Heptaplex Polymerase Chain Reaction Assay for the Simultaneous

Jul 8, 2019 - The meat and fish industry in many countries are not well regulated. ..... an automated QIAxcel Advanced Capillary Electrophoresis Syste...
2 downloads 0 Views 2MB Size
Download PDF
Article Cite This: J. Agric. Food Chem. XXXX, XXX, XXX−XXX

pubs.acs.org/JAFC

Heptaplex Polymerase Chain Reaction Assay for the Simultaneous Detection of Beef, Buffalo, Chicken, Cat, Dog, Pork, and Fish in Raw and Heat-Treated Food Products M. A. Motalib Hossain,*,† Syed Muhammad Kamal Uddin,† Sharmin Sultana,† Sharmin Quazi Bonny,† Md Firoz Khan,§,∥ Zaira Zaman Chowdhury,† Mohd Rafie Johan,† and Md. Eaqub Ali†,‡

Downloaded via BUFFALO STATE on July 18, 2019 at 03:25:10 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

Nanotechnology and Catalysis Research Centre, Institute for Advanced Studies, ‡Centre for Research in Biotechnology for Agriculture, §Department of Chemistry, Faculty of Science, and ∥Institute of Ocean and Earth Sciences, University of Malaya, 50603 Kuala Lumpur, Malaysia S Supporting Information *

ABSTRACT: Species authentication of meat and fish products is crucial to safeguard public health, economic investment, and religious sanctity. We developed a heptaplex polymerase chain reaction assay targeting short amplicon length (73−198 bp) for the simultaneous detection and differentiation of cow, buffalo, chicken, cat, dog, pig, and fish species in raw and processed food using species-specific primers targeting mitochondrial cytb, ND5, and 16s rRNA genes. Assay validation of adulterated and various heat-treated meatball matrices showed excellent stability and sensitivity under all processing conditions. The detection limit was 0.01−0.001 ng of DNA under pure states and 0.5% meat in meatball products. Buffalo was detected in 86.7% (13 out of 15) of tested commercial beef products, while chicken, pork, and fish products were found to be pure. The developed assay was efficient enough to detect target species simultaneously, even in highly degraded and processed food products at reduced time. KEYWORDS: heptaplex PCR, simultaneous detection and differentiation, short amplicon, meat and fish, food products

■

INTRODUCTION Foods obtained from farm animals, poultry, and fish contribute remarkably to the intake of vital energy and fundamental nutrients like protein, long chain polyunsaturated fatty acids (PUFA), various essential trace elements, and most B vitamins that enhance human immunity.1 Meat and fish are well-known as the richest sources of high-quality protein. Consumers nowadays are quality-conscious and pay great attention to integrity and the species origin of food products due to public health issues and biodiversity perspectives, as well as religious and cultural conventions.2 Consumers are also deeply concerned with animal origin when buying foods due to the prevalence of bovine spongiform encephalopathy (BSE) in cows,3 buffalopox in buffalos and cows,4 scrapie in sheep and goats,5 avian influenza virus in poultry,3 and swine influenza virus in pork.3 These occurrences have ultimately reduced the consumption of meat species in food.3 The meat and fish industry in many countries are not well regulated. Consequently, the adulteration or substitution of animal species in food products is likely to be practiced. The increased demand for meat and meat products, along with their escalating cost, increases their susceptibility to fraudulent adulteration, substitution, and mislabeling worldwide.2 In many countries, poultry meat is often substituted with red meat.6 The recent inclusion of rat meat in lamb products, pork in beef products, monkey and canine meat in soup items, as well as canine and feline meat for chevon2,7 has created deep concern and apprehension because of the likelihood of many of these species to carry potentially infectious zoonoses. Moreover, such substitute items are also forbidden in certain © XXXX American Chemical Society

religions, such as Islam and Judaism. For instance, pork consumption is totally prohibited in Muslim (Halal) and Jewish (Kashrut) dietary laws, whereas the Hindu forbid beef and beef products.8 The quickly growing business sector of fish items is likewise confronting diverse challenges nowadays. With escalating demand, fish and fishery products are especially vulnerable to adulteration because of their healthy quality and because they are well-accepted by all religious people and cultures. The occurrence of undeclared animal species in most instances is willful. However, in certain cases, such incident may be unintentional, often because of cross-contamination from equipment during the processing of various types of species due to the inadequate cleaning of equipment in manufacturing plants.9 Whether intentional or unintentional, mislabeling in food products consequently leads to the loss of consumer trust, thereby affecting the entire food supply industry. The detection of undesirable and objectionable species in food products is of paramount importance due to health, religious, financial, and moral issues. The correct labeling and proper declaration of ingredients in commercial food products, as well as their subsequent field supervision, are mandatory for ensuring fair trade, protecting consumer trust, and complying with legislation for sustainable food businesses. Consequently, different countries, including Malaysia, are Received: Revised: Accepted: Published: A

April 22, 2019 July 4, 2019 July 8, 2019 July 8, 2019 DOI: 10.1021/acs.jafc.9b02518 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

■

highly prioritizing both national and international regulations to safeguard consumer rights. Thus, a reliable technique for species authentication is essentially needed by regulatory authorities. A large number of approaches are available for species identification in raw meat, fish, and food products, among which protein and DNA-based analyses are the most widely used. Conventional speciation techniques, such as morphological identification, are not suitable to detect mislabeling in processed food products, given that specific morphological features are lacking in such items.10 Protein-based methods, such as high-performance liquid chromatography (HPLC), electrophoretic techniques, and enzyme-linked immunosorbent assay (ELISA) are considered effective for species identification in raw meat. However, these techniques show certain limitations of low sensitivity and detection limit when applied to heat-treated foods because of the denaturation of proteins.11 In contrast, DNA-based polymerase chain reaction (PCR) methods have been used as authentic, robust, and rapid alternatives because DNA is thermostable, highly variable in nucleotide compositions between species, and ubiquitous in all biological cells, tissues, and organs.12 Moreover, DNA is relatively more stable in harsh conditions and shows lesser cross-reactivity among related animals compared with protein.13 Recently, mitochondrial DNA (mtDNA) has been used more frequently than nuclear DNA. Given its maternal inheritance, lack of recombination events, and presence of conserved sequences, mtDNA is especially advantageous for DNA-based experiments.14 The accuracy and sensitivity of the PCR techniques even in seriously degraded samples under extreme heat treatment were retained effectively with the use of mt-genes, given their availability in numerous copies in all cells, protection with membrane, and highly conserved nature.15 Various DNA-based studies have been reported, such as species-specific PCR,16 PCR-restriction fragment length polymorphism (PCR-RFLP),17 loop-mediated isothermal amplification (LAMP),18 sequencing,19 and multiplex PCR (mPCR).15 However, in contrast with conventional singlespecies PCR, mPCR assays with species-specific primers are greatly promising due to their capability of detecting multiple targets in a single assay platform with reduced cost and time.20 Numerous mPCR methods have been proposed. Examples are a tetraplex PCR assay for beef, poultry, fish, and pork;21 pentaplex PCR for pig, dog, cat, rat, and monkey;22 and hexaplex PCR for horse, soybean, sheep, poultry, pork, and cow.3 Another hexaplex PCR assay has been documented for pork, lamb/mutton, chicken, ostrich meat, horse meat, and beef.12 To the best of our knowledge, no study has developed a heptaplex PCR (h-PCR) system for the simultaneous identification and differentiation of cow, buffalo, chicken, cat, dog, pig, and fish species in thermally processed food products. Our developed h-PCR assay successfully detected all the species in the food products despite increased likelihood of DNA degradation during food-processing treatments, especially the thermal ones. Thus, we present an h-PCR assay as a potential tool for the rapid, specific, sensitive, cost-effective, and simultaneous detection of short-targeted mitochondrial DNA of meat (cow, buffalo, pig, chicken, cat, and dog) and fish origins in food products.

Article

MATERIALS AND METHODS

Collection of Samples. Authentic muscle tissues of different species, including cow (Bos taurus), chicken (Gallus gallus), buffalo (Bubalus bubalis), goat (Capra hircus), sheep (Ovis aries), quail (Coturnix coturnix), pigeon (Columba livia), duck (Anas platyrhychos), salmon (Salmo salar), pangas (Pangasius pangasius), tuna (Thunnus orientalis), cod (Gadus morhua), rohu (Labeo rohita), tilapia (Oreochromis niloticus), frog (Rana kunyuensis), rabbit (Oryctolagus cuniculus), ostrich (Struthio camelus), turtle (Cuora amboinensis), and squirrel (Callosciurus notatus), were purchased in triplicates on three distinct dates from different wet markets and general stores (Tesco, Petaling Jaya, Selangor, Pasar Borong Selangor, Serdang, and PuduWet Market, Kuala Lumpur) in Malaysia. Pork (Sus scrofa) was bought in triplicate from three different sellers in a Chinese wet market in Sri Kam-bangan, Selangor, Malaysia. Dog (Canis familiariz), cat (Felis catus), and rat (Rattus rattus) meats were collected from Dewan Bandaraya Kuala Lumpur (DBKL). Monkey (Macaca fascicularis) meat was provided by Wildlife Malaysia.22 Crocodile (Crocodylus porosus) meat was bought from Krocies Outlet, Pearl Point Shopping Center, Kuala Lumpur, Malaysia.23 Plant samples, including onion, garlic, ginger, chili, and flour, were purchased from different grocery stores. Commercial beef, chicken, and pork meatballs and fish balls of distinct brands were bought from different supermarkets across Malaysia. The samples were transported under an ice-chilled (4 °C) condition and preserved at −20 °C until DNA extraction. Thermal Treatment of Meat Samples. To mimic the typical food preparation processes, we exposed crude meat samples to three distinct heat treatment techniques: boiling, autoclaving, and microwave cooking. The beef, buffalo, chicken, feline, canine, pork, and fish were initially boiled in water for 90 min on a hot plate. To simulate an ordinary canning procedure and steam cooking process, we autoclaved the meat samples at 21 °C and 15 psi pressure for 20 min.24 The meat samples were exposed to microwave cooking, a fast and modern means of cooking, at 600 and 700 W for 30 min.25 The treated samples were then stored at −20 °C for DNA extraction. Preparation of Beef, Chicken, and Pork Meatballs. Three model meatballs of beef, chicken, and pork were prepared following the method of Razzak et al.,26 with minor modifications (Table 1). Beef meatballs were deliberately adulterated by spiking with 10%, 1%, and 0.5% (w/w) of buffalo, chicken, feline, canine, pork, and fish. Chicken meatballs were adulterated by spiking with 10%, 1%, and 0.5% (w/w) of beef, buffalo, feline, canine, pork, and fish. Similarly, pork meatballs were contaminated by spiking with 10%, 1%, and 0.5% (w/w) meat of six other target species.26 Then, prepared 0.5% spiked

Table 1. Composition of Model Meatball Products meat ball composition (≥40 g/piece) ingredients

beef

chicken

pork

minced meat soy protein bread crumb chopped onion chopped ginger cumin powder garlic power black pepper tomato paste butter salt othersb

25a 3.5 6 1 0.1 0.75 0.5 0.14 1.5 1.5 SAc SA

25a 3.5 6 1 0.1 0.75 0.5 0.14 1.5 1.5 SA SA

25a 3.5 6 1 0.1 0.75 0.5 0.14 1.5 1.5 SA SA

a

A 10%, 1%, or 0.5% portion of beef, buffalo, chicken, cat, dog, pork, and fish meat was mixed with a balanced amount of respective minced meat to prepare ≥40 g meatball specimen. bFlavouring agents and enhancers. cSA: suitable amounts. B

DOI: 10.1021/acs.jafc.9b02518 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 2. Sequences of Primers Used in This Study species/primer

target gene

cow

cytb

buffalo

ND5

chicken

cytb

cat

cytb

dog

cytb

pig

ND5

fish (universal primer)

16s rRNA

sequence (5′−3′)

amplicon size (bp)

refs

forward: CGGCACAAATTTAGTCGAAT reverse: TGGACTATGGCAATTGCTATG forward: TCGCCTAGCTTCTTACACAAAC reverse: TGGTTTGTGACTGTGATGGAT forward: CTTTGCAATCGCAGGTATTACTAT reverse: GGAATGGGGTGAGTATGAGAGT forward: GGAGTCTGCCTAACCTTACAAATC reverse: CTGATGAAAAGGCGGTTATTG forward: CGGATCCTTACTAGGAGTATGCTT reverse: GGTGACTGATGAAAAAGCTGTG forward: GATTCCTAACCCACTCAAACG reverse: GGTATGTTTGGGCATTCATTG forward: CCGTTAACCCCACACTGG reverse: TTAAAAGACAAGTGATTGCGCTAC

120

Hossain et al.15

138

Hossain et al.15

161

this study

85

this study

103

this study

73

Hossain et al.15

198

Hossain et al.50

duck (A. platyrhynchos), chicken (G. gallus), pig (S. scrofa), horse (E. caballus), donkey (Equus africanus), deer (Cervus nippon), dog (C. familiariz), rabbit (O. cuniculus), cat (F. catus), monkey (M. fascicularis), rat (Ratus norvegicus), quail (C. coturnix), and pigeon (C. livia); 8 aquatic species, namely, salmon (S. salar), cod (G. morhua), tilapia (O. niloticus), tuna (T. orientalis), pangas (P. pangasius), rohu (L. rohita), turtle (Cuora amboinensis), and frog (R. kunyuensis); as well as 4 plant species, namely, onion (Allium cepa), pepper (Capsicum annuum), ginger (Zingiber officinale), and wheat (Triticum aestivum). Specificity was finally confirmed by running a PCR assay against templates of 30 alien species (target and nontarget; see Development of h-PCR Assay). The species-specific primer sets for cow, buffalo, and pig as well as the universal fish primer set used were obtained from a previously published article (Table 2). The required primers were synthesized by Integrated DNA Technologies (IDT) and provided by Apical Scientific Sdn Bhd. Heptaplex PCR Assay. Before the h-PCR assay was developed, simplex PCR was carried out for each target species by using corresponding primer sets, as depicted in our previous work.19 For the simplex PCR, a 25 μL reaction mixture was prepared consisting of 5 μL of 5× GoTaq Flexi Buffer, 0.2 mM each of dNTP, 2.5 mM of MgCl2, 0.625 U GoTaq Flexi DNA Polymerase (Promega, Madison, WI), 0.2 μM of each primer, and 1 μL (20 ng/μL) of the DNA template. For the negative control, deionized water was utilized instead of the template DNA. To check the specificity of the simplex PCR assay, we used 0.2 μM 18S rRNA gene-targeted universal eukaryotic primer (141 bp).33 The PCR assays were accomplished in an ABI Veriti 96-well thermal cycler (Applied Biosystems, Foster City, CA). The initial denaturation was done at 95 °C for 3 min. The subsequent steps were completed with 35 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 35 s, extension at 72 °C for 40 s, and final extension at 72 °C for 5 min. Having optimization of the simplex PCR assays for individual species, the duplex, triplex, tetraplex, pentaplex, hexaplex, and finally h-PCR assays were developed, as shown in Tables 3 and 4. A duplex PCR assay was

meatballs of beef, chicken, and pork were subjected to boiling at 100 °C for 90 min and autoclaved at 121 °C under 15 psi for 20 min.16 All samples were stored at −20 °C until DNA extraction. Extraction of DNA from Raw Meats and Meatballs. Total DNA extraction was done from meat and fish samples by utilizing the Yeastern Genomic DNA Mini Kit (Yeastern Biotech Co., Ltd., Taipei, Taiwan) and adhering to the manufacturer’s instructions.27 Approximately 20 mg of muscle tissue from each sample was pounded and homogenized in an Eppendorf tube by a micropestle. After lysis buffer and proteinase K were added, the blend was incubated at 60 °C in a water bath for 30 min for cell and protein lysis. To remove the protein part, we added absolute ethanol and subjected the mixture to high-speed centrifugation. The use of a spin column allows the binding of the DNA of the samples to the glass fiber matrix upon centrifugation. To eliminate potential contaminants, we added ethanol-containing wash buffer, followed by centrifugation. Finally, the purified DNA attached to the glass fiber matrix was eluted upon the addition of elution buffer and subsequent centrifugation.28 To extract the total DNA from the model and from the collected meat and fish products, we utilized the DNeasy mericon Food Kit (QIAGEN GmgH, Hilden, Germany) in accordance with the manufacturer’s instructions.29 Conversely, the DNeasy Plant Mini Kit (QIAGEN GmgH, Hilden, Germany) was used to extract DNA from plant species.30 To determine the concentration and purity of the extracted DNA, we estimated its absorbance at 260 nm and absorbance ratio at 260/280 nm, respectively,31,32 by using a UV−vis spectrophotometer (NanoPhotometer Pearl, Implen GmbH, Germany). Design of Species-Specific Primers. To design primer sets of chicken, cat, and dog, we targeted mitochondrial cytb genes, given their high level of divergence and presence of adequate conserved regions within the species yet sufficient polymorphism occurring among the closely related species.26 The cytb gene sequences of chicken (NC_001323.1), cat (NC_001700.1), and dog (KJ522809.1), as well as nontarget species, were retrieved from the National Centre of Biotechnology Information (NCBI) database. The MEGA7 alignment tool (http://www.megasoftware.net/) was employed for the alignment of the sequences for the detection of conserved and hyper-variable regions. The freely accessible software Primer3Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/ primer3plus.cgi) was utilized for designing the primer sets (Table 2). The theoretical specificity of the developed primers for the closely related and distant species was confirmed using the online Basic Local Alignment Search Tool (BLAST) in the NCBI database (http://blast. ncbi.nlm.nih.gov/Blast.cgi). In order to detect the level of mismatch between the target and nontarget species, we subjected the primers to in silico screening by utilizing a CLUSTALW multiple sequence alignment program (http://www.genome.jp/tools/clustalw/). The primers were aligned with sequences from 17 land animals, namely, cow (B. taurus), goat (C. hircus), buffalo (B. bubalis), sheep (O. aries),

Table 3. Concentration of PCR Componentsa PCR duplex triplex and tetraplex pentaplex hexaplex heptaplex

MgCl2 (mM)

dNTP (mM)

primer (μM)

Taq pol (unit)

3.0 3.0

0.20 0.20

0.2−0.40 0.12−0.40

0.625 0.80

3.5 3.5 4.0

0.25 0.25 0.25

0.12−0.40 0.12−0.50 0.12−0.52

1.0 1.25 1.25

a Note: 5 μL of 5× GoTaq Flexi Buffer and 7 μL of template DNA [1 μL (20 ng) from each target species] were used in all PCR experiments.

C

DOI: 10.1021/acs.jafc.9b02518 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 4. Cycling Parameters for PCR Reactions 35 cycles of PCR reactions PCR assay

initial denaturation

denaturation

annealing

extension

final extension

duplex, triplex, and tetraplex pentaplex, hexaplex, and heptaplex

95 °C for 3 min 95 °C for 3 min

95 °C for 30 s 95 °C for 40 s

60 °C for 40 s 60 °C for 60 s

72 °C for 40 s 72 °C for 50 s

72 °C for 5 min 72 °C for 5 min

developed using primer sets of cow and buffalo, followed by triplex PCR of cow, buffalo, and pig; tetraplex PCR of cow, buffalo, chicken, and pig; pentaplex PCR of cow, buffalo, chicken, dog, and pig; hexaplex PCR of cow, buffalo, chicken, cat, dog, and pig; and, finally, h-PCR of cow, buffalo, chicken, cat, dog, pig, and fish. The concentration of PCR components and the cycling parameters of all the optimized steps are given in Tables 3 and 4, respectively. Given the poor resolution of agarose gel, the separation and visualization of PCR products were performed in an automated QIAxcel Advanced Capillary Electrophoresis System (QIAGEN, Hilden, Germany). PCR Product Sequencing. The amplification of the extracted DNA of the target species of chicken, cat, and dog was performed by utilizing specific primer sets. Successful amplification was ensured by visualizing the DNA with gel electrophoresis. For gel electrophoresis 2% agarose gel was prepared in 1× Tris−borate−EDTA (TBE) buffer, and the PCR products were run for 60 min at 120 V. All PCR products were purified using the Promega Kit (Promega, Madison, WI). The purified products were then sent to IDT, where they were sequenced bidirectionally with forward and reverse primers. Herein, the PCR product of chicken was sequenced directly, whereas the feline and dog amplification products were sequenced after cloning into a pJet1.2 blunted vector. In brief, the blunt end of the purified PCR products was constructed by proofreading the DNA polymerases ligated into the cloning site of the pJet1.2 blunted vector, followed by introducing the recombinant plasmid into living Escherichia coli cells. The lethal gene of the vector was disrupted by the insertion of PCR products, thereby facilitating the propagation of only the recombinant plasmid containing bacterial cells, given that the plasmid contains the in vitro transcription promoter T7. A single transformation colony of the recombinant plasmid containing cells was produced due to the expression of an ampicillin-resistance gene encoded in the plasmid. After the recombinant plasmid was purified, the contained insert was separated by digestion with a restriction enzyme.34 Finally, the PCR products were sequenced to determine the original order of the nucleotides of the products. The derived sequences were then compared with GenBank sequences through nucleotide BLAST to evaluate any species match. The sequences were also aligned with specific gene sequences by using the MEGA5 software to determine similarity with specific species.

mPCR techniques, primer design is pivotal because, compared with conventional PCR assays, mPCR methods require more critical primer specificity and melting temperature (Tm). Since, the developed primers must undergo selective annealing with their respective targets in a defined set of PCR conditions, such as reagent components, reaction volume, and cycling parameters, the outcome and success of an mPCR method depend on the species-specific primers.35 Previous studies show that mismatch at only a single base pair at the 3′ end often interferes with PCR efficiency and results in unsuccessful amplification.15 Considering the above context, we critically analyzed the necessary parameters for a competent primer, especially base mismatching in the primer annealing sites. In the present study, cytb genes were targeted to design primer sets of chicken, cat, and dog species for developing an h-PCR assay with short-sized amplicons (Table 2). The primer sets of beef, buffalo, pork, and fish were obtained from previous literature. In silico alignment was performed against the corresponding genes of 29 nontarget species (17 terrestrial animal, 8 aquatic, and 4 plant species), as discussed in Design of Species-Specific Primers. The designed primer sequence fully matched only with the target species, including chicken, cat, and dog. Conversely, a 3−16 nucleotide (12.5%−76%) mismatch was found with other species [Figure 1SM, Supporting Information (SI)]. Pairwise distance was calculated through the neighbor-joining technique. The least distance (0.175) was noted between chicken and quail, whereas the most noteworthy (0.891) was observed between chicken and onion (Figure 2SM, SI). Thus, the bioinformatics analysis revealed sufficient genetic distances among the studied species, consequently eliminating the likelihood of any cross-target identification. A phylogenetic tree exhibited comparable observations that support the findings of other in silico studies (Figure 3SM, SI). The simplex PCR assay was initially optimized for each primer pair against the template DNA of each target species to confirm the amplification of each target.21 The primer sets of pig, cat, dog, cow, buffalo, chicken, and fish amplified 73, 85, 103, 120, 138, 161, and 198 bp products, respectively, from the respective regions of cytb, ND5, and 16s rRNA genes in the mitochondrial genome (Figure 1, lanes 1−7). Finally, the developed primers (chicken, cat, and dog) were cross-tested to verify the species specificity against the 7 target and 23 nontarget species (beef, buffalo, goat, sheep, dog, cat, pork, duck, chicken, rabbit, squirrel, crocodile, monkey, pigeon, rat, ostrich, quail, tuna, salmon, cod, pangas, tilapia, rohu, turtle, frog, onion, pepper, ginger, garlic, and wheat) by taking 20 ng of DNA extracted from the studied samples. Definite PCR products of 161, 85, and 103 bp in length were obtained only from chicken, cat, and dog species, respectively, while such products were missing from the other species studied. The utilization of universal eukaryotic primers for all studied species generated an amplification product of 141 bp, thereby eliminating the probability of any false-negative detection (Figure 4SM−6SM, SI). This outcome indicates the high efficiency of each set of the primers in amplifying specific targets. All experiments were

■

RESULTS AND DISCUSSION Quality and Quantity of Extracted DNA. To evaluate the quantity and purity of the extracted DNA, we determined its absorbance at 260 nm and absorbance ratio at 260 and 280 nm, respectively. The absorbance ratio A260/A280 was found to be in the range of 1.8 and 2.0 for all extracted DNA, reflecting high-quality DNA that was suitable for PCR amplification.16 The amount of DNA extracted from animal and fish muscle tissue (20 mg) was 104−571 ng/ μL, that from meat and fish products was 54−183 ng/μL, and that from heat-treated samples was 32−133 ng/ μL. Development of h-PCR Assay. The crucial point in developing a PCR assay is the specificity of the concerned primers; furthermore, primers that completely match the target species and consequently reveal a greater number of mismatches with the nontarget species provide an increased probability of a highly specific PCR assay and eliminate the likelihood of nontarget amplification.19 Therefore, the design and development of suitable primers contribute a vital role for the successful detection of authentic species.22 Especially for D

DOI: 10.1021/acs.jafc.9b02518 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

separates nucleic acids with less than 50 bp difference. Such a method is also laborious and time-consuming. Hence, a fully automated multicapillary electrophoresis device (QIAxcel Advanced Capillary Electrophoresis System, Germany) was used for the separation and subsequent visualization of PCR products. This device allows increased sensitivity and higher resolution, even at minimum length difference (∼5 bp), with reduced analysis time; furthermore, manual handling errors are also minimized due to its built-in gel matrices in a ready-to-run gel cartridge, reducing the likelihood of exposure to hazardous chemicals.19 The gel images and electropherograms provided a clear visualization of all well-separated h-PCR products (Figure 1) for the seven targets. Finally, screening was performed using the developed h-PCR assay against the 18 nontarget species (goat, sheep, rabbit, squirrel, crocodile, monkey, duck, pigeon, quail, ostrich, rat, frog, turtle, wheat, onion, garlic, ginger, and pepper) to analyze cross-specificity. Herein, PCR products were obtained only from beef, buffalo, pork, cat, dog, chicken, and fish targets. Not a single product was obtained from any other nontargets, thereby indicating stringent specificity (data not shown). Various mPCR tests have been reported to simultaneously detect different species, as summarized in Table 5. However, no report is available for the simultaneous authentication of cow, buffalo, chicken, cat, dog, pig, and fish species, along with extremely thermally processed samples. In this study, we developed an h-PCR assay targeting mitochondrial cytb, ND5, and 16s rRNA genes and involving short target lengths (73− 198 bp), which exhibit more thermodynamic stability relative to long targets. To the best of our knowledge, this work is the first report of a short amplicon targeted h-PCR assay for the differential and simultaneous identification of cow, buffalo, chicken, cat, dog, pig, and fish species in raw and processed food products. Sequencing. Although specific species could often be conclusively assigned through proper design and optimization of PCR assays, the validation of PCR products by sequence analysis greatly enhances the reliability and acceptability of the PCR assay. Moreover, PCR products indicate only the presence or absence of the species, whereas the sequencing of PCR products absolutely ensures the determination of the appropriate species.36 The PCR products of cat and dog were cloned prior to sequencing because they were of very short length and direct sequencing of the full-length sequence of their products cannot be achieved.37 On the other hand, the chicken PCR product was sequenced directly due to its suitable size to derive an identifiable sequence. At first, the obtained sequences were aligned with GenBank (www.ncbi. nlm.nih.gov) sequences to check any match with any species. The MEGA7 alignment tool was then used for alignment with specific gene sequences to identify similarities. The similarity score obtained from the sequences of chicken, cat, and dog showed 100% homology with G. gallus, F. catus, and C. familiariz sequences available in GenBank, respectively. Cawthorn et al.38 showed a 99% sequence similarity for three studied samples (one “blesbok biltong” and two “kudu biltong”). Likewise, 97.78% sequence similarity was observed for bovine-specific PCR products by Natonek-Wisniewska et al.,39 whose work with ovine revealed a similarity of >94% with ovine species and over 99% for porcine products. Dalmasso et al.21 obtained a 100% sequence similarity score for ovine, chicken, and pork species. Man et al.40 also found a 100% sequence identity for the PCR product of pork sausage sample.

Figure 1. Gel image (a) and electropherogram (b) of h-PCR for pig, cat, dog, cow, buffalo, chicken, and fish species authentication. In the gel image (a), lane M represents the DNA ladder; lanes 1−13 are the PCR products from pig (lane 1); cat (lane 2); dog (lane 3); cow (lane 4); buffalo (lane 5); chicken (lane 6); fish (lane 7); duplex PCR of cow and buffalo (lane 8); triplex PCR of pig, cow, and buffalo (lane 9); tetraplex PCR of pig, cow, buffalo, and chicken (lane 10); pentaplex PCR of pig, dog, cow, buffalo, and chicken (lane 11); hexaplex PCR of pig, cat, dog, cow, buffalo, and chicken (lane 12); heptaplex PCR of pig, cat, dog, cow, buffalo, chicken, and fish (lane 13); and lane N is the negative control. The corresponding electropherogram of lane 13 is represented with labels.

replicated three times on three distinctive days, but the same results were observed. Once the simplex PCR was confirmed, a step-by-step development of the h-PCR assay was attempted to simultaneously detect all target species (Figure 1). The experimental stages proceeded through the simplex (lanes 1−7), duplex (lane 8), triplex (lane 9), tetraplex (lane 10), pentaplex (lane 11), hexaplex (lane 12), and finally the heptaplex (lane 13) PCR assays to establish the consistency of the multiplex system.22 By applying the simplex and all the multiplex assays, we successfully amplified the target gene (cytb, ND5, and 16s rRNA) regions yielding 73, 85, 103, 120, 138, 161, and 198 bp PCR products from pig, cat, dog, cow, buffalo, chicken, and fish, respectively (Figure 1). This outcome indicates full consistency with the simplex PCR system. Herein, we used 10 different fish species (T. thynnus, Rastrelliger faughni, Chanos chanos, Epinephelus coioides, Cyprinus carpio carpio, L. rohita, S. salar, O. mossambicus, Scomberomorus guttatus, and P. pangasius) to evaluate the efficiency of a universal fish biomarker and found the amplification of 198 bp PCR products from all of the studied samples. This result reflects the universal character of the developed biomarker. In this study, we could not perform agarose gel electrophoresis to separate and visualize the amplified products because the differences in the length of the amplified products were narrow. Moreover, agarose gel electrophoresis barely E

DOI: 10.1021/acs.jafc.9b02518 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Kitpipit et al.12

Matsunaga et al.43

Limit of Detection (LOD). A low LOD of a test is an indicator of the presence of targets at a marginal level in food products. For determination of the sensitivity of the h-PCR assay, we prepared a mixture of the extracted DNA of seven target species (cow, buffalo, chicken, cat, dog, pig, and fish) consisting of 10 ng/μL DNA of each species. Subsequently, the DNA mixture was serially diluted 10-fold from 10.0 ng/μL to 0.001 ng/μL (10.0, 1.0, 0.1, 0.01, and 0.001 ng/μL). Using the QIAxcel automated capillary electrophoresis system, we visualized seven distinct bands corresponding to amplified PCR products of pig, cat, dog, cow, buffalo, chicken, and fish species to a level as low as 0.01 ng of DNA (Figure 2, lane 4). On the other hand, lane 5 corresponding to 0.001 ng showed clear bands for PCR products from cat (85 bp), dog (103 bp), beef (120 bp), chicken (161 bp), and fish (198 bp). Although the band intensity of pork DNA (73 bp) was very low, the electropherograms (lane 5 of Figure 2b) clearly showed the corresponding peak. However, no PCR product was observed for buffalo (138 bp) in lane 5. Therefore, the LOD for pig, cat, dog, cow, chicken, and fish was 0.001 ng, whereas that for buffalo was 0.01 ng. Razzak et al.26 detected 0.01 ng of DNA of monkey, rat, and dog, and 0.02 ng for cat and pig by using a pentaplex PCR assay that yielded 108−172 bp product sizes. Zhang41 detected 0.001 ng (1 pg) of DNA while using a seminested mPCR for chicken (216 bp), beef (263 bp), mutton (322 bp), and pork (387 bp). However, in seminested mPCR, the prior amplification of a common primer pair is performed before using the amplified product as a template for the mPCR. Consequently, the seminested assay is complicated, expensive, time-consuming, and less reliable. Moreover, due to the identical efficiency of the short primers for different templates, the detection of the exact species sometimes becomes difficult.22 Furthermore, Kitpipit et al.12 worked with amplicon sizes between 100−311 bp and observed an LOD of 7−21 fg for chicken, beef, lamb, pork, horse, and ostrich. A detection level of 0.1−0.2 ng of DNA in a simplex PCR assay for cattle, pig, sheep, and chicken with 149−274 bp product sizes has also been observed.42 Matsunaga et al.43 obtained a 0.25 ng LOD for the authentication of goat, chicken, cattle, sheep, pig, and horse with 157−439 bp amplicon sizes. Furthermore, an LOD of 0.005 ng in both simplex and multiplex systems has been achieved for lamb, beef, and duck.13 Thus, in terms of sensitivity, the efficiency of our method is quite satisfactory compared with the previously mentioned assays. Validation of the h-PCR Assay in Thermally Processed Meat and Fish. Due to extreme thermal or processing treatments, DNA in food products are usually subjected to disruption or degradation because of mechanical forces as well as natural decomposition.44 It is necessary to validate the stability of a PCR assay for thermally treated meat samples in order to apply the method for the analysis of processed food products.13 Therefore, heat-treated meat and fish samples have been assayed to evaluate the detection efficiency of the developed h-PCR technique.44 As described in the methodology (Thermal Treatment of Meat Samples), the raw meat of cow, buffalo, chicken, cat, dog, pig, and fish were exposed to three diverse thermal treatment processes in the present study. The h-PCR assay was performed using the extracted DNA from all processed samples as templates. All markers were successfully amplified from the samples of three different heat treatments, namely, boiling (100 °C for 90 min), extreme microwaving (500 and 700 W for 30 min), and

609

172, 163, 141, 129, and 108, ND5, ATPase 6, and respectively cytochrome b

274, 157, 227, 331, 398, and cytb 439, respectively

100, 119, 133, 155, 253, and cytb, COI, and 12s rRNA 311, respectively

cattle, buffalo, goat, sheep, and pig

cat, dog, pig, monkey, and rat meats

cattle, goat, chicken, sheep, pig, and horse

pork, lamb/mutton, chicken, ostrich meat, horse meat, and beef

multiplexconventional PCR assay multiplexDetection limits was 0.25 ng under pure state. Only cooked samples were conventional PCR analyzed, but other heat-treated samples were not tested. assay direct-multiplex PCR Heat-treated samples were not tested.

Specific primers for all species were not used. Sensitivity of the method was not Kumar et al. 49 tested. Heat stability was not shown. Only autoclaved samples were analyzed, but other heat treatment was not Ali and coshown. workers22

Only autoclaved samples were analyzed, and other heat treatment was not shown.

Safdar and Junejo3 Safdar and Junejo 48 Heat-treated samples were not tested.

cytb, lectin, 12S rRNA, hexaplex12S rRNA, ATPase conventional PCR t.glu gene, cytb, 12S rRNA, multiplexand ATPase conventional PCR assay cytb PCR-RFLP 271, 212, 183, 119, 85, and 100, respectively 271, 119, 142, and 224, respectively cow, pork, poultry, sheep, horse, and soybean bovine, ovine, caprine, and fish

method target gene amplicon size (bp) detected species

Table 5. A Summary of Various Reported Multiplex PCR Assays for Detecting Different Species

limitations

refs

Journal of Agricultural and Food Chemistry

F

DOI: 10.1021/acs.jafc.9b02518 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 2. Sensitivity test of the heptaplex PCR system. In the gel view (a), lane M is the DNA ladder, lanes 1−5 are the h-PCR products of 10.0, 1.0, 0.1, 0.01, and 0.001 ng of the mixed DNA of pig, cat, dog, cow, buffalo, chicken, and fish species, respectively; and lane N is the negative control (0 ng of DNA). The electropherograms of lanes (b) 4 and (c) 5 are presented with labels.

autoclaving (121 °C at 15 psi for 20 min) (Figure 3). This outcome evidenced the high stability of our developed h-PCR technique, even with degraded samples that were exposed to harsh cooking procedures. Previous studies showed an increased stability of short-length PCR targets over long ones.16 Therefore, the high stability of all of our targets (