Homogeneous Immunochemical Assay on the ... - ACS Publications

Subscriber access provided by Univ. of Tennessee Libraries

Technical Note

Homogeneous Immunochemical Assay on the Lateral Flow Strip for Rapid Measurement of DNase I Activity Yi Zhang, and Jackie Y. Ying Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.5b02658 • Publication Date (Web): 28 Sep 2015 Downloaded from http://pubs.acs.org on September 30, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 12

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Fig. 1. Lateral flow immunochemical assay for the measurement of DNase I activity on the test strip. a) Illustration of the dually labeled DNA reporter probe with biotin at one terminal and fluorescein at the other terminal. b) Illustration of the test strip assembly. c) In the absence of DNase I, the DNA reporter probes are captured by the streptavidin on the test strip. The gold nanoparticles are immobilized via the DNA reporter probes, which give rise to colorimetric signal at the test line. d) DNase I digests the reporter probes and breaks the linkage between the gold nanoparticles and the test strip. As a result, gold nanoparticles cannot be immobilized at the test line. 120x268mm (300 x 300 DPI)

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fig. 2. Optimization of the DNA reporter probe concentration. a) Photographs of the DNase I test strips showing test lines with and without digestion for three different probe concentrations. b) Test line intensity difference for a serial dilution of the DNA reporter probes. 218x248mm (300 x 300 DPI)


Page 2 of 12

Page 3 of 12

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 3. Measurement of DNase I activity using the DNase I lateral flow test strip. a) Photograph of the test strips showing the change in test line intensity with DNase I concentration. b) The effect of digestion time on the linear dynamic range. c) The effect of probe concentration on the linear dynamic range. 118x279mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fig. 4. Investigation of DNase I inhibition using the DNase I lateral flow test strip. a) DNase I inhibition by Na+ in 1× PBS. b) DNase I inhibition by EDTA. 136x209mm (300 x 300 DPI)


Page 4 of 12

Page 5 of 12

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 5. Measurement of DNase I activity in serum. a) Comparison of DNase I activity in serum and in water measured using the DNase I lateral flow test strip. Comparison of DNase I activity measured with 1-h and 4h digestion b) in serum and c) in water, respectively. 65x151mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 12

Homogeneous Immunochemical Assay on the Lateral Flow Strip for Rapid Measurement of DNase I Activity Yi Zhanga, Jackie Y. Yinga,* a

Institute of Bioengineering and Nanotechnology, 31 Biopolis Way, The Nanos, Singapore 138669, Singapore

ABSTRACT: Deoxyribonuclease I (DNase I) is an important enzyme that cleaves both double-stranded and single-stranded DNA at their phosphate backbone. DNase I is a useful biomarker. Previous studies have shown that patients with prostate cancer and systemic lupus erythematosus exhibit reduced DNase I activity, and patients with myocardial infarction exhibit increased DNase I activity. Current methods of measuring DNase I relies either on immunochemical assay, which requires multiple washing steps, or on single radial enzyme diffusion assay, which requires long digestion time and expensive fluorescence detection system. We have developed a lateral flow immunochemical assay for the measurement of DNase I activity on the test strip. The assay utilized a dually labeled double-stranded DNA as the reporter probe. The biotin-labeled terminal of the probe binded to the streptavidin immobilized on the lateral flow test strip, and the fluorescein-labeled terminal binded to the antibody-conjugated gold nanoparticles, resulting in a visible test line. The presence of DNase I would cleave the reporter probe and lead to reduced test line intensity. Using the DNase I test strip, we have successfully measured the DNase I activity, and determined the factors that influence the sensitivity and linear dynamic range of the assay. We have also investigated the conditions that inhibited the DNase I activity. The combined advantage of wash-free assay format and colorimetric readout would make the lateral flow DNase I test strip a suitable platform for point-of-care diagnostics.

Deoxyribonuclease I (DNase I) is an endonuclease that acts on both double-stranded and single-stranded DNA. It nonspecifically cleaves the DNA at the phosphate backbone, resulting in di-, tri-, and oligonucleotides with phosphorylated 5’ terminal and hydroxylated 3’ terminal.1,2 To be active, DNase I requires the presence of Ca2+, Mg2+ or Mn2+ ions in an environment with the pH close to neutral. DNase I is responsible for the fragmentation of genomic content during apoptosis.3,4 It is a useful diagnostic biomarker.5-13 DNase I activity in patients with systemic lupus erythematosus (SLE) was reported to be lower than that of healthy controls.8,9,13 It has been shown that the treatment with recombinant murine DNase would postpone the onset of SLE and extend the survival time by 30% in mice.9 DNase I activity was lower in the blood samples of cancer patients, which was proposed to be the cause of increased integrity and quantity of cell-free circulating DNA.6,14 DNase I was also proven to be a useful diagnostic marker for cardiovascular diseases. Patients with acute myocardial infarction exhibited elevated DNase I activity 3 h from the onset of symptom.5,7 A similar study demonstrated the use of DNase I in the diagnosis of transient myocardial ischemia.11 Several methods have been proposed to measure the activity of DNase I. Sinicropi and colleagues used natural salmon testes DNA as the DNase I substrate.15 The DNA was stained with methyl green, a major groove binding dye that served as the reporter. Once bound to the DNA, the absorbance of methyl green would increase. The digestion of the DNA substrate by DNase I released the methyl green into the solution, resulting in decreased absorption at 620 nm, a parameter used to calculate the DNase I activity. Another method developed by

Cherepanova and colleagues employed a dually labeled PCR amplicon as the DNase I substrate.16 The DNA substrate was immobilized to an avidin-coated microtiter plate via the biotin label at one terminal. Peroxidase-conjugated antibody would bind to the fluorescein on the other terminal of the DNA substrate and generate signals. In the presence of DNase I, the DNA substrate was cleaved. As a result, the peroxidaseconjugated antibody could not stay on the microtiter plate, and no signal could be observed. However, the heterogeneous assay required several rounds of washing to reduce the nonspecific background. Another well-established and widely used assay for DNase I activity measurement was the single radial enzyme diffusion (SRED) method.17 SRED utilized a hydrogel substrate made by mixing salmon testes DNA with agarose. The DNA was stained with a DNA intercalating dye, ethidium bromide. To measure DNase I activity, samples containing DNase I were added to wells punched in the hydrogel. Under ultraviolet (UV) light, the hydrogel substrate appeared bright. As DNase I diffused into the hydrogel and digested the DNA, a dark circle started to appear around the well. The DNase I activity was determined by measuring the diameter of the dark circle. SRED was used by several studies mentioned above,5,7-9,11 but it has a few drawbacks. First, it required a UV light source and an imaging system to constantly monitor the hydrogel substrate. These bulky instruments would limit SRED to well-established laboratories, and prevent its use in low resource settings for point-of-care diagnostics. Furthermore, SRED required a long digestion time. An overnight digestion was typical for SRED. Although a modified version of SRED claimed to measure DNase I activity on paper substrate within 1 h, the performance was greatly compromised.18


Page 7 of 12

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The goal of this study is to develop a point-of-care DNase Ibased diagnostic test, and the lateral flow test strip is an ideal platform. Lateral flow platform has been applied to immunoassays in many applications.19-24 On a typical lateral flow test strip, a capture agent, either an antigen or an antibody, is immobilized at the test line. As the target molecules flow through the test strip, they are captured by the capture agent. A detector antibody, which is conjugated to chromogenic or fluorescent reporters, tags the immobilized target molecules, resulting in a visible test line. Lateral flow strip enables true point-ofcare capability, and is the most widely accepted home test platform. Lateral flow platform is well known for its simplicity. Firstly, the capillary-driven liquid handling mechanism eliminates external pumping apparatus. Secondly, reagents are pre-stored in the dry form on the test strip in a self-contained fashion. Thirdly, the readout from the lateral flow platform is visible to unaided eyes, which greatly reduces the cost associated with optical detection system. In this study, we developed a lateral flow immunochemical assay to measure the DNase I activity on the test strip (Fig. 1). The test strip contained surface-immobilized streptavidin at the test zone. This lateral flow test strip provided a homogeneous (i.e. wash-free) immunochemical assay for the measurement of DNase I activity. It was simple to use and held great potential for point-of-care diagnostics.

higher than optimal probe concentration, the test line intensity became insensitive to DNase I due to the “Hook’s effect”.25 The optimal probe concentration would result in an intense test line, and the test line intensity would decrease significantly after digestion by DNase I. With 6.25 nM of the reporter probe, the test line was hardly visible even without the digestion by DNase I (Fig. 2a). On the other hand, with 800 nM of the reporter probe, there was no significant difference in the test line intensity between samples with and without the digestion by DNase I. In contrast, with 100 nM of the reporter probe, which was within the optimal concentration range, the test line exhibited high intensity for the sample without the digestion, and a greatly reduced intensity after digestion by DNase I.

Experimental Section Methods are described in detail in the supporting information. Briefly, the test strip was made by dispensing streptavidin onto nitrocellulose membrane. An arbitrary 76-bp double-stranded DNA reporter probe was custom-synthesized. (CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGC TTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCAC GTG). One of the strands was labeled with biotin, and its complementary strand was labeled with fluorescein. The antifluorescein antibodies were conjugated to the gold nanoparticles coated with protein G. Human recombinant DNase I was incubated with reporter probe at 37ºC for the desired duration. The serum was obtained off-the-clot. To measure DNase I in serum, 8 µL of serum was added to the reaction mixture. Results and Discussion Assay Principle. A biotin-fluorescein dually labeled double-stranded DNA was used as the DNase I substrate, which also functioned as the reporter probe (Fig. 1a). As the DNA reporter probe flowed through the test strip, it was captured by the immobilized streptavidin (Fig. 1b). Gold nanoparticles, which were conjugated to anti-fluorescein detector antibodies, would bind to the fluorescein-labeled terminal of the DNA, generating a dark test line visible to unaided eyes (Fig. 1c). In the presence DNase I, the DNA reporter probe was cleaved. As a result, the linkage between the gold nanoparticles and the test strip was broken, and gold nanoparticles would flow off the test strip, hence not able to generate signals (Fig. 1d). Probe optimization. First, the probe concentration needed to be optimized in order to achieve the best sensitivity. When a probe concentration that was lower than the optimal was used, a very weak intensity would be obtained for the test line. With

Fig. 1. Lateral flow immunochemical assay for the measurement of DNase I activity on the test strip. a) Illustration of the dually labeled DNA reporter probe with biotin at one terminal and fluorescein at the other terminal. b) Illustration of the test strip assembly. c) In the absence of DNase I, the DNA reporter probes are captured by the streptavidin on the test strip. The gold nanoparticles are immobilized via the DNA reporter probes, which give rise to colorimetric signal at the test line. d) DNase I digests the reporter probes and breaks the linkage between the gold nanoparticles and the test strip. As a result, gold nanoparticles cannot be immobilized at the test line.

2



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

To optimize the reporter probe concentration, a 2-fold serial dilution of the reporter probe was digested with 15.6 unit/L DNase I for 15 min. The measurement was subsequently performed on the test strip. The difference in test line intensity from samples with and without digestion was calculated and plotted as a function of the reporter probe concentration (Fig. 2b). The intensity difference exhibited a bell-shaped curve with a plateau. As the concentration increased, the difference in test line intensity increased and reached a plateau at the center of the bell-shaped curve. As the concentration further increased, the difference in test line intensity started to decrease. The plateau region, which was the optimal probe concentration range, encompassed 10−200 nM.

Page 8 of 12

a lower reporter probe concentration allowed us to obtain the same linear dynamic range with a shorter digestion time, the test line intensity was weak, and the difference between samples was too small to be clearly distinguished.

Fig. 2. Optimization of the DNA reporter probe concentration. a) Photographs of the DNase I test strips showing test lines with and without digestion for three different probe concentrations. b) Test line intensity difference for a serial dilution of the DNA reporter probes.

DNase I activity on test strip. A 2-fold serial dilution of DNase I was measured using the test strip. 1 µL of the reporter probes and 1 µL of the 10× digestion buffer were added to 8 µL of sample containing DNase I. The final mixture contained 1× digestion buffer and 20 nM of reporter probes. The mixture was digested at 37ºC for 1 h, and then measured on the test strip. As shown in Fig. 3a, the test line intensity decreased with increasing DNase I concentration, as evidenced by the decreasing peak in the test line profile (Fig. 3a, right). The test line intensity was plotted as a function of DNase I concentration in semi-log scale, and fitted with a linear function (Fig. 3b and 3c). The probe concentration also affected the linear dynamic range (Fig. 3c). The sample with 20 nM of reporter probes covered the linear dynamic range of ~ 7.8 units/L to 125 units/L. As the concentration of the reporter probes decreased below the optimal probe concentration, test line intensity was reduced, and the linear dynamic range shifted towards the left. The response curves were fitted by linear regression. The Rsquare values for samples with 1 nM, 5 nM and 20 nM of reporter probes were 0.87, 0.99 and 0.99, respectively. Although

Fig. 3. Measurement of DNase I activity using the DNase I lateral flow test strip. a) Photograph of the test strips showing the change in test line intensity with DNase I concentration. b) The effect of digestion time on the linear dynamic range. c) The effect of probe concentration on the linear dynamic range.

Linear dynamic range. The concentration of tested DNase I ranged from 0.98 units/L to 125 units/L. The dynamic range with linear response changed with the digestion time (Fig. 3b). With 15-min digestion, the range with linear response encompassed the samples with high DNase I concentration. As the digestion time increased, the linear dynamic range shifted towards the left and covered samples with lower DNase I concentration. Compared to 15-min digestion, the response curve with 1-h digestion covered samples containing ~ 4 units/L to ~ 60 units/L of DNase I. With 4-h digestion, the response curve shifted further to the left and covered samples containing ~ 2 units/L to ~ 30 units/L of DNase I. The response curves were fitted by linear regression. All the curve fits have a R-square value of > 0.99. The average DNase I concentration in human serum was ~ 5 units/L.17 Therefore, 1-h digestion would be sufficient for serum samples.

3


Page 9 of 12

a 160 ×

1 PBS Water

Intensity

120

80

40

0

1

10 100 DNAse concentration (units/L)

b 160 120 Intensity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


80

40

With EDTA Without EDTA

0 1

10 100 DNAse concentration (unit/L)

Fig. 4. Investigation of DNase I inhibition using the DNase I lateral flow test strip. a) DNase I inhibition by Na+ in 1× PBS. b) DNase I inhibition by EDTA.

Investigation of DNase I inhibition. DNase I is sensitive to the buffer condition. High concentration of Na+ would inhibit DNase I activity.1 For comparison, we measured the DNase I activity in water and in 1× PBS on the test strip. In both cases, 1 µL of 10× digestion buffer and 1 µL of reporter probes at 200 nM were added to 8 µL of samples containing DNase I. The final mixture contained 1× digestion buffer and 20 nM reporter. 1× PBS contained 137 mM of Na+, and such a high level of Na+ would strongly inhibit DNase I activity. With 15min digestion, the test line intensity was significantly higher for samples in 1× PBS than those in water, indicating reduced DNase I activity (Fig. 4a). For the sample containing 125 units/L of DNase I in water, the test intensity was ~ 10. In contrast, for the sample with same amount of DNase I in 1× PBS, the intensity was ~ 80. The relative difference in test line intensity was ~ 8 fold, suggesting a strong inhibition in 1×PBS. DNase I requires divalent ions such as Mg2+, Ca2+ or Mn2+ to be functional. Ethylenediaminetetraacetic acid (EDTA) is a widely used chelating agent that binds strongly to divalent ions. Hence, the presence of EDTA would deplete divalent ions in the solution, thereby inhibiting DNase I activity.26 We have investigated the effect of EDTA on DNase I activity using the test strip. We measured a serial dilution of DNase I in buffers with and without EDTA. In both cases, 20 nM of reporter probe was digested in 1× digestion buffer for 2 h. In the absence of EDTA, a typical response curve was observed (Fig. 4b). In contrast, DNase I activity was completely inhibited in the presence of EDTA, even with 2 h of digestion. Measurement of DNase I in serum. We measured the activity of DNase I spiked into serum. A 2-fold serial dilution of

DNase I was spiked into heat-inactivated serum. The serum samples were then digested with 20 nM of reporter probe for 1 h. Compared to the samples in water under the same condition, DNase I activity in serum was slightly inhibited (Fig. 5a). The inhibition was particularly evident for samples with medium DNase I concentration ranging from ~ 7 units/L to ~ 60 units/L. The inhibition was likely due to high concentration of Na+ in the serum and the presence of β-actin, a known DNase I inhibitor naturally existing in blood.27 DNase I was found to be active for a longer period of time in serum than in water. Fig. 5b compares the response curves for DNase I in serum and in water with 1-h and 4-h digestion. For DNase I in serum, the response curve with 4-h digestion shifted to the left. More noticeably, the test line intensity decreased significantly after 4-h digestion for samples with low DNase I concentration. However, the same phenomenon was not observed for samples in water. With 4-h digestion, although the response curve also shifted to the left, the test line intensity hardly changed for samples with low DNase I concentration. We speculated that serum would provide a protective environment for DNase I, which allowed the enzyme to remain active for a longer period of time. DNase I lateral flow strip vs. other methods. Measuring the DNase I activity on the lateral flow platform has many advantages over the traditional ELISA-like immunochemical assay and SRED. Compared to conventional immunochemical assay, which requires multiple washing steps in order to eliminate the false positive caused by non-specific protein adsorption, the lateral flow strip is a homogeneous assay and does not require washing. Compared to SRED, which requires UV light source and fluorescence optical detection system, the lateral flow strip provides colorimetric readout that can be directly visualized by unaided eyes. Furthermore, the digestion is conducted at 37°C, which may be provided by the body temperature. The combined advantage renders the DNase I test strip a suitable platform for point-of-care diagnostics. Conclusions In summary, we have developed a lateral flow immunochemical assay for the measurement of DNase I activity on the test strip. The assay used an arbitrary 76-bp dually labeled double-stranded DNA as the reporter probe. The digestion of the reporter probe by DNase I would result in reduced test line intensity on the lateral flow test strip, which enabled us to determine the DNase I activity. We have optimized the probe concentration and assaying conditions, and successfully determined DNase I activity. The DNase I test strip is considerably more rapid than tests that have been described previously. The dynamic range is easily tunable and covers the concentration of DNase I in physiological fluids. The DNase I test strip is a homogeneous assay platform that does not require any washing step. It provides colorimetric readout that is visible to unaided eyes. These advantages make the DNase I test strip an ideal platform for point-of-care diagnostics. A control line will be added in the future to allow end users to ensure the proper performance of the device.

4



a

160 serum water

Intensity

120

80

40

0 1

10 100 DNAse concentration (unit/L)

b 160 1h 4h

Intensity

120

80

40

0 1


c 160 1h 4h

120 Intensity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

80

40

0 1


Fig. 5. Measurement of DNase I activity in serum. a) Comparison of DNase I activity in serum and in water measured using the DNase I lateral flow test strip. Comparison of DNase I activity measured with 1-h and 4-h digestion b) in serum and c) in water, respectively.

AUTHOR INFORMATION Corresponding Author * Corresponding author. Tel.: +65 6824 7100; fax: +65 6478 9020. E-mail address: [email protected] (J.Y. Ying).

Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.

ACKNOWLEDGMENT This work is supported by the Institute of Bioengineering and Nanotechnology (Biomedical Research Council, Agency of Science, Technology and Research, Singapore).

SUPPORTING INFORMATION Supporting Information Available: This information is available free of charge via the Internet at http://pubs.acs.org.

Page 10 of 12

REFERENCES (1) Kunitz, M. J. Gen. Physiol. 1950, 33, 363-377. (2) Vanecko, S.; Laskowski, M. J. Biol. Chem. 1961, 236, 33123316. (3) Mishra, N. C. Nucleases: molecular biology and applications; Wiley-Interscience: New York, 2002. (4) Moore, S. In The Enzymes, Paul, D. B., Ed.; Academic Press: New York, 1981, pp 281-296. (5) Arakawa, K.; Kawai, Y.; Kumamoto, T.; Morikawa, N.; Yoshida, M.; Tada, H.; Kawaguchi, R.; Taniguchi, K.; Miyamori, I.; Kominato, Y.; Kishi, K.; Yasuda, T. Eur. Heart J. 2005, 26, 2375-2380. (6) Cherepanova, A. V.; Tamkovich, S. N.; Bryzgunova, O. E.; Vlassov, V. V.; Laktionov, P. P. Ann. N. Y. Acad. Sci. 2008, 1137, 218-221. (7) Kawai, Y.; Yoshida, M.; Arakawa, K.; Kumamoto, T.; Morikawa, N.; Masamura, K.; Tada, H.; Ito, S.; Hoshizaki, H.; Oshima, S.; Taniguchi, K.; Terasawa, H.; Miyamori, I.; Kishi, K.; Yasuda, T. Circulation 2004, 109, 2398-2400. (8) Macanovic, M.; Lachmann, P. J. Clin. Exp. Immunol. 1997, 108, 220-226. (9) Macanovic, M.; Sinicropi, D.; Shak, S.; Baughman, S.; Thiru, S.; Lachmann, P. J. Clin. Exp. Immunol. 1996, 106, 243-252. (10) Malíčková, K.; Ďuricová, D.; Bortlík, M.; Hrušková, Z.; Svobodová, B.; Machková, N.; Komárek, V.; Fučíková, T.; Janatková, I.; Zima, T.; Lukáš, M. Autoimmune Dis. 2011, 2011, 945861. (11) Morikawa, N.; Kawai, Y.; Arakawa, K.; Kumamoto, T.; Miyamori, I.; Akao, H.; Kitayama, M.; Kajinami, K.; Lee, J.-D.; Takeshita, H.; Kominato, Y.; Yasuda, T. Eur. Heart J. 2007, 28, 2992-2997. (12) Zhu, B.; Gong, Y.; Chen, P.; Zhang, H.; Zhao, T.; Li, P. Mol. Cell. Biochem. 2014, 393, 23-32. (13) Martínez Valle, F.; Balada, E.; Ordi-Ros, J.; Vilardell-Tarres, M. Autoimmun. Rev. 2008, 7, 359-363. (14) Tamkovich, S. N.; Cherepanova, A. V.; Kolesnikova, E. V.; Rykova, E. Y.; Pyshnyi, D. V.; Vlassov, V. V.; Laktionov, P. P. Ann. N. Y. Acad. Sci. 2006, 1075, 191-196. (15) Sinicropi, D.; Baker, D. L.; Prince, W. S.; Shiffer, K.; Shak, S. Anal. Biochem. 1994, 222, 351-358. (16) Cherepanova, A.; Tamkovich, S.; Pyshnyi, D.; Kharkova, M.; Vlassov, V.; Laktionov, P. J. Immunol. Methods 2007, 325, 96-103. (17) Nadano, D.; Yasuda, T.; Kishi, K. Clin. Chem. 1993, 39, 448-452. (18) Takeshita, H.; Nakajima, T.; Mogi, K.; Kaneko, Y.; Yasuda, T.; Iida, R.; Kishi, K. Clin. Chem. 2004, 50, 446-448. (19) Jawaid, W.; Campbell, K.; Melville, K.; Holmes, S. J.; Rice, J.; Elliott, C. T. Anal. Chem. 2015, 87, 5324-5332. (20) Song, L.-W.; Wang, Y.-B.; Fang, L.-L.; Wu, Y.; Yang, L.; Chen, J.-Y.; Ge, S.-X.; Zhang, J.; Xiong, Y.-Z.; Deng, X.-M.; Min, X.-P.; Zhang, J.; Chen, P.-J.; Yuan, Q.; Xia, N.-S. Anal. Chem. 2015, 87, 5173-5180. (21) Xu, H.; Chen, J.; Birrenkott, J.; Zhao, J. X.; Takalkar, S.; Baryeh, K.; Liu, G. Anal. Chem. 2014, 86, 7351-7359. (22) Xu, Y.; Liu, Y.; Wu, Y.; Xia, X.; Liao, Y.; Li, Q. Anal. Chem. 2014, 86, 5611-5614. (23) Papanikos, F.; Iliadi, A.; Petropoulou, M.; Ioannou, P. C.; Christopoulos, T. K.; Kanavakis, E.; Traeger-Synodinos, J. Anal. Chim. Acta 2012, 727, 61-66. (24) Wang, S.; Zhang, C.; Wang, J.; Zhang, Y. Anal. Chim. Acta 2005, 546, 161-166. (25) Stamm, A. M.; Polt, S. S. JAMA 1980, 244, 1359-1359.

5


Page 11 of 12

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(26) Barra, G. B.; Santa Rita, T. H.; Vasques, J. d. A.; Chianca, C. F.; Nery, L. F. A.; Costa, S. S. S. Clin. Biochem. 2015, http://dx.doi.org/10.1016/j.clinbiochem.2015.02.014. (27) Lazarides, E.; Lindberg, U. Proc. Natl. Acad. Sci. USA 1974, 71, 4742-4746.

6



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 12

For Table of Contents Only

7


Homogeneous Immunochemical Assay on the ... - ACS Publications

Recommend Documents