weeks (Figure 6f). Additionally, bone formation progressed in a centripetal manner with new bone stretching from the margins toward the center. Sagittal reconstructions further validated these results (Figure 6c-d, g-h). For the blank group, bone volume/tissue volume (BV/TV) ratios were 11.17 ± 3.13 and 22.61 ± 3.93% at 4 and 8 weeks, respectively (Figure 6i). Meanwhile, at 4 weeks, it was 24.72 ± 2.91% in the P34HB group and 34.17 ± 2.09% in the P34HB/GO group (P = 0.004); by 8 weeks, 47.2 ± 1.19% and 60.77 ± 4.39% of the defects were repaired, respectively (P = 0.001). Bone mineral density (BMD) was 314.4 ± 49 and 311.7 ± 41.9 mg HA/ccm (P = 0.94) at 4 and 8 weeks, respectively (Figure 6j). Enhancement could be observed in the scaffold groups, with BMD of P34HB increasing to 496.2 ± 63.3 and that of P34HB/GO to 487.4 ± 41.9 mg HA/ccm at 4 weeks (P = 0.83). By 8 weeks, the bone quality in the scaffold groups was remarkably improved with BMD increasing to 793.7 ± 11.6 and 824.1 ± 11.3 mg HA/ccm in the P34HB and P34HB/GO groups, respectively (P = 0.0095). Our quantitative results are consistent with previous micro-CT reconstruction data.


Page 16 of 32

Page 17 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Radiographical analysis of bone formation. (a) Frontal P34HB defect at 4 weeks. (b) Frontal P34HB/GO defect at 4 weeks. (c) Sagittal P34HB defect at 4 weeks. (d) Sagittal P34HB/GO defect at 4 weeks. (e) Frontal P34HB defect at 8 weeks. (f) Frontal P34HB/GO defect at 8 weeks. (g) Sagittal P34HB defect at 8 weeks. (h) Sagittal P34HB/GO defect at 8 weeks. Blank defects (left ones in individual images) remained large valid (green area) and defect of P34HB/GO at 8 weeks was almost fully covered by red (scale bars: 5 mm). (i) BV/TV analysis. (j) BMD analysis. Defect of P34HB/GO were remarkably repaired at 4 weeks, being further repaired and high-mineralized at 8 weeks. * p < 0.05.

Bone formation was further analyzed histologically with H&E and Masson Trichrome staining. No obvious sign of inflammation or severe immunological response was observed in all groups. Bone healing progressed in a centripetal way as determined above. Demarcations (blue and black dashed lines) between the host (hb) and regenerated bone (rb) could be distinguished by continuity interruption and morphology alteration of the bone tissue. The blank group remained poorly repaired, filled with mere connective tissue (ct) even at 8 weeks (Figure 7a-b & g-h). Additionally, the P34HB scaffold was partially degraded at 4 weeks (Figure 7c-d) with layered cellular structure (green arrows). At 4 weeks, an immature bony bridge, with obvious gaps, formed in the P34HB/GO group (Figure 7e-f). Whereas, it was almost fully linked at 8 weeks with poorly discernable margins between the new and



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

native tissues (Figure 7k-l). Fibrous tissue was replaced by thicker new bone, stretching from the bottom and margins. Furthermore, blood vessels (black arrows) and trabeculae surrounded by osteoblasts were present. Organized bone structures and bone marrow space (blue arrow, Figure 7j) emerged inside the woven bone, together with new formed cortical-bone-like lamellar bone (Figure 7l).

Figure 7. H&E staining. (a-b) Blank defect at 4 weeks. Fibrous tissue filled. (c-d) P34HB defect at 4 weeks. Scaffold remained. (e-f) P34HB/GO defect at 4 weeks. Much new bone formed with immature structures. (g-h) Blank defect at 8 weeks. Thicker connective tissue filled. (i-j) P34HB defect at 8 weeks. Bony bridge formed with gap. (k-l) P34HB/GO defect at 8 weeks. Bony bridge was almost fully linked


Page 18 of 32

Page 19 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with mature bone structures. ct: connective tissue; hb: host bone; rb: regenerated bone; green arrows: layered scaffold structures; blue arrow: bone marrow space; black arrow: blood vessels; blue dashed line: demarcation between host and regenerated bone.

Masson staining confirmed the above results with better exhibition of tissue microstructures and matrix components. Large defects remained unrepaired at 8 weeks in the blank group with blue-stained connective tissue filled in chaos (Figure 8a-b & g-h). At 8 weeks, the P34HB group achieved partial healing (Figure 8i-j). Superior outcome was confirmed in the P34HB/GO group at 8 weeks (Figure 8k-l) with the defect almost fully replaced by woven bone (blue-stained) and cortical-like lamella bone (red stained). More mature arrangement of collagen could also be observed (Figure 8l).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 8. Masson staining. (a-b) Blank defect at 4 weeks. Fibrous tissue filled inside (red stained). (c-d) P34HB defect at 4 weeks. Scaffold remained (light blue stained). (e-f) P34HB/GO defect at 4 weeks. Much new bone formed with immature structures (red stained). (g-h) Blank defect at 8 weeks. Increased connective tissue filled. (i-j) P34HB defect at 8 weeks. Bony bridge formed with valid. (k-l) P34HB/GO defect at 8 weeks. Bony bridge was almost fully linked with clear, mature bone structures (red and blue stained). ct: connective tissue; hb: host bone; rb: regenerated bone; black dashed line: demarcation between host and regenerated bone.


Page 20 of 32

Page 21 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4. DISCUSSION Under appropriate conditions, the incorporation of GO barely affects the scaffold morphology such as fiber collapse or breakage. Parameters like solution surface tension, viscosity, and electroconductivity exert a tremendous influence on fiber morphology.13,

51

Thinner fibers can be ascribed to alteration of viscosity and

electroconductivity caused by GO.52-53 Solution conductivity was greatly elevated by GO and, consequently, led to adequate fiber elongation. Additionally, decreased solution viscosity also facilitated this process. Besides, more GO may result in a rougher scaffold surface due to unstable electrospinning. The negative correlation between the fiber diameter and GO amount was consistent with previous reports.13, 52-53

Dispersion of GO flakes in electrospun fibers also resembled findings by Bao

using graphene,54 suggesting that electrospinning was an effective strategy to incorporate GO with a high aspect ratio. Subsequent XRD analysis further validate that the previous black blocks in fibers were GO fragments incorporated. The introduction of hydroxyl and carboxyl groups from GO may explain the improvement in hydrophilicity of the scaffolds, reflected by a remarkable decrease of water contact angle.45 The improvement of porosity, caused by thinned fibers, and the roughened fibrous structure may also play a role as previously demonstrated.55-56 Specific physical properties of scaffolds for BTE are highly required at loading-bearing sites.9-10 Compared with bare P34HB, scaffold modified with 2 mg/mL GO were improved by 87% and 161% in tensile strength and Young’s modulus, respectively. GO is one of the strongest nanomaterials owing to its sp2 bonded hexagonal structure.30 Moreover, it was reported to enhance mechanical properties on electrospun polymeric scaffolds.57-58 A 60.6% improvement of the Young’s modulus was obtained on GO modified Poly (vinyl alcohol) (PVA) electrospun scaffolds.59 It’s interesting to observe a decrease of elongation rate with the increase in GO. The incorporation of GO may be unfavorable for the flexibility of composite. GO can either improve cell viability or induce cellular death depending on cell types and dosage.60 The cytotoxicity may be ascribed to its physical damage to cell



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

membrane. It’s reported that FBS of 10% could remarkably mitigate GO’ s cytotoxicity, which is the concentration we used in our medium.61 Besides, the addition of GO increased the porosity and hydrophilicity of the scaffolds, which may also explain the increase in BMSCs’ viability. Besides, better pore interconnectivity also facilitated the transport of nutrients and removal of metabolic waste, making the scaffold a more favorable microenvironment for BMSCs to attach, grow in, and proliferate.6 We previously explored the in vitro ASCs osteogenic differentiation on P34HB.28 For osteogenesis, BMSCs are considered superior to ASCs.62 Moreover, it was previously reported that GO promotes in vitro osteogenesis.43-44 Thus, the upregulation of osteogenesis-related genes observed in this study could be ascribed to polymeric materials, enhanced porous microstructure, and hydrophilicity of the scaffolds. Additionally, the expression of osteopontin (Opn) and Runx 2 was upregulated over six and 8 folds, respectively (Figure 5c-d), in the P34HB/GO scaffold, indicating a much more vigorous process of osteoblasts maturation and biomineralization.63 By 8 weeks, 47.2% and 60.77% new bone formed in the P34HB and P34HB/GO group, respectively. These results were comparable and even better than some existing literature.64-65 New bone generation was significantly higher (19.11% more) in the P34HB/GO group than in the P34HB, indicating superior osteogenic capability. Importantly, 34.17% new bone in the P34HB/GO group at 4 weeks and no difference in term of BMD compared to that in the P34HB group suggested that GO promotes osteogenesis through rapid augmentation of bone volume even at an early stage. Histological staining revealed faster bone formation in the P34HB/GO group at 4 weeks consistent with previous micro-CT results. Furthermore, newly formed bone with more mature, organized structures was confirmed in the P34HB/GO group at 8 weeks, also verifying its superior osteogenic capability.

5. CONCLUSIONS In this study, a novel P34HB/GO nanofibrous scaffold was successfully fabricated by electrospinning and applied for in vivo bone repair for the first time. GO exerted


Page 22 of 32

Page 23 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


tremendous influences on the fiber diameter and considerably enhanced the scaffold properties. The scaffolds were biodegradable, with improved cellular performance. While both P34HB and P34HB/GO scaffolds were capable of in vivo bone repair, P34HB/GO presented the optimal capability. GO promoted osteogenesis and rapidly increased bone volume even at an early stage. However, we must point out that long-term follow-up study still need to be performed to further evaluate the biomechanical properties of new-formed bone. In summary, this study demonstrates that GO improves the properties of P34HB scaffold in relation to its addition amount, confirms the osteogenic capability of P34HB scaffold, and reveals the high, fast capability of P34HB/GO scaffold for in vivo bone regeneration. Considering its facile, economical fabrication process, favorable porous structures, enhanced biomechanical properties, and superior osteogenic capability, the electrospun P34HB/GO scaffold may shed light on biomaterial fabrication and provide some potential therapeutic options in bone tissue engineering, including the cell-homing based one.

ASSOCIATED CONTENT AUTHOR INFORMATION Corresponding Author *Email: [email protected] Author Contributions § Authors contributed equally to this study All authors collaborated on this manuscript and achieved the consent of its final version. Notes All authors declare no competing financial interests.

ACKNOWLEDGEMENT This study was sponsored by National Natural Science Foundation of China (81671031 and 81470721) and Sichuan Province Youth Science and Technology



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Innovation Team (2014TD0001).

ABBREVIATIONS DO, distraction osteogenesis BTE, bone tissue engineering PHA, polyhydroxyalkanoate PHB, poly-hydroxybutyrate PHBV, poly(3-hydroxybutyrate-co-3-hydroxybutyrate) P34HB, poly(3-hydroxybutyrate-co-4-hydroxybutyrate) ASCs, adipose-derived stem cells BMSCs, bone marrow mesenchymal stem cells GO, graphene oxide GNS, graphene XRD, X-ray powder diffraction CCK8, cell counting kit 8 SD rats, Sprague-Dawley rats GAPDH, glyceraldehyde-3-phosphate dehydrogenase ALP, alkaline phosphatase OCN, osteocalcin OPN, osteopontin RUNX 2, runt-related transcription factor 2 BMP 2/4, bone morphogenetic protein 2/4 µCT, micro computed tomography BMD, bone mineral density BV/TV, bone volume/tissue volume

REFERENCES (1)

Gong, T.; Xie, J.; Liao, J.; Zhang, T.; Lin, S.; Lin, Y. Nanomaterials and Bone Regeneration. Bone Res. 2015, 3, 123-129.

(2)

Ardeshirylajimi, A.; Farhadian, S.; Jamshidi Adegani, F., Mirzaei, S.; Zomorrod,


Page 24 of 32

Page 25 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


M. S.; Langroudi, L. L.; Doostmohammadi, A.; Seyedjafari, E.; Soleimani, M. Enhanced Osteoconductivity of Polyethersulphone Nanofibres Loaded with Bioactive Glass Nanoparticles in in Vitro and in Vivo Models. Cell Prolif. 2015, 48, 455-464. (3)

Liao, J.; Cai, X.; Tian, T; Shi, S.; Xie, X.; Ma, Q.; Li, G.; Lin, Y. The Fabrication of Biomimetic Biphasic CAN-PAC Hydrogel with a Seamless Interfacial Layer Applied in Osteochondral Defect Repair. Bone res. 2017, 5, 17018.

(4)

Velasco, M. A.; Narváez-Tovar, C. A.; Garzón-Alvarado, D. Design, Materials, and Mechanobiology of Biodegradable Scaffolds for Bone Tissue Engineering. BioMed Res. Internat. 2015, 2015, 729076.

(5)

Zhong, J.; Guo, B.; Xie, J.; Deng, S.; Fu, N.; Lin, S.; Li, G.; Lin, Y.; Cai, X. Crosstalk between adipose-derived stem cells and chondrocytes: when growth factors matter. Bone Res. 2016, 4, 15036.

(6)

Zhao, D.; Lei, L.; Wang, S.; Nie, H. Understanding Cell Homing-based Tissue Regeneration from the Perspective of Materials. J. Mater. Chem. B 2015, 3, 7319-7333.

(7)

Sicchieri, L. G.; Crippa, G. E.; de Oliveira, P. T.; Beloti, M. M.; Rosa, A. L. Pore Size Regulates Cell and Tissue Interactions with PLGA–Cap Scaffolds Used for Bone Engineering. J. Tissue Eng. Regen. Med. 2012, 6, 155-162.

(8)

Jones, A. C.; Arns, C. H.; Hutmacher, D. W.; Milthorpe, B. K.; Sheppard, A. P.; Knackstedt, M. A. The Correlation of Pore Morphology, Interconnectivity and Physical Properties of 3D Ceramic Scaffolds with Bone Ingrowth. Biomaterials 2009, 30, 1440-1451.

(9)

Boccaccini, A. R.; Gerhardt, L. C. Carbon Nanotube Composite Scaffolds and Coatings for Tissue Engineering Applications. Key Eng. Mater. 2010, 441, 31-52.

(10)

Ramakrishna, S.; Mayer, J.; Wintermantel, E.; Leong, K. W. Biomedical Applications of Polymer-Composite Materials: A Review. Compos. Sci. Technol. 2001, 61, 1189-1224.

(11)

Tang, A.; Li, J.; Zhao, S.; Liu, T.; Wang, Q.; Wang, J. Biodegradable Tissue Engineering Scaffolds Based on Nanocellulose/PLGA Nanocomposite for NIH



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3T3 Cell Cultivation. J. Nanosci. Nanotechnol. 2017, 17, 3888–3895. (12)

Chu, W. S.; Pandey, J. K.; Ahn, S. H. Fabrication of Bio-Composite Scaffold for Implantable Drug Delivery System (DDS). J. Biobased Mater. bio. 2014, 8, 230-239.

(13)

Vegalugo, A. C.; Lim, L. T. Electrospinning of Soy Protein Isolate Nanofibers. J. Biobased Mater. bio. 2008, 2, 223-230.

(14)

Cai, X.; Xie, J.; Yao, Y.; Cun, X.; Lin, S.; Tian, T.; Zhu, B.; Lin, Y. The role of WNT Signaling in engineering functional vascular networks for tissue regeneration. Bone Res. 2017, 5:17048.

(15)

Zhang, T.; Xie, J.; Sun, K.; Fu, N.; Deng, S.; Lin, S.; Shi, S.; Zhong, J.; Lin, Y. Physiological Oxygen Tension Modulates the Soluble Growth Factor Profile after Crosstalk between Chondrocytes and Osteoblasts. Cell Prolif. 2016, 49:122-133.

(16)

Ji, X.; Wang, T.; Guo, L.; Xiao, J.; Li, Z.; Zhang, L.; Deng, Y.; He, N. Effection of Nano-ZnO on the Mechanical Property and Biocompatibility of Electrospun Poly(L-lactide) Acid/Nano-ZnO Mats. J. Biomed. Nanotechnol. 2013, 9, 417-423.

(17)

Shi, S.; Peng, Q.; Shao, X.; Xie, J.; Lin, S.; Zhang, T.; Li, Q.; Li, X.; Lin, Y. Self-Assembled Tetrahedral DNA Nanostructures Promote Adipose-Derived Stem Cell Migration via lncRNA XLOC 010623 and RHOA/ROCK2 Signal Pathway. ACS Appl. Mater. Interfaces. 2016; 8, 19353-19363.

(18)

Ji, X.; Yang, W.; Wang, T.; Mao, C.; Guo, L.; Xiao, J.; He, N. Coaxially Electrospun Core/Shell Structured Poly(L-lactide) Acid/Chitosan Nanofibers for Potential Drug Carrier in Tissue Engineering. J. Biomed. Nanotechnol. 2013, 9, 1672-1678.

(19)

Li, J.; Hu, Y.; Liu, W.; Weng X.; Dong, X.; Zhang, X.; Zhou, W. High Flux and Hydrophilic Fibrous Ultrafiltration Membranes Based on Electrospun Titanium Dioxide Nanoparticles/Polyethylene Oxide/Poly(vinylidene fluoride) Composite Scaffolds. J. Nanosci. Nanotechnol. 2017, 17, 9042–9049.

(20)

Yang, W.; He, N.; Li, Z. Rapamycin Release Study of Porous Poly(L-lactic acid) Scaffolds, Prepared via Coaxial Electrospinning. J. Nanosci. Nanotechnol. 2016, 16, 9404-9412.


Page 26 of 32

Page 27 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(21)

Luo, L.; Wei, X.; Chen G. Q. Physical Properties and Biocompatibility of Poly (3-Hydroxybutyrate-Co-3-Hydroxyhexanoate)

Blended

with

Poly

(3-Hydroxybutyrate-Co-4-Hydroxybutyrate). J. Biomater. Sci. Polym. Ed. 2009, 20, 1537-1553. (22)

Wang, X. H.; Sang, L.; Wei, Z. Y.; Zhai, J. L.; Qi, M. Fabrication and Characterization of P34HB Scaffolds with Oriented Microtubules. Adv. Mater. Res. 2014, 898, 318-321.

(23)

Xu, X. Y.; Li, X. T.; Peng, S. W.; Xiao, J .F.; Liu, C.; Fang, G.; Chen, K. C.; Chen, G. Q. The Behaviour of Neural Stem Cells on Polyhydroxyalkanoate Nanofiber Scaffolds. Biomaterials 2010, 31, 3967-3975.

(24)

Fu, N.; Xie, J.; Li, G.; Shao, X.; Shi, S.; Lin, S.; Deng, S.; Sun, K.; Lin, Y. P34HB Film Promotes Cell Adhesion, in Vitro Proliferation, and in Vivo Cartilage Repair. RSC Adv. 2015, 5, 21572-21579.

(25)

Li, G.; Fu, N.; Xie, J.; Fu, Y.; Deng, S.; Cun, X.; Wei, X.; Peng, Q.; Cai, X.; Lin, Y. Poly (3-Hydroxybutyrate-Co-4-Hydroxybutyrate) Based Electrospun 3D Scaffolds for Delivery of Autogeneic Chondrocytes and Adipose-derived Stem Cells: Evaluation of Cartilage Defects in Rabbit. J. Biomed. Nanotechnol. 2015, 11, 105-116.

(26)

Opitz, F.; Schenke-Layland, K.; Cohnert, T. U.; Starcher, B.; Halbhuber, K. J.; Martin, D. P.; Stock, U. A. Tissue Engineering of Aortic Tissue: Dire Consequence of Suboptimal Elastic Fiber Synthesis in Vivo. Cardiovasc. Res. 2004, 63, 719-730.

(27)

Sodian, R.; Hoerstrup, S. P.; Sperling, J. S.; Daebritz, S. H.; Martin, D. P.; Schoen, F. J.; Vacanti, J. P.; Mayer, J .E. Tissue Engineering of Heart Valves: In Vitro Experiences. Ann. Thorac. Surg. 2000, 70, 140-144.

(28)

Fu, N.; Deng, S.; Fu, Y.; Li, G.; Cun, X.; Hao, L.; Wei, X.; Cai, X.; Peng, Q.; Lin, Y. Electrospun P34HB Fibres: A Scaffold for Tissue Engineering. Cell Prolif. 2014, 47, 465-475.

(29)

Sreejith, S.; Ma, X.; Zhao, Y. Graphene Oxide Wrapping on Squaraine-loaded Mesoporous Silica Nanoparticles for Bioimaging. J. Am. Chem. Soc. 2012, 134,



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 32

17346-17349. (30)

Kim, H.; Namgung, R.; Singha, K.; Oh, I. K. Graphene Oxide-Polyethylenimine Nanoconstruct as a Gene Delivery Vector and Bioimaging Tool. Bioconjugate Chem. 2015, 22, 2558-2567.

(31)

Lee, J.; Kim, J.; Kim, S.; Min, D. H. Biosensors Based on Graphene Oxide and its Biomedical Application. Adv. Drug Deliver. Rev. 2016, 105, 275-287.

(32)

Wei, Y.; Zhou, F.; Zhang, D.; Chen, Q.; Xing, D. A Graphene Oxide Based Smart Drug Delivery System for Tumor Mitochondria-targeting Photodynamic Therapy. Nanoscale 2016, 8, 3530-3538.

(33)

Shuai C.; Feng, P.; Gao, C.; Shuai, X.; Xiao, T.; Peng, S. Graphene Oxide Reinforced

Poly(Vinyl

Alcohol):

Nanocomposite

Scaffolds

for

Tissue

Engineering Applications. RSC Adv. 2015, 5, 25416-25423. (34)

Xu, H.; Li, Q.; Wang, L.; He, Y.; Shi, J.; Tang, B.; Fan, C. Nanoscale Optical Probes for Cellular Imaging. Chem. Soc. Rev. 2014, 43, 2650-2661.

(35)

Li, F.; Pei, H.; Wang, L.; Lu, J.; Gao, J.; Jiang, B.; Zhao, X.; Fan, C. Nanomaterial℃based Fluorescent DNA Analysis: A Comparative Study of the Quenching Effects of Graphene Oxide, Carbon Nanotubes, and Gold Nanoparticles. Adv. Funct. Mater. 2013, 23, 4140-4148.

(36)

Zhao, J.; Deng, B.; Lv, M.; Li, J.; Zhang, Y.; Jiang, H.; Peng, C.; Li, J.; Shi, J.; Huang, Q.; Fan, C. Graphene Oxide℃based Antibacterial Cotton Fabrics. Adv. Healthc Mater. 2013, 2, 1259-1266.

(37)

Hu, W.; Peng, C.; Luo, W.; Lv, M.; Li, D.; Huang, Q.; Fan, C. Graphene-based Antibacterial Paper. ACS Nano 2010, 4, 4317-4323.

(38)

Xia, S.; Yao, L.; Zhao, Y.; Li, Z.; Zheng, Y. Preparation of Graphene Oxide Modified Polyamide Thin Film Composite Membranes with Improved Hydrophilicity for Natural Organic Matter Removal. Chem. Eng. J. 2015, 280, 720-727.

(39)

Cano, M.; Khan, U.; Sainsbury, T.; Neill, O. A.; Wang, Z.; Mcgovern, I. T.; Maser W. K.; Benito, A. M.; Coleman, J. N. Improving the Mechanical Properties of Graphene Oxide Based Materials by Covalent Attachment of Polymer Chains.


Page 29 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Carbon. 2013, 52, 363-371. (40)

Usman, A.; Hussain, Z.; Riaz, A.; Khan, A. N. Enhanced Mechanical, Thermal and

Antimicrobial

Properties

of

Poly(Vinyl

Alcohol)/Graphene

Oxide/Starch/Silver Nanocomposites Films. Carbohyd. Polym. 2016, 153, 592-599. (41)

Jing, X.; Qiu, Z. Crystallization Kinetics and Thermal Property of Biodegradable Poly(3-hydroxybutyrate)/Graphene

Oxide

Nanocomposites.

J.

Nanosci.

Nanotechnol. 2012, 12, 7314-7321. (42)

Sridhar, V.; Park, H.; Lee, I.; Chun, H. Graphene Reinforced Biodegradable Poly(3-Hydroxybutyrate-Co-4-Hydroxybutyrate)

Nano-composites.

Express

Polym. Lett. 2013, 7, 320-328. (43)

Zhang, W.; Sun, H.; Mou, Y.; Jiang, X.; Wei, L.; Wang, Q.; Wang, C.; Zhou, J.; Cao, J. Graphene Oxide-Collagen Matrix Accelerated Osteogenic Differentiation of Mesenchymal Stem Cells. J. Biomater. Tiss. Eng. 2015, 5, 1-10.

(44)

La, W. G.; Park, S.; Yoon, H. H.; Jeong, T. J.; Bhang, S. H.; Han, J. Y.; Char, K.; Kim, B. S. Delivery of a Therapeutic Protein for Bone Regeneration from a Substrate Coated with Graphene Oxide. Small 2013, 9, 4051-4060.

(45)

Fu, N.; Liao, J.; Lin, S.; Sun, K.; Tian, T.; Zhu, B.; Lin, Y. PCL-PEG-PCL film promotes cartilage regeneration in vivo. Cell Prolif. 2016, 49:729-739.

(46)

Zhang, Q.; Lin, S.; Zhang, T.; Tian, T.; Ma, Q.; Xie, X.; Xue, C.; Lin, Y.; Zhu, B; Cai, X. Curved Microstructures Promote Osteogenesis of Mesenchymal Stem Cells via the Rhoa/ROCK Pathway. Cell Prolif. 2017, 50, e12356.

(47)

Zhang, W.; Zhu, C.; Wu, Y.; Ye, D.; Wang, S.; Zou, D.; Zhang, X.; Kaplan, D. L.; Jiang, X. VEGF and BMP-2 Promote Bone Regeneration by Facilitating Bone Marrow Stem Cell Homing and Differentiation. Eur. Cell Mater. 2014, 27, 1-11.

(48)

Shao, X.; Lin, S.; Peng, Q.; Shi, S.; Wei, X.; Zhang, T.; Lin, Y. Tetrahedral DNA Nanostructure: A Potential Promoter for Cartilage Tissue Regeneration via Regulating Chondrocyte Phenotype and Proliferation. Small 2017, 13, doi:10.1002/smll.201770070.

(49)

Shi, S.; Xie, J.; Zhong, J.; Lin, S.; Zhang, T.; Sun, K.; Fu, N.; Shao, X.; Lin, Y.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Effects of Low Oxygen Tension on Gene Profile of Soluble Growth Factors in Co℃cultured Adipose℃derived Stromal Cells and Chondrocytes. Cell Prolif. 2016, 49, 341-351. (50)

Spicer, P. P.; Kretlow, J. D.; Young, S.; Jansen, J. A.; Kasper, F. K.; Mikos, A. G. Evaluation of Bone Regeneration Using the Rat Critical Size Calvarial Defect. Nat. Protoc. 2012, 7, 1918-1929.

(51)

Pan, C.; Fang, Y.; Wu, H.; Ahmad, M.; Luo, Z.; Li, Q.; Xie, J.; Yan, X.; Wu, L.; Wang, Z. L. Generating Electricity from Biofluid with a Nanowire℃based Biofuel Cell for Self℃powered Nanodevices. Adv. Mater. 2010, 22, 5388-5392.

(52)

Barzegar, F.; Bello, A.; Fabiane, M.; Khamlich, S.; Momodu, D.; Taghizadeh, F.; Dangbegnon, J.; Manyala, N. Preparation and Characterization of Poly (Vinyl Alcohol)/Graphene Nanofibers Synthesized by Electrospinning. J. Phys. Chem. Solids. 2015, 77, 139-145.

(53)

Huang, J.; Deng, H.; Song, D.; Xu, H. Electrospun Polystyrene/Graphene Nanofiber Film as a Novel Adsorbent of Thin Film Microextraction for Extraction of Aldehydes in Human Exhaled Breath Condensates. Anal. Chim. Acta 2015, 878, 102-108.

(54)

Bao, Q.; Zhang, H.; Yang, J.; Ang, P.; Loh, K. P.; Ultrafast Photonics: Graphene– Polymer Nanofiber Membrane for Ultrafast Photonics. Adv. Funct. Mater. 2010, 20, 782-791.

(55)

Tong, H. W.; Wang, M.; Lu, W. W. Electrospinning and Evaluation of PHBV-based Tissue Engineering Scaffolds with Different Fibre Diameters, Surface Topography and Compositions. J. Biomater. Sci. Polym. Ed. 2012, 23, 779-806.

(56)

Chen, W. C.; Chen, Y. S.; Ko, C. L.; Lin, Y.; Kuo, T. H.; Kuo, H. N. Interaction of Progenitor Bone Cells with Different Surface Modifications of Titanium Implant. Mat. Sci. Eng: C-Mater. 2014, 37, 305-313.

(57)

Wang, C.; Li, Y.; Ding, G.; Xie, X.; Jiang, M. Preparation and Characterization of Graphene Oxide/Poly(Vinyl Alcohol) Composite Nanofibers via Electrospinning. J. Appl. Polym. Sci. 2013, 127, 3026-3032.


Page 30 of 32

Page 31 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(58)

Ke, H.; Pang, Z.; Xu, Y., Chen, X.; Fu, J.; Cai, Y.; Huang, F.; Wei, Q. Graphene Oxide Improved Thermal and Mechanical Properties of Electrospun Methyl Stearate/Polyacrylonitrile Form-stable Phase Change Composite Nanofibers. J. Therm. Anal. Calorim. 2014, 117, 109-122.

(59)

Ghobadi, S.; Sadighikia, S.; Papila, M.; Cebeci, F. C.; Gürsel, S. A. Graphene-reinforced Poly (Vinyl Alcohol) Electrospun Fibers as Building Blocks for High Performance Nanocomposites. RSC Adv. 2015, 5, 85009-85018.

(60)

Seabra, A. B.; Paula, A. J.; de Lima, R.; Alves, O. L.; Duran, N. Nanotoxicity of Graphene and Graphene Oxide. Chem. Res. Toxicol. 2014, 27, 159-168.

(61)

Hu, W.; Peng, C.; Lv, M.; Li, X.; Zhang, Y.; Chen, N.; Fan, C.; Huang, Q. Protein Corona-mediated Mitigation of Cytotoxicity of Graphene Oxide. ACS Nano 2011, 5, 3693-3700.

(62)

Tian, T.; Liao, J.; Zhou, T.; Lin, S.; Zhang, T.; Shi, S.; Cai, X.; Lin, Y. Fabrication of Calcium Phosphate Microflowers and Their Extended Application in Bone Regeneration. ACS Appl. Mater. Interfaces. 2017, 9, 30437–30447.

(63)

Li, Q,; Zhao, D.; Shao, X.; Lin, S.; Xie, X.; Liu, M.; Ma, W.; Shi, S.; Lin, Y. Aptamer-modified tetrahedral DNA nanostructure for tumor-targeted drug delivery. ACS Appl. Mater. Interfaces. 2017, 9, 36695-36701.

(64)

Zhao, S.; Zhang, J.; Zhu, M.; Zhang, Y.; Liu, Z.; Tao, C.; Zhu, Y.; Zhang, C. Three-Dimensional Printed Strontium-Containing Mesoporous Bioactive Glass Scaffolds for Repairing Rat Critical-Sized Calvarial Defects. Acta Biomater. 2015, 12, 270-280.

(65)

Bateman, J. P.; Safadi, F. F.; Susin, C.; Wikesjo, U. M. Exploratory Study on the Effect of Osteoactivin on Bone Formation in the Rat Critical-Size Calvarial Defect Model. J. Periodont. Res. 2012, 47, 243-247.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For Table of Contents Only


Page 32 of 32

Graphene Oxide Scaffold - American Chemical Society

Recommend Documents