Human Umbilical Cord Mesenchymal Stem Cells as Vehicles of CD20

Nov 2, 2012 - Non-coding RNAs are promising targets for stem cell-based cancer therapy. Naoya Sakamoto , Ririno Honma , Yohei Sekino , Keisuke Goto , ...
9 downloads 16 Views 621KB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Human Umbilical Cord Mesenchymal Stem Cells as Vehicles of CD20Specific TRAIL Fusion Protein Delivery: A Double-Target Therapy against Non-Hodgkin’s Lymphoma Cihui Yan,†,‡ Shuangjing Li,† Zhenzhen Li,† Hongwei Peng,† Xiangfei Yuan,† Linlin Jiang,† Yanjun Zhang,† Dongmei Fan,† Xiao Hu,† Ming Yang,†,* and Dongsheng Xiong†,* †

State Key Laboratory of Experimental Hematology, Department of Pharmacy, Institute of Hematology & Hospital of Blood Diseases, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin 300020, P. R. China ‡ Department of Biotherapy Center, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, P. R. China ABSTRACT: Mesenchymal stem cells (MSCs) are an attractive candidate for cellbased therapy. We have designed a promising double-target therapeutic system for non-Hodgkin’s lymphoma (NHL) therapy. The system is based on MSC homing capacity and scFvCD20 antigen-restriction to NHL. In this system, a novel secreted fusion protein scFvCD20-sTRAIL, which contains a CD20-specific single chain Fv antibody fragment (scFv) and a soluble tumor necrosis factor related apoptosisinducing ligand (sTRAIL, aa residues 114−281) with an isoleucine zipper (ISZ) added to the N-terminal (ISZ-sTRAIL), was expressed in human umbilical cord derived mesenchymal stem cells (HUMSCs) . When compared with ISZ-sTRAIL protein, the scFvCD20-sTRAIL fusion protein demonstrated a potent inhibition of cell proliferation in CD20-positive BJAB cells, moderate inhibition in Raji cells, weak inhibition in CD20-negtive Jurkat cells, and no effect on normal human peripheral blood mononuclear cells (PBMCs). The scFvCD20-sTRAIL fusion protein also caused significant increase of cellular apoptosis through both extrinsic and intrinsic apoptosis signaling pathways. Using a NOD/SCID mouse subcutaneous BJAB lymphoma xenograft model, the tropism of the firefly luciferase (fLuc) labeled MSC was monitored by bioluminescent imaging (BLI) for fLuc activity. Our study indicated that HUMSCs selectively migrated to the tumor site after 24 h of intravenous injection and mice injected with the MSC.scFvCD20-sTRAIL significantly inhibited the tumor growth when compared with those treated with MSC.ISZ-sTRAIL. The treatment was tolerated well in mice, as no obvious toxicities were observed. Our study has suggested that scFvCD20-sTRAIL secreting HUMSCs is a novel and efficient therapeutic approach for the treatment of non-Hodgkin’s lymphoma. KEYWORDS: mesenchymal stem cells, CD20, TRAIL, lymphoma, target therapy

■

INTRODUCTION More efforts should be taken to develop new strategies for nonHodgkin’s lymphoma (NHL) therapy as the incidence of NHL has risen dramatically in the past few decades. Moreover, a significant number of NHL patients who initially responded to traditional chemotherapies would have disease relapsed. CD20 antigen is the principal target for the immunotherapy of B-cell lymphomas.1,2 Its expression is restricted to B-cell precursors and mature B cells and is lost upon differentiation of B cells toward plasma cells.3,4 Although monoclonal anti-CD20 antibody (mAb) rituximab has markedly improved clinical response in NHL, it is inevitable that currently available antibody constructs are not perfect; about half of the B-cell lymphoma patients would develop resistance toward rituximab in the course of prolonged treatment. Therefore, novel strategies are in high demand for B-cell malignancy therapy. TNF related apoptosis-inducing ligand (TRAIL), a member of the tumor necrosis factor (TNF) superfamily, is a promising candidate for cancer therapy as it can induce apoptosis in a wide range of tumor cell lines, while sparing normal cells. TRAIL binds to five TNF receptor superfamily members.5 © 2012 American Chemical Society

Death receptor 4 (DR4) and death receptor 5 (DR5), both of which contain a cytoplasmic death domain, are capable of transducing an apoptotic signal when they bind to TRAIL. Decoy receptor 1 (DcR1) and decoy receptor 2 (DcR2) lack the ability to initiate an apoptotic signal and act as inhibitory receptors. As a type 2 transmembrane protein, TRAIL can be cleaved by specific proteases and the extracellular region forms a soluble molecule. Protein crystal structure studies revealed that soluble TRAIL (sTRAIL) forms a homotrimer which is a pivotal structure for receptor recognition and apoptotic function.6,7 Several groups have created such an artificial TRAIL gene that encodes a fusion protein ISZ-sTRAIL. This protein, which is composed of three functional elements, namely, a secretion signal, a trimerization domain, and an apoptosis-inducing moiety, has shown greater apoptotic activity than that without an additional trimerization domain.8−10 Received: Revised: Accepted: Published: 142

May 10, 2012 October 28, 2012 November 2, 2012 November 2, 2012 dx.doi.org/10.1021/mp300261e | Mol. Pharmaceutics 2013, 10, 142−151

Molecular Pharmaceutics

Article

of the VH and VL domains of the chimeric anti-CD20 Fab. The VH and VL sequences were genetically linked via a flexible peptide linker [(GGGGS)3]. A cDNA fragment encoding the extracellular domain (aa residues 114−281) of human sTRAIL was amplified from mRNA isolated from PBMCs by RT-PCR process. A fragment sequence ATGAAGCAGATCGAGGACAAAATTGAGGAA ATCCTGTCCAAGATTTACCACATCGAGAACGAGATCGCCCGGATTAAGAAACTCATTGGCGAGAGGGAA encoding the isoleucine zipper (ISZ)28 was genetically linked to the N-terminus of human sTRAIL (ISZsTRAIL) by PCR. The CopGFP sequence was amplified from the lentivirus expression vector pCDH1 (Cat. No. CD511A-1, System Biosciences, SBI, USA). The scFvCD20-sTRAIL sequence was amplified by two cycle overlap PCR in which the sequence of scFvCD20, CopGFP, and ISZ-sTRAIL was linked in turn by two peptide linkers. Likewise, either ISZ-sTRAIL or scFvCD20 fragment was linked with a CopGFP fragment by overlap PCR. Then the murine kappa light-chain leader peptide was genetically linked to the N-terminus of these four cDNA fragments scFvCD20-sTRAIL, ISZ-sTRAIL, scFvCD20, and CopGFP, and the corresponding restriction enzymes EcoRI (N-terminus) and NotI (C-terminus) were introduced. The luciferase sequence was amplified from pGL3 basic plasmid (Promega). Then, the cDNAs were cloned into lentivirus expression vector separately. All lentiviral packaging plasmids (Cat. No. LV100A-1, SBI, USA) and the lentivirus expression vector (Cat. No. CD511A-1, SBI, USA) were kindly provided by professor Ma Xiaotong (PUMC). The lentivirus expression vector was genetically modified (named pLentiR), in which the CopGFP sequence following EF1 promoter was replaced by RFP sequence. All constructed plasmids pLentiR.scFvCD20sTRAIL, pLentiR.ISZ-sTRAIL, pLentiR.scFvCD20, and pLentiR.CON (inserted CopGFP gene and used as a vector control) were confirmed by DNA sequence analysis (Invitrogen). Transient Transfection of 293T Cells. 293T cells were transfected with pLentiR.scFvCD20-sTRAIL, pLentiR.ISZsTRAIL, pLentiR.scFvCD20, or pLentiR.CON using lipofectamine 2000 (Invitrogen) according to the manufacturer’s standard protocol. After 48 h of transfection, cell supernatant was collected by centrifugation at 500g for 10 min at 4 °C to clear 293T cells and applied to in vitro studies. Production of Lentivirus. The lentivirus particles were produced by 293T cells according to the SBI protocol. Briefly, 3.75 × 106 293T cells were plated in a fresh 10-cm plate the day before transfection. Mixing 20 μL (10 μg) of the pPACK Packaging Plasmid Mix with 2 μg of lentivector expression construct and diluted into 400 μL of Opti-MEM (Gibco); diluting 30 μL of Lipofectamine 2000 Reagent with 400 μL of Opti-MEM at room temperature for 5 min. Diluted Lipofectamine 2000 was added into DNA complex, mixed gently by inversion, and incubated at room temperature for 20 min. Then the complex was added into the plate of 293T culture, and complexes were mixed with medium gently by inversion and incubated at 37 °C in a CO2 incubator overnight. Supernatants were collected at 48 h post-transfection. The lentiviruscontaining medium was spun at 500g for 5 min, filtered through a 0.45 μm pore size filter (Millipore), and used to infect HUMSCs immediately or stored at −80 °C. Transduction of HUMSCs. HUMSCs were plated at a density of 2 × 105 per well in a T-25 cm plastic culture flask and incubated overnight at 37 °C. On next day, medium was removed and 3 mL of appropriate fresh medium containing

Recombinant human sTRAIL displays a shot half-life (30−60 min) in vivo.11 mAbs over TRAIL represent a longer half-life (14−21days) but could increase potential side effects.12 Evidence has demonstrated that a combination of the recombinant human sTRAIL or mAb Mapatumumab targeting DR4 and rituximab augmented the antitumor activity against Bcell lymphoma.13−15 However, the efficacy of this cotreatment may be negatively affected by the widespread expression of TRAIL-receptors and differential binding affinities to agonistic receptors DR4 and DR5. Derivation of sTRAIL-producing mesenchymal stem cells (MSCs) may overcome these limitations.16−19 MSCs can be isolated from almost every type of tissue, such as bone marrow, adipose tissue, muscle, liver, placenta, or umbilical cord blood. It presents a particularly attractive tool for clinical use because they have tumor targeting properties, can be easily isolated and expanded to a large number for clinical use, can be genetically manipulated with viral vectors, and have low immunogenicity and intrinsic mutation rate.20−22 In addition, fusion of a sTRAIL to a tumor-specific single-chain Fv antibody fragment (scFv) has been shown to mediate an antigen-restricted apoptosis.23−25 The scFvCD20 was derived from a chimeric anti-CD20Fab fragment isolated from a hybridoma cell line we previously constructed, and the antigen binding activity was confirmed.26 To our knowledge, the fusion protein scFvCD20sTRAIL has not been reported so far. In this study, we designed a novel double-target anticancer system, in which the human umbilical cord derived MSCs (HUMSCs) were engineered to secrete the fusion protein scFvCD20-sTRAIL. Therapeutic potential against NHL of this system was evaluated in vitro as well as in vivo. Our results indicated that HUMSCs could migrate to the tumor site specifically and released scFvCD20-sTRAIL locally and constantly, which resulted in a concentrated scFvCD20sTRAIL at the tumor site and a promising therapeutic efficacy in an antigen-restricted manner.

■

EXPERIMENTAL SECTION HUMSC Preparation and Cell Culture. HUMSCs were isolated from the gelatinous Wharton’s jelly (WJ) of the human umbilical cord by methods previously described.27 HUMSCs were subcultured at a density of 4,000 cells/cm2 in DF-12 (Invitrogen) supplemented with 2 mmol/L L-glutamine and 10% FSC (Gibco). Passages 2−5 were used for the following experiments. The B-cell lymphoma lines BJAB and Raji (Institute of Hematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China) and PBMCs from healthy donors (provided by Dr. Cao Shannan, PUMC) were maintained in RPMI 1640 (Invitrogen) supplemented with 2 mmol/L Lglutamine, 100 units/mL penicillin (Hyclone), 100 μg/mL streptomycin (Hyclone) and 10% FCS. 293T cells (kindly presented by Professor Cheng Tao, PUMC) were maintained in DMEM (Invitrogen) supplemented with 2 mmol/L Lglutamine, 100 units/mL penicillin (Hyclone), 100 μg/mL streptomycin (Hyclone), and 10% FCS. Cells were incubated at 37 °C in a humidified atmosphere containing 5% CO2. Construction of Lentivirus Expression Vectors. The cDNA fragments scFvCD20-sTRAIL, ISZ-sTRAIL, scFvCD20, CopGFP, and luciferase gene were first amplified for incorporation into the lentivirus expression vector. The scFvCD20 sequence was generated by fusing VH CD20 and VL CD20 by overlap PCR technology using the sequence data 143

dx.doi.org/10.1021/mp300261e | Mol. Pharmaceutics 2013, 10, 142−151

Molecular Pharmaceutics

Article

lentivirus supernatants at MOI 8 and 8 μg/mL of Polybrene (Sigma) was added. The medium was removed after 8 h, and 10% FCS DF-12 medium was added. HUMSCs were incubated for another 48 h and observed under a fluorescence microscope. Western blot was used to determine the expression of desired genes 5 days after transduction. Western Blotting. Cells were lysed and protein was extracted using M-PER (Pierce, Rockford, IL, USA) plus protease inhibitor cocktail (Halt; Pierce). Protein concentrations were determined using BCA assay (Pierce). Aliquots of protein lysates were separated on SDS−polyacrylamide gels and transferred onto NC membrane, which was blocked with 5% blotting grade milk (Bio-Rad, Hercules, CA, USA) in PBST (0.1% Tween 20 in PBS). The membrane was then hybridized with the indicated primary antibodies to human Bcl-2, Bax, caspase-8, -9, and -3, and PARP followed by corresponding secondary antibodies conjugated with horseradish peroxidase, and then detected using a chemiluminescence assay (Millipore, Billerica, MA, USA). Membranes were exposed to X-ray film to visualize the bands. All Western blot primary and secondary antibodies were purchased from Cell Signal Technology. ELISA. sTRAIL in the culture supernatant of 293T cells transfected with plasmids or HUMSCs transduced with lentivirus were measured by a commercial TRAIL ELISA kit (R&D Systems) according to the manufacturer’s instructions. Cell Viability. Cells were plated into 96-well microplates (8 × 103 cells/well) and cultured overnight. Various concentrations of scFvCD20-sTRAIL or ISZ-sTRAIL obtained from transfected 293T cells were added into the culture medium. For blocking antigen-specific antitumor effect, BJAB cells were preincubated with anti-CD20 Fab for 1 h. The cell viability was assessed with CCK8 assay (Dojindo, Gaithersburg, MD) at 72 h after treatment. The absorbance of each well was measured at 450 nm with a synergy H4 microplate reader (synergy H4, BioTek, USA). Apoptosis Assay. Apoptosis was quantified using the Annexin-V-PE Kit (BD Bioscience, USA) as described by the manufacturer. Briefly, cells were grown in the 6-well plate and collected following treatment. Cells were stained by Annexin-VPE and 7-AAD and analyzed by BD LSRII flow cytometry. Animal Studies. All animal studies were performed in accordance with guidelines under the Animal Ethics Committee of the Institute of Hematology & Hospital of Blood Diseases, Chinese Academy of Medical Sciences & Peking Union Medical College. BJAB cells were washed and suspended in PBS. 1 × 107 cells were implanted subcutaneously into the right flank of each female NOD/SCID mice (5−6 weeks of age; PUMC) in a volume of 0.2 mL. One week later when tumor size reached 200−300 mm3, the mice were divided into six groups (5 mice/group) and treated with engineered HUMSCs intravenously via the tail vein as follows: (a) with 5 × 105 MSC.scFvCD20-sTRAIL; (b) with 5 × 105 MSC.ISZ-sTRAIL; (c) with 5 × 10 5 MSC.scFvCD20; (d) with 5 × 10 5 MSC.CON; (e) with 5 × 105 HUMSCs; (f) negative control with PBS. Tumor sizes were measured every 3 days in two dimensions using a caliper, and the volume was expressed in mm3 using the formula V = 0.5ab2 where a and b are the long and short diameters of the tumor, respectively. At day 24 after treatment started, mice were sacrificed. The tumor was dissected from each mouse and weighed. The level of serum liver enzymes alanine aminotransferase (ALT) and aspartate transaminase

(AST) was assessed by spectrophotometer (Nan Jing JianCheng Bioengineering Institute, China). Bioluminescence Imaging. When the subcutaneous BJAB tumor reached 200−300 mm3, HUMSCs labeled with fLuc (MSC.Lu) were iv injected. The migration of MSC.Lu in vivo was confirmed by BLI (IVIS-Xenogen 100 system; Caliper Lifesciences). Briefly, prior to imaging, mice were anesthetized by intraperitoneal administration of 100 μL of 20 mg/mL pentobarbital sodium. All mice received D-luciferin (15 mg/mL in PBS, Promega) at a dosage of 150 mg/kg ip 10 min prior to imaging. All images represented 5 min exposure time. Morphological Analysis and Apoptosis in Vivo. Animal specimens were fixed in 10% buffered-formalin solution and embedded in paraffin. For morphological analysis, 4 mm thick sections were cut from paraffin blocks and observed by laser scanning confocal microscope (TCS P2, Leisa, German). To detect apoptotic activity, TUNEL staining was done according to protocol (Beyotime Institute of Biotechnology, China). Statistical Analysis. Data are represented as mean ± SD. Differences between groups were examined for significant differences by ANOVA LSD or Dunnett post hoc procedure. Values of P < 0.05 were considered to be statistically significant and those of P < 0.01 were considered to be highly statistically significant.

■

RESULTS Expression Vectors Were Successfully Constructed. We successfully constructed the lentivirus expression vectors with different cDNA sequences inserted (Figure 1A). All

Figure 1. (A) Schematic representation of various DNA constructs employed in this study. All constructs contained a murine kappa lightchain leader peptide (signal peptide). The fragments in each construct were genetically linked via a flexible peptide linker. (B) ELISA measuring TRAIL released in the supernatant of 293T cells transfected with pLentiR.scFvCD20-sTRAIL or pLentiR.ISZ-sTRAIL 48 h later; no detectable amounts were released from 293T cells transfected with pLentiR.scFvCD20 or pLentiR.CON and untransfected cells. (C) Identification of trimeric scFvCD20-sTRAIL fusion protein. The lysis of 293T cells expressing the scFvCD20-sTRAIL protein was mixed with the sample buffer with or without BME (β-mercaptoethanol), fractionated on 10% SDS−PAGE gels, and detected by Western blot using anti-CopGFP antibody. 144

dx.doi.org/10.1021/mp300261e | Mol. Pharmaceutics 2013, 10, 142−151

Molecular Pharmaceutics

Article

Figure 2. Induction of CD20-restricted cell death by scFvCD20-sTRAIL. Cells were cultured (8 × 103 cells/well) overnight and exposed to supernatant from transfected 293T cells (A, B, C) or preincubated with anti-CD20 Fab (D). The supernatant contained different concentration of scFvCD20-sTRAIL and ISZ-sTRAIL that had been quantified by ELISA. Cell viability was assessed with CCK8 assay after 72 h of treatment. Three different experiments were repeated. (A) HUMSCs displayed resistance to either scFvCD20-sTRAIL or ISZ-sTRAIL. (B) ScFvCD20-sTRAIL induced potent, CD20-restricted inhibitory effect. ScFvCD20-sTRAIL exhibited superiority in inhibition of the growth of BAJB and Raji cells, but had reduced inhibitory effect on Jurkat cells when compared with ISZ-sTRAIL treatment. (C) scFvCD20-sTRAIL had no side effect on PBMCs. (D) Preincubation with anti-CD20 Fab (1 μg/mL) blocked scFvCD20-sTRAIL induced cell death. Control, the supernatant from 293T cells transfected with pLenR.CON (coding CopGFP gene). Columns, mean; bars, SD. *, P < 0.05; **, P < 0.01 compared with control. ☆, P < 0.05; ☆☆, P < 0.01 compared with ISZ-sTRAIL. ▲▲, P < 0.01 compared with scFvCD20-sTRAIL. All expriments were repeated three times.

2B, scFvCD20-sTRAIL induced potent cell death in CD20positive TRAIL-sensitive BJAB cells in a dose-dependent manner. The cell viability, which was 80.7%, 76.8%, and 56.8% when BJAB cells were treated with different concentrations of ISZ-sTRAIL, decreased to 65.2%, 49.2%, and 40.0% after correspondent concentrations of scFvCD20-sTRAIL treatment (p < 0.01). The growth of CD20-positive/TRAILresistant Raji cells was also slightly inhibited when treated with ScFvCD20-sTRAIL (p < 0.05 or 0.01, versus CON; p > 0.05, versus ISZ-sTRAIL). Similar treatment of CD20-negtive/ TRAIL-sensitive Jurkat cells resulted in the contrary result. ScFvCD20-sTRAIL induced less cell death compared with ISZsTRAIL; and the inhibitory effect kept a relatively low level in spite of the enhanced concentration of scFvCD20-sTRAIL. Furthermore, preincubation of BJAB cells with anti-CD20 Fab resulted in significant inhibition of scFvCD20-sTRAIL induced cell death (Figure 2D). To investigate potential unwanted cytotoxicity toward normal hematopoietic cells, PBMCs from healthy donors were exposed to scFvCD20-sTRAIL. The result indicated that treatment of PBMCs with scFvCD20-sTRAIL for 72 h did not induce any obvious inhibitory effect (p > 0.05) (Figure 3C). Apoptosis Was Induced by scFvCD20-sTRAIL. To verify the specific mechanism involved in scFvCD20-sTRAIL-induced cell death, further studies were proceeded. Apoptosis analysis by FACS showed that the percentage of apoptotic cells increased from 37.2 ± 1.4% when treated with ISZ-sTRAIL to 63.0 ± 3.5% after scFvCD20-sTRAIL treatment (Figure 3A). However, there was no obvious change in normal PBMCs after either treatment (Figure 3B). ScFvCD20-sTRAIL-mediated apoptosis involved both extrinsic and intrinsic apoptotic pathway. As shown in Figure 3C, the level of Bcl-2 protein

sTRAIL consisted of a sequence of 114−281 amino acids which was the secretary and functional fraction. An isoleucine zipper was added to the N-end of sTRAIL to promote the active trimerization of sTRAIL. All constructs were linked with signal peptides from murine kappa liget-chain leader peptide to facilitate secretion of target protein. To determine the expression capacity of these constructs, 293T cells were transfected transiently and visualized for CopGFP fluorescence (data n ot shown). 293T cells transfected with pLentR.scFvCD20-sTRAIL and pLentR.ISZ-sTRAIL expressed a high level of sTRAIL (pLentR.ScFvCD20-sTRAIL, 2529 ± 363 pg/mL; pLentR.ISZ-sTRAIL, 9475 ± 786 pg/mL), while the sTRAIL expression was not detectable in the other transfected or nontransfected 293T cells (Figure 1B). As shown in Figure 1C, nonreducing Western blot revealed that the scFvCD20-sTRAIL fusion protein was a tripolymer in the natural state. Since the tripolymer maintained its spatial structure in the whole process of SDS−PAGE electrophoresis, the band exposed at last appeared wider than normal. ScFvCD20-sTRAIL Induced Potent, CD20-Restricted Inhibitory Effect in Vitro. The specific anticancer effect of scFvCD20-sTRAIL from the supernatant of transfected 293T cell culture was tested in vitro. Since we would apply HUMSCs as vihicles to deliver scFvCD20-sTRAIL, the sensitivity of HUMSCs to the fusion protein was analyzed first. It revealed that HUMSCs displayed resistance to either scFvCD20sTRAIL or ISZ-sTRAIL (Figure 2A), which was consistent with a previous report that adult BM-derived MSCs showed very low or absence of apoptosis in the presence of recombinant TRAIL.29 Next, three cell lines with different level of CD20 expression and sensitivity to TRAIL were exposed to scFvCD20-sTRAIL respectively. As shown in Figure 145

dx.doi.org/10.1021/mp300261e | Mol. Pharmaceutics 2013, 10, 142−151

Molecular Pharmaceutics

Article

Figure 3. Induction of apoptosis by scFvCD20-sTRAIL in BJAB cells. (A, B) BJAB cells (A) and PBMCs from healthy donors (B) were treated with 1 ng/mL of scFvCD20-sTRAIL, ISZ-sTRAIL, or their correspondent supernatant from 293T cells containing scFvCD20 or CopGFP (CON). After 48 h of treatment, exposure of phosphatidylserine (PS) to the outer cell membrane was assessed by Annexin-PE/7-AAD. Percentages in the lower right quadrant (Q3) indicated early apoptotic cells. Histograms on the right exhibited the percentage of early and late apoptotic cells. Columns, mean; bars, SD. ▲▲, P < 0.01 compared with untreated. **, P < 0.01 compared with CopGFP. ☆☆, P < 0.01 compared with ISZ-sTRAIL. (C) BJAB cells were treated with 1 ng/mL of scFvCD20-sTRAIL, ISZ-sTRAIL, or corresponding 293T supernatant containing scFvCD20 or CopGFP for 24 h. Characteristic indicators of apoptosis participating in the extrinsic and intrinsic apoptotic pathway were revealed by Western blot. All experiments were repeated three times.

(MSC.scFvCD20-sTRAIL, 243.3 ± 12.8 pg/mL; MSC.ISZsTRAIL, 268 ± 25.5 pg/mL) (Figure 4C) Homing Property of HUMSCs to Established Subcutaneous Tumor. To monitor migration of HUMSCs in vivo, HUMSCs labeled with firefly luciferase (fLuc) reporter gene by lentivirus transduction were injected intravenously into NOD/ SCID mice with well-established BJAB sc tumors (5 × 105 HUMSCs each mouse). Representative bioluminescence images (BLI) of MSC.Lu ex vivo was analyzed at first (Figure 5A). The result suggested that fLuc reporter gene could be used to quantify transplanted HUMSCs in small living animals. Next, in an in vivo experiment, BLI revealed that MSC.Lu migrated and selectively accumulated at the tumor site at 24 h after injection (Figure 5B). Even after 24 days of iv injection, HUMSCs labeled with CopGFP could be observed in the paraffin sections from the tumor sites of mice under the confocal microscope (Figure 5C). MSC.scFvCD20-sTRAIL Exhibited Greater Antitumor Activity in Vivo. Next, we wanted to validate the superiority of MSC.scFvCD20-sTRAIL in vivo. When the tumor burden reached 200−300 mm3, HUMSCs enginneered with therapeutic genes were iv injected into NOD/SCID mice (5 × 105 cells/

expression decreased, while Bax expression increased; caspase8, -9, and -3 and PARP were cleaved and activated. All these changes were in a higher degree when BJAB cells were exposed with scFvCD20-sTRAIL than those when treated with ISZsTRAIL. HUMSCs Transduced with Lentivirus Expressed Desired Protein Efficiently. HUMSCs were transduced with lentivirus particles coding scFvCD20-sTRAIL, ISZsTRAIL, scFvCD20, or CopGFP (control) at MOI 8. To direct the expression of all target protein, CopGFP gene was fused into all the constructs. After 48 h of transduction, CopGFP fluorescence was observed in the cytoplasm (Figure 4A). The level of CopGFP protein expression was verified by Western blot at day 5 after transduction. As shown in Figure 4B, all the target genes fused with CopGFP were expressed by their respondent HUMSCs. Furthermore, we tested the desired protein released in the supernatant in culture of HUMSCs by ELISA. Both MSC.scFvCD20-sTRAIL and MSC.ISZ-sTRAIL constantly released the desired protein. The level of secreted protein achieved a peak at day 5 (MSC.scFvCD20-sTRAIL, 632.3 ± 64.7 pg/mL; MSC.ISZ-sTRAIL, 2075.4 ± 194.4 pg/ mL) and was detectable even at day 24 after transduction 146

dx.doi.org/10.1021/mp300261e | Mol. Pharmaceutics 2013, 10, 142−151

Molecular Pharmaceutics

Article

Figure 4. Transduced HUMSCs expressed desired protein efficiently. HUMSCs were transduced with lentivirus coding scFvCD20-sTRAIL, ISZsTRAIL, scFvCD20, or CopGFP at MOI 8 overnight. The next day, supernatant was removed and fresh medium culture was added. (A) The fluorescence of CopGFP was observed after 48 h of transduction. B, The protein expression of scFvCD20-sTRAIL, ISZ-sTRAIL, scFvCD20, and CopGFP in transduced HUMSCs was tested by Western blot using anti-CopGFP antibody after 5 days of transduction. The cDNA sequence of scFvCD20-sTRAIL, ISZ-sTRAIL, and scFvCD20 was genetically fused with CopGFP gene. (C) Transduced HUMSCs expressed the desired protein scFvCD20-sTRAIL or ISZ-sTRAIL constantly. MSC.scFvCD20:TRAIL and MSC.ISZ-TRAIL were cultured in a 24-well plate (4 × 104/well) in DF12 containing 2% FCS for 24 h. Then the level of sTRAIL released in culture was measured by ELISA at different time points.

Figure 5. Homing property of MSC.Lu to established subcutaneous tumor. (A) MSC.Lu expressed fLuc constitutively. (B) Tropism of HUMSCs to tumor site. MSC.Lu was iv injected into tumor bearing mice. After 24 h, the mice were anesthetized and received ip injection of D-luciferin at a dose of 150 μg of D-luciferin per gram of body weight. 10 min later, the BLI for fLuc activity was detected by Xenogen in vivo imaging system. (C) HUMSCs localized in tumor site for a long period. HUMSCs labeled with CopGFP were iv injected into tumor bearing mice. Twenty-four days later, the tumors were dissected from the sacrificed mice for paraffin sections and consequently observed under a confocal microscope. The white line amounted to 80 μm.

liver toxicity,30 we assessed the safety of the treatment by monitoring the serum level of ALT and AST. The serum was collected at day 24 after treatment, and no significant change of serum level of ALT and AST was observed between the treated groups and PBS group (p > 0.05, Figure 7D).

each mouse). As shown in Figure 6, when observed after 5 days of treatment, the fusion protein scFvCD20-sTRAIL secreted by HUMSCs accumulated in the tumor site and exhibited antitumor potential. Both MSC.scFvCD20-sTRAIL and MSC.ISZ-sTRAIL inhibited tumor growth early at 3 days after injection, and this effect became extremely obvious in the following days. At day 24 after the beginning of treatment, extensive apoptosis took place in tumors of MSC.scFvCD20sTRAIL-treated mice (Figure 7A). 65% tumor regression was observed in the MSC.scFvCD20-sTRAIL-treated group, and 42.7% of tumor regression in the MSC.ISZ-sTRAIL-treated group. MSC.scFvCD20-sTRAIL exhibited greater antitumor potential than that of MSC.ISZ-sTRAIL (P < 0.05). In contrast, there was no detectable difference in tumor size among MSC.scFvCD20-, MSC.CON-, and PBS-treated groups (p > 0.05) (Figure 7B,C). Because TRAIL exposure could induce

■

DISCUSSION Over the past decade, an increased understanding of pathogenic mechanisms and rapid development of gene engineering technologies has provided new targets and strategies for cancer therapy. Here we describe a novel double-target approach for B-cell lymphoma therapy using recombinant scFvCD20sTRAIL fusion protein secreting HUMSCs. This double-target therapeutic system, in which HUMSCs delivers scFvCD20sTRAIL to tumor site specifically and efficiently, results in considerable antigen-restricted apoptosis, exhibits powerful 147

dx.doi.org/10.1021/mp300261e | Mol. Pharmaceutics 2013, 10, 142−151

Molecular Pharmaceutics

Article

Figure 6. The fusion protein scFvCD20-sTRAIL was delivered to tumor sites by MSC.scFvCD20-sTRAIL in vivo. The tumors were dissected from the sacrificed mice for paraffin sections after 5 days of MSC.scFvCD20-sTRAIL iv injection. The distribution of fusion protein scFvCD20-sTRAIL in tumor was observed under a confocal microscope by CopGFP fluorescence. The white line amounted to 80 μm (upper row) and 20 μm (lower row) respectively.

similarities in microenvironment. 13 We confirmed that HUMSCs migrated to the subcutaneous BJAB tumor site after systemic administration though a part of them could be trapped in lung. The exact process and factors underlining the migration of MSCs to tumor sites is not clear. Two possible mechanisms have been proposed:39 one is that the released chemokines/cytokines increase the migration of MSCs;39 the other one is that the interaction of cytokines or chemokines with their corresponding receptors would induce the migration of MSCs toward the tumor microenvironment.38 As a result, to develop a specific and potent inhibitor for Bcell lymphoma therapy, we designed engineered HUMSCs secreting a fusion protein scFvCD20-sTRAIL. The in vitro studies proved that scFvCD20-sTRAIL fusion protein showed a powerful antitumor activity on CD20-positive B-lymphoma, which is consistent with a series of scFv-sTRAIL fusion protein for targeted cancer therapy as previous reported.24,25 With the characteristics of CD20 restriction and enhanced apoptotic inducing capability, scFvCD20-sTRAIL exhibited greater inhibitory effect on the growth of CD20-positive BJAB and Raji cells when compared with ISZ-sTRAIL treatment alone. As antibody−antigen binding has fast on/slow off rates that are typical for antibody and derivative theory, scFvCD20-sTRAIL can accumulate on the cell surface by the specific binding to CD20. This contributes to stabilization of sTRAIL domainTRAIL receptor binding, which has very fast on/fast off binding rates typical for cytokine−cytokine receptor binding. Meanwhile, ISZ-sTRAIL domain favors formation of a monotrimer. The trimeric scFvCD20-sTRAIL contains three scFv, which enhances binding avidity to CD20-positive cells. Therefore, sTRAIL−TRAIL receptor binding is strengthened further and the apoptotic signal induced by sTRAIL is augmented. Both extrinsic and intrinsic apoptosis were induced with changes of Bcl-2 and Bax level as well as cleavage and activity of caspases.

anticancer potential, and avoids any detectable toxicity to normal cells and tissues. To our knowledge, it is the first report using such a double-target system of engineered MSCs for cancer therapy. Marrow, adipose, and umbilical cord blood derived MSCs as vehicles for gene therapy were widely studied in the past decade. Human umbilical cord WJ derived MSCs are not controversial. They can be harvested in abundance, they have many unique properties including high proliferation rates, wide multipotency, and hypoimmunogenicity, they are not teratoma inducing, and their stemness is retained even for a long culture time in vitro (9−10 passages). All these advantages make these cells an attractive and safe source of vehicles in target therapy. In this study, we have generated scFvCD20-sTRAIL secreting HUMSCs against NHL. The contribution of MSCs to tumor growth is arguable, which may be due to variable reasons including the ratio of each cell population in animal models, the location of the lesion, alternative administration route, and other factors.31−33 Nevertheless, in our study, no tumor stimulation activity was found by injection of 5 × 105 HUMSCs into well-established BJAB lymphoma-bearing NOD/SCID mice. This is supported by the findings that HUMSCs express high level proapoptotic and tumor suppressor genes,34 have the properties of nontumorigenicity35 or antitumorigenincity,36 and are unable to transform into tumor-associated fibroblasts (TAFs).37 Long-term culture of marrow derived MSCs is accompanied by the loss of chemokine receptors and a decrease in adhesion molecule expression.38 We used HUMSCs in the 3−5 passages for all experiments and did not observe noticeable changes in morphology as well as proliferation. The phenotype, migration related gene expression, and functional assays of HUMSCs should be emphasized after long-term and abundant culture in further studies. The shared tropism of MSCs in sites of an injured tissue and tumor is thought to result from the 148

dx.doi.org/10.1021/mp300261e | Mol. Pharmaceutics 2013, 10, 142−151

Molecular Pharmaceutics

Article

Figure 7. Effect of MSC.scFvCD20-sTRAIL on transplanted tumor. Engineered HUMSCs (5 × 105 cells) or PBS were given iv to BJAB-bearing mice once at day 7 after BJAB (1 × 107 cells) implantation (tumor reached 200−300 mm3). Mice were sacrificed after 24 days of the beginning treatment. (A) Apoptosis in tumor was analyzed by TUNEL. (B) Tumor size was measured every 3 days after HUMSC treatment. (C) Tumor weights after 24 days of treatment. (D) Safety of engineered HUMSC infusion. Serum transaminase (AST-ALT) level in mice was detected at day 24. No significant changes of serum level of ALT and AST between treated groups and PBS group were detected (p > 0.05). MSC.CON represented HUMSC transduced CopGFP gene by lentivirus. Columns, mean; bars, SD. **, p < 0.01 compared with PBS group. ☆, p < 0.05 compared with MSC.ISZ-sTRAIL-treated group.

Jurkat cells showed much lower response to scFvCD20-sTRAIL compared with ISZ-sTRAIL. The reduced sensitivity of Jurkat to scFvCD20-sTRAIL resulted from CD20-specific action and the exact mechanisms need to be explored further in the future. Lentivirus transduced HUMSCs were capable of constantly producing the desired proteins for a long term. Even though the level of scFvCD20-sTRAIL secreted by MSC.scFvCD20sTRAIL was much lower than that of ISZ-sTRAIL from MSC.ISZ-sTRAIL, owing to the larger inserted cDNA sequence, the potential antitumor effect of MSC.scFvCD20sTRAIL was not influenced. This was attributed to the double-

Previous studies indicated that neither treatment of CD19negtive T-ALL cell line CEM with scFvCD19-sTRAIL nor treatment of CD33-negtive T-ALL cell line MOLT-16 with scFvCD33-sTRAIL could cause cell death; and preincubation with parental CD19- or CD33-specific antibodies or using nontarget scFv-sTRAIL fusion protein instead of scFvCD19sTRAIL strongly inhibited cell death induced by scFvCD19sTRAIL or scFvCD33-sTRAIL in CD19- or CD33-positive cells.24,25 It was consistent with our finding that the cell death of CD20-positive BJAB cells was inhibited when proincubated with CD20 specific Fab, and CD20-negtive/TRAIL-sensitive 149

dx.doi.org/10.1021/mp300261e | Mol. Pharmaceutics 2013, 10, 142−151

Molecular Pharmaceutics

Article

E. B cell origin of non-T cell acute lymphoblastic leukemia. A model for discrete stages of neoplastic and normal pre-B cell differentiation. J. Clin. Invest. 1984, 74, 332−340. (5) Wiezorek, J.; Holland, P.; Graves, J. Death receptor agonists as a targeted therapy for cancer. Clin. Cancer Res. 2010, 16, 1701−1708. (6) Cha, S. S.; Shin, H. C.; Choi, K. Y.; Oh, B. H. Expression, purification and crystallization of recombinant human TRAI. Acta Crystallogr. 1999, 55, 1101−1104. (7) Ashkenazi, A.; Pai, R. C.; Fong, S.; Leung, S.; Lawrence, D. A.; Marsters, S. A.; Blackie, C.; Chang, L.; McMurtrey, A. E.; Hebert, A.; DeForge, L.; Koumenis, I. L.; Lewis, D.; Harris, L.; Bussiere, J.; Koeppen, H.; Shahrokh, Z.; Schwall, R. H. Safety and antitumor activity of recombinant soluble Apo2 ligand. J. Clin. Invest. 1999, 104, 155−162. (8) Kim, M. H.; Billiar, T. R.; Seol, D. W. The secretable form of trimeric TRAIL, a potent inducer of apoptosis. Biochem. Biophys. Res. Commun. 2004, 321, 930−935. (9) Kim, C. Y.; Jeong, M.; Mushiake, H.; Kim, B. M.; Kim, W. B.; Ko, J. P.; Kim, M. H.; Kim, M.; Kim, T. H.; Robbins, P. D.; Billiar, T. R.; Seol, D. W. Cancer gene therapy using a novel secretable trimeric TRAIL. Gene Ther. 2006, 13, 330−338. (10) Jeong, M.; Kwon, Y. S.; Park, S. H.; Kim, C. Y.; Jeun, S. S.; Song, K. W.; Ko, Y.; Robbins, P. D.; Billiar, T. R.; Kim, B. M.; Seol, D. W. Possible novel therapy for malignant gliomas with secretable trimeric TRAIL. PLoS One 2009, 4, e4545. (11) R. S. Herbst, M. D.; Ebbinghaus, S.; Gordon, M. S.; O’Dwyer, P.; Lieberman, G.; Ing, J.; Kurzrock, R.; Novotny, W.; Eckhardt, G. A phase I safety and pharmacokinetic (PK) study of recombinant Apo2L/TRAIL, an apoptosis inducing protein in patients with advanced cancer. J. Clin. Oncol. 2006, 24, 3013 abstract. (12) Takeda, K.; Kojima, Y.; Ikejima, K.; Harada, K.; Yamashina, S.; Okumura, K.; Aoyama, T.; Frese, S.; Ikeda, H.; Haynes, N. M.; Cretney, E.; Yagita, H.; Sueyoshi, N.; Sato, N.; Nakanuma, Y.; Smyth, M. J. Death receptor 5 mediated-apoptosis contributes to cholestatic liver disease. Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 10895−10900. (13) Daniel, D.; Yang, B.; Lawrence, D. A.; Totpal, K.; Balter, I.; Lee, W. P.; Gogineni, A.; Cole, M. J.; Yee, S. F.; Ross, S.; Ashkenazi, A. Cooperation of the proapoptotic receptor agonist rhApo2L/TRAIL with the CD20 antibody rituximab against non-Hodgkin lymphoma xenografts. Blood 2007, 110, 4037−4046. (14) Vega, M. I.; Baritaki, S.; Huerta-Yepez, S.; Martinez-Paniagua, M. A.; Bonavida, B. A potential mechanism of rituximab-induced inhibition of tumor growth through its sensitization to tumor necrosis factor-related apoptosis-inducing ligand-expressing host cytotoxic cells. Leuk. Lymphoma 2011, 52, 108−121. (15) Maddipatla, S.; Hernandez-Ilizaliturri, F. J.; Knight, J.; Czuczman, M. S. Augmented antitumor activity against B-cell lymphoma by a combination of monoclonal antibodies targeting TRAIL-R1 and CD20. Clin. Cancer Res. 2007, 13, 4556−4564. (16) Loebinger, M. R.; Eddaoudi, A.; Davies, D.; Janes, S. M. Mesenchymal stem cell delivery of TRAIL can eliminate metastatic cancer. Cancer Res. 2009, 69, 4134−4142. (17) Kim, S. M.; Lim, J. Y.; Park, S. I.; Jeong, C. H.; Oh, J. H.; Jeong, M.; Oh, W.; Park, S. H.; Sung, Y. C.; Jeun, S. S. Gene therapy using TRAIL-secreting human umbilical cord blood-derived mesenchymal stem cells against intracranial glioma. Cancer Res. 2008, 68, 9614− 9623. (18) Grisendi, G.; Bussolari, R.; Cafarelli, L.; Petak, I.; Rasini, V.; Veronesi, E.; De. Santis, G.; Spano, C.; Tagliazzucchi, M.; Barti-Juhasz, H.; Scarabelli, L.; Bambi, F.; Frassoldati, A.; Rossi, G.; Casali, C.; Morandi, U.; Horwitz, E. M.; Paolucci, P.; Conte, P.; Dominici, M. Adipose-derived mesenchymal stem cells as stable source of tumor necrosis factor-related apoptosis-inducing ligand delivery for cancer therapy. Cancer Res. 2010, 70, 3718−3729. (19) Choi, S. A.; Hwang, S. K.; Wang, K. C.; Cho, B. K.; Phi, J. H.; Lee, J. Y.; Jung, H. W.; Lee, D. H.; Kim, S. K. Therapeutic efficacy and safety of TRAIL-producing human adipose tissue-derived mesenchymal stem cells against experimental brainstem glioma. Neuro-Oncology 2011, 13, 61−69.

target system, in which, on the one hand, HUMSCs targeted to tumor site and released the fusion protein constantly and, on the other hand, local concentrated scFvCD20-sTRAIL accumulated in the CD20-positive tumor and exhibited robust specific toxicity to tumor cells. As a result, the size of tumor in MSC.scFvCD20-sTRAIL-treated mice was smaller than that of MSC.ISZ-sTRAIL-treated mice in all time points after treatment and the significant difference exhibited at last. Meanwhile, no changes of live enzymes as well as weight were found among all groups and no toxicity to the growth of PBMCs in vitro, which indicated a good safety profile with this double-target system for cancer therapy. In conclusion, we have developed, for the first time, a doubletarget tumor therapeutic system, which utilizes HUMSCs, which migrate to the tumor site, secrete a novel fusion protein scFvCD20-sTRAIL, and result in locally concentrated scFvCD20-sTRAIL to extend antigen-restricted antitumor activity. Our system has shown a potent inhibiting effect on tumor growth in BJAB lymphoma and may motivate the clinical application of MSC-based cancer therapy in the future.

■

AUTHOR INFORMATION

Corresponding Author

*Institute of Hematology & Hospital of Blood Diseases, Chinese Academy of Medical Sciences & Peking Union Medical College, Department of Pharmacy, Chinese Academy of Medical Sciences, Institute of Hematology, Tianjin 300020, P. R. China; phone, (0086) 02223909076; (0086) 02223909404; e-mail, [email protected], [email protected]. cn. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by grants from the Chinese National Natural Sciences Foundation (Grant No. 30873091, 30971291), National High-tech R&D Program of China (863 program grant 2011AA020118) and the Natural Sciences Foundation of Tianjin, People’s Republic of China (No. 05YFGZGX02800).We thank Yu-Jiao Jia and Ya-Hui Ding for excellent technical help and Dr. Changnian Liu for critical reading of the manuscript.

■

ABBREVIATIONS USED MSC, mesenchymal stem cell; TRAIL, necrosis factor related apoptosis-inducing ligand; ISZ, isoleucine zipper; PBMC, peripheral blood mononuclear cells; fLuc, firefly luciferase; BLI, bioluminescent imaging; NHL, non-Hodgkin’s lymphoma; DR, death receptor; DcR, decoy receptor; BME, βmercaptoethanol

■

REFERENCES

(1) Van, M. T.; Hagenbeek, A. CD20-targeted therapy: a breakthrough in the treatment of non-Hodgkin’s lymphoma. Neth. J. Med. 2009, 67, 251−259. (2) Cragg, M. S.; Glennie, M. J. Antibody specificity controls in vivo effector mechanisms of anti-CD20 reagents. Blood 2004, 103, 2738− 2743. (3) Stashenko, P.; Nadler, L. M.; Hardy, R.; Schlossman, S. F. Characterization of a human B lymphocyte-specific antigen. J. Immunol. 1980, 125, 1678−1685. (4) Nadler, L. M.; Korsmeyer, S. J.; Anderson, K. C.; Boyd, A. W.; Slaughenhoupt, B.; Park, E.; Jensen, J.; Coral, F.; Mayer, R. J.; Sallan, S. 150

dx.doi.org/10.1021/mp300261e | Mol. Pharmaceutics 2013, 10, 142−151

Molecular Pharmaceutics

Article

cell (hWJSC) extracts inhibit cancer cell growth in vitro. J. Cell. Biochem. 2012, 113, 2027−2039. (37) Subramanian, A.; Shu-Uin, G.; Kae-Siang, N.; Gauthaman, K.; Biswas, A.; Choolani, M.; Bongso, A.; Chui-Yee, F. Human umbilical cord Wharton’s jelly mesenchymal stem cells do not transform to tumor-associated fibroblasts in the presence of breast and ovarian cancer cells unlike bone marrow mesenchymal stem cells. J. Cell. Biochem. 2012, 113, 1886−1895. (38) Honczarenko, M.; Le, Y.; Swierkowski, M.; Ghiran, I.; Glodek, A. M.; Silberstein, L. E. Human bone marrow stromal cells express a distinct set of biologically functional chemokine receptors. Stem Cells 2006, 24, 1030−1041. (39) Kosztowski, T.; Zaidi, H. A.; Quinones-Hinojosa, A. Applications of neural and mesenchymal stem cells in the treatment of gliomas. Expert Rev. Anticancer Ther. 2009, 9, 597−612.

(20) Vilalta, M.; Degano, I. R.; Bago, J.; Gould, D.; Santos, M.; Garcia-Arranz, M.; Ayats, R.; Fuster, C.; Chernajovsky, Y.; GarciaOlmo, D.; Rubio, N.; Blanco, J. Biodistribution, long-term survival, and safety of human adipose tissue-derived mesenchymal stem cells transplanted in nude mice by high sensitivity non-invasive bioluminescence imaging. Stem Cells Dev. 2008, 17, 993−1003. (21) Dvorak, H. F. Tumors: wounds that do not heal. Similarities between tumor stroma generation and wound healing. N. Engl. J. Med. 1986, 315, 1650−1659. (22) Gotherstrom, C.; Ringden, O.; Tammik, C.; Zetterberg, E.; Westgren, M.; Le Blanc, K. Immunologic properties of human fetal mesenchymal stem cells. Am. J. Obstet. Gynecol. 2004, 190, 239−245. (23) Helfrich, W.; Haisma, H. J.; Magdolen, V.; Luther, T.; Bom, V. J.; Westra, J.; V. D. Hoeven, R.; Kroesen, B. J.; Molema, G.; de. Leij, L. A rapid and versatile method for harnessing scFv antibody fragments with various biological effector functions. J. Immunol. Methods 2000, 237, 131−145. (24) Bremer, E.; Kuijlen, J.; Samplonius, D.; Walczak, H.; de. Leij, L.; Helfrich, W. Target cell-restricted and -enhanced apoptosis induction by a scFv:sTRAIL fusion protein with specificity for the pancarcinomaassociated antigen EGP2. Int. J. Cancer 2004, 109, 281−290. (25) Bremer, E.; Samplonius, D. F.; Peipp, M.; van Genne, L.; Kroesen, B. J.; Fey, G. H.; Gramatzki, M.; de. Leij, L. F.; Helfrich, W. Target cell-restricted apoptosis induction of acute leukemic T cells by a recombinant tumor necrosis factor-related apoptosis-inducing ligand fusion protein with specificity for human CD7. Cancer Res. 2005, 65, 3380−3388. (26) Xiong, D. S.; Zheng, M. J.; Liu, Y. X.; Xu, Y. F.; Wang, J. H.; Yang, C. Z. [High level expression of chimeric antibody fragment F(ab’)2 directed against CD20 in Escherichia coli]. Shengwu Gongcheng Xuebao 2004, 20, 673−678. (27) Ma, L.; Feng, X. Y.; Cui, B. L.; Law, F.; Jiang, X. W.; Yang, L. Y.; Xie, Q. D.; Huang, T. H. Human umbilical cord Wharton’s Jellyderived mesenchymal stem cells differentiation into nerve-like cells. Chin. Med. J. (Engl.) 2005, 118, 1987−1993. (28) Harbury, P. B.; Zhang, T.; Kim, P. S.; Alber, T. A switch between two-, three-, and four-stranded coiled coils in GCN4 leucine zipper mutants. Science 1993, 262, 1401−1407. (29) Secchiero, P.; Melloni, E.; Corallini, F.; Beltrami, A. P.; Alviano, F.; Milani, D.; D’Aurizio, F.; di Iasio, M. G.; Cesselli, D.; Bagnara, G. P.; Zauli, G. Tumor necrosis factor-related apoptosis-inducing ligand promotes migration of human bone marrow multipotent stromal cells. Stem Cells 2008, 26, 2955−2963. (30) Jo, M.; Kim, T. H.; Seol, D. W.; Esplen, J. E.; Dorko, K.; Billiar, T. R.; Strom, S. C. Apoptosis induced in normal human hepatocytes by tumor necrosis factor-related apoptosis-inducing ligand. Nat. Med. 2000, 6, 564−567. (31) Maestroni, G. J.; Hertens, E.; Galli, P. Factor(s) from nonmacrophage bone marrow stromal cells inhibit Lewis lung carcinoma and B16 melanoma growth in mice. Cell. Mol. Life Sci. 1999, 55, 663−667. (32) Djouad, F.; Bony, C.; Apparailly, F.; Louis-Plence, P.; Jorgensen, C.; Noel, D. Earlier onset of syngeneic tumors in the presence of mesenchymal stem cells. Transplantation 2006, 82, 1060−1066. (33) Roorda, B. D.; Elst, A.; Boer, T. G.; Kamps, W. A.; de Bont, E. S. Mesenchymal stem cells contribute to tumor cell proliferation by direct cell-cell contact interactions. Cancer Invest. 2010, 28, 526−534. (34) Fong, C. Y.; Chak, L. L.; Biswas, A.; Tan, J. H.; Gauthaman, K.; Chan, W. K.; Bongso, A. Human Wharton’s jelly stem cells have unique transcriptome profiles compared to human embryonic stem cells and other mesenchymal stem cells. Stem Cell Rev. 2011, 7, 1−16. (35) Gauthaman, K.; Fong, C. Y.; Suganya, C. A.; Subramanian, A.; Biswas, A.; Choolani, M.; Bongso, A. Extra-embryonic human Wharton’s jelly stem cells do not induce tumorigenesis, unlike human embryonic stem cells. Reprod. Biomed. Online 2012, 24, 235− 246. (36) Gauthaman, K.; Yee, F. C.; Cheyyatraivendran, S.; Biswas, A.; Choolani, M.; Bongso, A. Human umbilical cord Wharton’s jelly stem 151

dx.doi.org/10.1021/mp300261e | Mol. Pharmaceutics 2013, 10, 142−151