Identification of Novel Pyruvate Dehydrogenase Kinase 1 (PDK1

Subscriber access provided by University of Sunderland

Article

Identification of novel pyruvate dehydrogenase kinase 1 (PDK1) inhibitors by kinase activity-based high throughput screening for anticancer therapeutics Wen Zhang, Xiaohui Hu, Harapriya Chakravarty, Zheng Yang, and Kin Yip Tam ACS Comb. Sci., Just Accepted Manuscript • DOI: 10.1021/acscombsci.8b00104 • Publication Date (Web): 16 Oct 2018 Downloaded from http://pubs.acs.org on October 19, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Combinatorial Science

Identification of novel pyruvate dehydrogenase kinase 1 (PDK1) inhibitors by kinase activity-based high throughput screening for anticancer therapeutics

Wen Zhang, Xiaohui Hu, Harapriya Chakravarty, Zheng Yang and Kin Yip Tam* Cancer Centre, Faculty of Health Sciences, University of Macau, Macau, China

*

Corresponding Author: Prof. Kin Yip Tam; Cancer Centre, Faculty of Health Sciences,

University of Macau, Taipa, Macau, China Phone: +853-88224988; Fax: +853-88222314; E-mail: [email protected]

ACS Paragon Plus Environment

ACS Combinatorial Science 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Warburg effect, a preference of aerobic glycolysis for energy production even in the presence of adequate oxygen, is one of the most prominent distinctions of cancer cells from their normal equivalents. Upregulated pyruvate dehydrogenase kinase 1 (PDK1) was found to dominate the pivotal switch from mitochondrial respiration to aerobic glycolysis by inactivating pyruvate dehydrogenase (PDH) in cancer cells. PDK1 inhibition may lead to an unfavorable environment for cancer cells, which presents an opportunity for anticancer therapy. However, up to now, only limited number of PDK1 inhibitors were reported. In this work, we reported our attempt to discover novel small molecules from a diverse chemical library containing 15,000 small molecules selected from the Chembridge™ screening library. We developed a kinase activity-based high throughput screening (HTS) assay for initial screening of PDK1 inhibitors. Seven PDK1 inhibitory compounds were identified with IC50 values range from 0.68 and 45.69 μM. Follow up evaluations on these compounds revealed good PDK1 binding affinity and anti-proliferative activities in cancer cell lines, with two novel hits (9 and 10) clearly outperformed others compounds in terms of PDK1 inhibition and the suppression of cancer cell proliferation. 9 and 10 may serve as new chemistry starting points for further structural modifications to improve the potency on PDK1 inhibition for anticancer treatment. Key words: cancer; Warburg effect; high throughput screening; pyruvate dehydrogenase kinase 1; small molecule inhibitors.


Page 2 of 36

Page 3 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Glucose metabolism provides most of the energy used by the human body. After glucose is metabolized to pyruvate by glycolytic enzymes, most cancer cells will transform about 85% of pyruvate to lactate in the cytoplasm for energy rather than metabolizing it via mitochondrial oxidative phosphorylation. This hallmark of cancer is known as aerobic glycolysis or the Warburg effect.1 Aberrant cellular metabolism is one of the most significant differences between cancer cells and normal cells. Although aerobic glycolysis is less efficient in producing adenosine triphosphate (ATP), this altered metabolic profile provides many advantages for tumorigenesis and cancer development.2 The metabolic switch from mitochondrial oxidative phosphorylation

to lactate fermentation facilitates

the synthesis of macromolecules, which are in demand due to the rapid proliferation of cancer cells.3 Moreover, the acidic microenvironment is due to increased lactate excretion which accelerates cancer cell invasion and promotes metastasis.4 As most tumor cells rely on this altered metabolism for growth and proliferation, treatment leading to the reversal of theWarburg effect might be an attractive therapeutic approcah for anticancer treatment.5 Indeed, a great deal of attention has paid to the identification of the central nodes in abnormal metabolic program that are crucial to establish and maintain the Warburg effect in cancer cells. Many studies have reported that pyruvate dehydrogenase kinase 1 (PDK1), which primarily regulates pyruvate dehydrogenase (PDH) activity by reversible phosphorylation of three serine residues, plays such a critical role 6. PDH links glycolysis with mitochondrial respiration via the irreversible decarboxylation of pyruvate to acetylCoA, which is the main substrate of the tricarboxylic acid (TCA) cycle. Inactivation of PDH reduces the aerobic oxidation of pyruvate and accordingly facilitates its reduction to



lactate.7 Therefore, PDK1 dominates a critical switch in the Warburg effect by regulating PDH. Overexpression of PDK1 was observed in various human cancers, such as gastric cancer,8 myeloma,9 renal cell carcinoma10 and melanoma.11 Collectively, targeting PDK1 represents a plausible anticancer therapeutic strategy to rekindle mitochondrial respiration and attenuate the glycolytic phenotype by reactivating PDH in cancer cells.12 Although some PDK1 inhibitors have been investigated for cancer therapy,13-15 DCA is the only one that has entered clinical trials. DCA showed some anticancer effects. However the potency and selectivity were poor which required high doses limiting its routine use in anticancer treatment. Moreover, clinical data indicated that long-term DCA treatment caused motor weakness and symptoms of demyelination.16 Little, if any, combinatorialstyle identification of PDK1 inhibitors has been undertaken. To this end, the search for novel small molecules that inhibit PDK1 with improved potency and specificity is imperative. Herein, we described our attempt to discover novel small molecules from a diverse chemical library containing 15,000 small molecules selected from the Chembridge™ screening library. A kinase activity-based high-throughput screening (HTS) assay was developed to identify PDK1 inhibitors. From these screening campaigns, we identified several classes of molecules that bind to PDK1 and reactivate PDH. We have shown that some of these small molecules exhibited antiproliferative activities in several cancer cell lines, which was shown to be due to PDK1 inhibition redirecting the metabolic switch from aerobic glycolysis to mitochondrial respiration. RESULTS AND DISCUSSION


Page 4 of 36

Page 5 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Preparation of recombinant PDK1. His6-tagged human PDK1 was produced in E. coli and purified with Ni-charged column by a fast flow liquid chromatograph system. The prepared recombinant PDK1 was confirmed by the Coomassie stained SDS-PAGE gel (Figure 1A).

Figure 1 Kinase-activity based high throughput screening for PDK1 inhibitors. (A) Purified PDK1 fractions evaluated by the Coomassie stained SDS-PAGE gel. (B) The luminescence of residual ATP in 384-well plate after the kinase reaction was carried out by the established HTS platform. The first column was the background control group with PDK1, peptide and no ATP. The second and the penultimate columns were negative control groups with PDK1, peptide and ATP. The last column was the positive control group with peptide and ATP and no PDK1. From the columns 3 to 22, library compounds were added, referred to as test groups. (C) Z’-factors of each plate in the HTS assays. The kinase activity-based HTS assay for every compound plate was repeated three times and the Z’-factors of each assay were shown. All of the Z’-factors were greater than 0.5, indicating that the developed HTS assay was sensitive and reproducible. (D) Luminescence of the PDK1 inhibitory compounds. In this assay, ATP, peptide and PDK1 were substituted with water. All the other procedures remained the same as in the established HTS assay. As shown here, the luminescence of the compounds was around 200. (E) The IC50 values of HTS compounds for inhibiting PDK1 kinase activity. The IC50 values of the inhibitory effects were calculated using GraphPad Prism. Data was presented as mean ± SD (n =6) and was representative of three independent experiments.

Development and optimization of PDK1 kinase activity assay. A kinase activity assay was developed to screen for active molecules in our compound library. The idea was based on the determination of the residual ATP in the kinase reaction upon the inhibition of PDK1



using the Promega Kinase-Glo kit. In the process of establishing the assay, the buffer system (Figure S-1 and S-2), reagent concentrations (Figure S-3 and S-4), reaction period (Figure S-5) and the dilution ratio of Kinase-Glo kit reagent (Figure S-6) were optimized to improve the Z'-factor. After several rounds of modification, the procedure was established and employed in HTS assay (Figure S-7). High throughput screening for PDK1 inhibitors. The inhibitory effects of 15,000 compounds at 10 μM were assessed against recombinant PDK1 by using the kinase activity assay. The luminescence of residual ATP in the 384-well plate after the kinase activity reaction was detected by the HTS system. The window between the positive and negative control groups was large enough and the luminescent signals in control wells were uniform, indicating that the HTS assay was suffuciently sensitive to pick up moderate to weak inhibitor (Figure 1B). With the established HTS system, the kinase assays of every 384well compound plate were repeated three times. The Z’-factors of all of the assays were greater than 0.5 and the average Z’-factor was 0.75 ± 0.06 (Figure 1C), indicating that the HTS assay was sensitive and reproducible. Twelve hits with significant inhibitory effects were selected from the compound library. The compound name and PDK1 inhibition rate at 10 μM were presented in Table 1. The compound structures were shown in Figure 2.


Page 6 of 36

Page 7 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


O N

O

O

O

Cl

OH O

Cl

Cl

O O

H3C

O

N O

N

O

O

Cl

HN

O

Cl

HO

CH3

NH

O

O

Cl

2

O O

Cl O

O N

N H

1

H3C

O

O 3

Br

OH

O

Cl

N O

N

N

S

N NH Cl

N H

Cl HO

OH

O

H3C

CH3

7

N

O

O O

CH3

6

O

O

S O

N N

S Br H3C

O

5

4

O O

N O

Cl

O

9

8 CH3

NH S

NH HN

S

O

CH3

O

HN

H3C O

O

N

NH

NH N S O O

S 10

O

11

Br

O N H HO

O

12

O S

O

N O

O HN

AZD7545

Cl

N H

CF3

HO

Figure 2 Chemical structures of the PDK1 inhibitors identified in this study and AZD7545.


ACS Combinatorial Science 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

Page 8 of 36

Table 1 ID number, name and inhibition rate of the PDK1 inhibitory compounds identified from the Chembridge™ library. The number in the current thesis, the ID number in the Chembridge™ compound library, the compound name and the PDK1 inhibition rate of small molecules were shown in the table. Inhibition rates were calculated with the equation: Inhibition rate (%) = (Luminescence of test group – Luminescence of negative control group)/(Luminescence of positive control group – Luminescence of negative control group) ⅹ 100%. The data was representative of three independent experiments (n = 6). Compounds

ID number in library

Compound name

Inhibition rate at 10 μM (%)

1

# 6773323

4,5-dichloro-2-{[(2,4-dichlorophenyl)amino]carbonyl}benzoic acid

36.08 ± 0.97

2

# 7078470

2-(5,6-dichloro-1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-4-nitrobenzoic acid

79.34 ± 5.62

3

# 7087458

2-(4-nitrophenyl)-2-oxoethyl 1H-indol-3-ylacetate

41.16 ± 2.10

4

# 7089730

2-(2,6-dimethylphenoxy)-N-(1,3-dioxo-2-phenyl-2,3-dihydro-1H-isoindol-4-yl)acetamide

45.56 ± 2.93

5

# 7089905

2-chloro-4-formyl-6-methoxyphenyl 4-chloro-3-nitrobenzoate

41.26 ± 2.73

6

# 7406086

7

# 7452326

8

# 7562576

4-chloro-2-{[4-(propionyloxy)benzoyl]amino}enzoic acid

39.88 ± 3.12

9

# 7618539

6-bromo-2-(2-methoxyphenyl)-4H-3,1-benzoxazin-4-one

45.07 ± 1.34

10

# 7785894

11

# 7956189

N-(3-methoxyphenyl)-2-[(phenylsulfonyl)amino]-5-pyrimidinecarboxamide

65.66 ± 2.27

12

# 7969198

5-bromo-2-({3-[(3-methylbenzoyl)amino]benzoyl}amino)benzoic acid

73.53 ± 5.45

5-(3-bromophenyl)-4-(2-furoyl)-3-hydroxy-1-(5-isopropyl-1,3,4-thiadiazol-2-yl)-1,5-dihydro-2H-pyrrol-2one 6-(3,5-dichloro-4-hydroxybenzylidene)-5-imino-2-[(2-phenoxyethyl)thio]-5,6-dihydro-7H[1,3,4]thiadiazolo[3,2-a]pyrimidin-7-one

ethyl 5-benzyl-2-[({2-[(cyclohexylamino)carbonothioyl]hydrazino}ccarbonothioyl)amino]-3thiophenecarboxylate


37.15 ± 1.12 42.87 ± 2.15

49.53 ± 1.94

Page 9 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Counter screening assays. The inhibitory effects of compounds on PDK1 were evaluated using the luminescence of residual ATP in the kinase activity system. To determine whether the compounds themselves had any influence on the luminescent signal, the luminescence of the PDK1 inhibitory compounds was measured. As shown in Figure 1D, the luminescence of all compounds in the buffer (without ATP) was about 200, much lower than the values of residual ATP in the reaction system (around 4 ⅹ 105 ~ 5 ⅹ 105) as measured in the screening assay. The results indicated that the effects of the compounds on the luminescent signal of ATP could be ignored in this study. IC50 determination of PDK1 inhibition. We then further assessed the half-maximal inhibitory concentration (IC50) of the 12 hit compounds against PDK1. In the HTS assay, to minimize reagent costs and washing steps, low concentrations of ATP and peptide were employed. In this manually performed assay, the procedures were modified. The final concentration of ATP was increased from the original 1 μM to 100 μM, and the substrate concentration was optimized from the previous 1 μM to 50 μM, i.e. a situation more similar to those found in physiological condition.17 At the same time, the reaction time was modified accordingly and the assay was terminated at 1.5 h (Figure S-8). As the ATP concentration around 100 μM was too high to be detected by the Kinase-Glo kit, the reaction system was diluted ten-fold with water before adding the diluted Kinase-Glo kit reagent. Seven compounds were characterized with IC50 values from 0.68 to 45.69 μM for inhibiting PDK1 (Figure 1E). We were not able to obtain reliable IC50 values for the other 5 hit compounds which was probably due to poor solubility.

9



Page 10 of 36

Binding affinities determined by Isothermal Titration Calorimetry (ITC). With the inhibitory effects on PDK1 kinase activity determined, we then investigated whether these compounds interacted directly with PDK1. In order to assess the physical relationship between the small molecules and the kinase, recombinant PDK1 was titrated into the compound solutions (due to the poor solubility of the compounds). The KD values indicated that these small molecules interact directly with PDK1 (Table 2). ITC analyses of all the inhibitory compounds were shown in Figure S-9. Table 2 Thermodynamic parameters of hit compounds binding to recombinant PDK1. Isothermal calorimetry was carried out by titrating 150 μM PDK1 to 10 μM compounds dissolved in protein buffer with 0.1% DMSO at 25°C. The data were processed with MicroCal-customized Origin7 software. The parameters were derived from the OneSites model with a fixed binding site number (N=1). KD was reciprocally calculated from KA. Compounds

KA, x104 M-1

KD, µM

ΔH, cal/mol

ΔS, cal/mol/deg

ΔG, cal/mol

1

1.64 ± 0.26

61.0

-13000 ± 1299

-24.2

-5788.4

2

6.07 ± 0.63

16.5

-2055 ± 108.8

15.1

-6554.8

3

1.37 ± 0.12

73.0

-6460 ± 450

-2.38

-5750.76

4

2.20 ± 0.32

45.5

-5385 ± 519.3

2.1

-6010.8

5

1.81 ± 0.20

55.2

-6690 ± 528.1

-2.59

-5918.18

6

12.4 ± 5.8

8.1

-3108 ± 57.9

13

-6982

7

12.1 ± 1.7

8.3

-2306 ± 127.4

15.6

-6954.8

8

6.28 ± 0.4

15.9

-2185 ± 69.96

14.7

-6565.6

9

16.1 ± 1.9

6.2

-5447 ± 225.2

5.86

-7193.28

10

2.62 ± 0.25

38.2

-11700 ± 730.2

-18.2

-6276.4

11

3.81 ± 0.25

26.2

-3770 ± 142.7

8.52

-6308.96

12 NT

*:

NA*

Binding model not applicable

Compounds inhibited cancer cell proliferation and viability. The inhibitory effects of the 12 hit compounds were then evaluated by the Alamar Blue assay in cancer cell lines from different tissues of the human body. In these cancer cells, several PDK1 inhibitors dramatically inhibited cell proliferation, especially 9 and 10. Compared with DCA at 10 10


Page 11 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mM, which inhibited proliferation by 15%, the inhibitory rates of 9 and 10 at 50 μM were mostly between 40% to 70% (Table 3). Next the IncuCyte ZOOM system was employed to monitor the growth of A549 cells after being treated with control, 10 mM DCA, 50 μM 9 and 10 for 72 h (Figure 3A). Meanwhile, the phase object confluences of A549 cells after exposure to different doses of 10 for 72 h were monitored and analyzed by the IncuCyte ZOOM (Figure 3B). It can be seen that 50 μM 9 and 10 strongly inhibited growth and proliferation of A549 cells. In addition, 10 dose-dependently inhibited colony formation in A549 cells (Figures 3C and 3D). IC50 values of 10 in inhibting cell viability were around 40 μM in a variety of cancer cell lines (Figure 3E). Poor solubility of 9 prevented us from getting reliable IC50 data. We have develped knockdown PDK1 NCIH1975 cells using shRNA lentiviral particles (Figure 3F). PDK1 knock-down compromized anti-cancer effect of 10, which suggested that PDK1 was a main target of 10 in inhibiting cancer cell viability and proliferation (Figure 3G and 3H). The inhibition rate of 10 on human embryonic kidney 293T cells was further evaluated. We was not able to obtain the IC50 value of 10 on this normal cell line due to its relatively low cytotoxic effect. The inhibition rate was only 8.37 ± 1.14 % for 10 at 100 μM.

11



Page 12 of 36

Figure 3 The compounds inhibited cancer cell proliferation and colony formation. Images of A549 cells treated with control, 10 mM DCA, 50 µM 9 and 50 µM 10 in 96-well plates for 72 h were taken by IncuCyte Zoom imaging system without invasion. (B) The phase object confluence of A549 cells after treatment with serial concentrations of 10 (5, 10, 25, 50 and 100 μM) for 72 h. Images of live cells were captured by IncuCyte Zoom and then confluence was analyzed automatically by the software. (C) Images of A549 cell colonies after treatment with control, 10 mM DCA and serial concentrations of 10 (10, 20 and 50 μM). In the colony formation assay, A549 cells were plated in 6well plates, cultured overnight and then treated with 10 for 72 h. Media were replaced by fresh ones every 3 days after treatment. Numbers of colonies with more than 50 cells were counted at the end of the experiment (D). (E) IC50 values of 10 in reducing cell proliferation and viability in different cancer cell lines. The cancer cells were treated with serial doses of 10 for 72 h. Cell viability of each group was assessed by alamar Blue assay and IC50 values were calculated by Graphpad Prism. (F) PDK1 knock-down cell line

was generated using PDK1 shRNA lentiviral particles. Western-blotting assay was employed to confirm the reduced PDK1 expression in the knock down cells. (G) Inhibition rates of PDK1 knock-down and control cells after treatment with 10, meanwhile IC50 values were compared in (H). The results were representative of three independent experiments. * P < 0.05, ** P < 0.01, *** P < 0.001, versus control group. Table 3 Biological evaluations of the PDK1 inhibitory compounds. The alamar Blue assay was performed to evaluate the biological activities of the HTS compounds in various cancer cell lines from different tissues of human body. 10 mM DCA was employed as the positive control. Cpds

Inhibitory rate (%) A549

HCT116

MIA PaCa-2

NCI-H1975

U251

DCA (10 mM)

21.10 ± 2.80

14.64 ± 2.70

15.53 ± 4.67

18.49 ± 3.26

12.47 ± 0.33

1

13.20 ± 1.08

-5.49 ± 0.99

14.83 ± 6.06

3.30 ± 1.08

-5.65 ± 2.92

2

-5.38 ± 1.31

-3.42 ± 2.46

-3.28 ± 5.50

2.76 ± 2.61

-11.72 ± 1.89

3

-0.54 ± 1.77

10.74 ± 1.23

54.01 ± 8.06 -19.29 ± 1.06

4

17.52 ± 2.84

5.12 ± 1.83

34.31 ± 5.19 -13.34 ± 1.03 17.93 ± 2.01

5

10.46 ± 3.12

3.73 ± 1.37

20.00 ± 12.58

6.64 ± 5.74

18.77 ± 2.15

6

5.71 ± 0.32

4.21 ± 1.02

8.14 ± 2.78

14.25 ± 1.11

21.89 ± 2.59

7

17.04 ± 4.29

3.77 ± 1.37

33.04 ± 8.10

3.48 ± 1.41

8.98 ± 1.24

8

13.66 ± 2.27

1.68 ± 1.46

25.11 ± 4.73

5.67 ± 0.58

6.31 ± 2.95

9

70.23 ± 9.48

74.28 ± 3.79

83.65 ± 2.12

53.72 ± 2.77

76.20 ± 2.49

10

61.80 ± 4.27

57.52 ± 3.04

68.58 ± 2.55

95.77 ± 0.40

63.59 ± 1.34

11

2.78 ± 1.86

-4.68 ± 1.73

3.37 ± 0.74

-15.23 ± 2.78 -5.80 ± 3.84

12

3.95 ± 2.29

6.38 ± 1.77

12.48 ± 2.56

-8.95 ± 0.50

7.40 ± 0.82

-7.09 ± 1.57

Compounds activated PDH and inhibited PDH phosphorylation. Next, a primary PDH enzymatic assay was employed to evaluate the effect of hits on dehydrogenase activation 12


Page 13 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


by PDK1 inhibition. Following Jackson’s report, a commercial porcine PDC containing PDK1 was used in the assay.18 Briefly, the enzymatic evaluation consisted of three steps. Firstly, intrinsic PDK1 activity was enhanced by the acetylation of PDH. After that, buffer (including ATP) was added to initiate the PDK1 kinase reaction. In this step, PDK1 catalyzed the phosphorylation of PDH in the presence or absence of PDK1 inhibitors. Finally, an NAD+-containing buffer was mixed and NADH generation was measured to evaluate the activity of PDH at 340 nm spectrophotometrically. The PDK1 inhibitors reactivated PDH significantly at 10 μM, particularly, 2, 6, 7, 9 and 10, outperformed DCA at 10 mM (Figure 4A). In order to verify that the stimulation of PDH activity occurred by inhibiting PDK1 directly, we quenched the reaction with 55 mM pyruvate and ADP before adding the HTS compounds. NADH generation was barely affected by the addition of PDK1 inhibitors right before dehydrogenation, indicating that 2, 6, 7, 9 and 10 had little effect on PDH (Figure 4B and 4C). This data suggested that these small molecules activated PDH by inhibiting PDK1 directly. In cancer cells, upregulated PDK1 principally restrained PDH activity by phosphorylating its three serine sites, among which Ser293 was the most important one. Small molecules targeting PDK1 would inhibit PDH phosphorylation and increase its activity. Here we investigated the influence of 9 and 10 on PDH phosphorylation levels in two different cancer cells. Relative to the control group, phosphorylation of PDH was significantly decreased in a dose-dependent manner after treatment with 9 and 10 in A549 cells (Figure 4D). A similar reduction in PDH phosphorylation was also observed in the HCT116 cell line (Figure 4E). It is noted that PDH expression in both of these cell lines was not affected 13



by the compounds. Taken together with the findings presented above, 9 and 10 inhibited cancer cell proliferation and viability by reactivating PDH through inhibiting PDK1 directly.

Figure 4 The compounds activated PDH and inhibited PDH phosphorylation (A) PDH activation rate of the 10 μM PDK1 hit compounds. 10 mM DCA was used as the positive control. (B, C) Effects of 10 µM 2, 6, 7, 9, 10 and 10 mM DCA on PDH kinetics. OD340 nm values were detected at 37 oC. ● represented maximal PDH activity in the absence of ATP (minimal PDK1 activity) and ■ indicated minimal PDH activity when 100 µM ATP was added. (D, E) 9 and 10 inhibited PDH phosphorylation in cancer cells. After treatment with serial concentrations of 9 and 10 for 12 h, protein samples were collected from A549 cells (D) and HCT116 cells (E). Western blotting was used to assess PDH and its phosphorylation level. α-tubulin was employed as a loading control.

Compounds altered mitochondria bioenergetics in cancer cells. After glucose was metabolized to pyruvate in cells, two processes could occur: (1) decarboxylation to acetylCoA by PDH, or (2) reduction to lactate by lactate dehydrogenase. Upregulated PDK1 has been reported to suppress PDH activity in different tumors. Therefore, PDK1 inhibitors would promote oxidative phosphorylation and decrease glycolysis in cancer cells. The Seahorse XFe24 platform was used to assess the cellular bioenergetic alterations in cancer cells after treatment with 9 and 10. The oxygen consumption rate (OCR) and extracellular acidification rate (ECAR), which indicated mitochondrial respiration and glycolytic 14


Page 14 of 36

Page 15 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


activity, respectively were measured. Compounds 9 and 10 evidently increased the OCR (Figure 5A and 5D) and decreased the ECAR dose-dependently (Figure 5B and 5E), indicating that both compounds, by inhibiting PDK1, facilitated the metabolism of pyruvate into TCA cycle and suppressed glycolysis. Moreover, the OCR/ECAR ratios were significantly improved in A549 cells (Figure 5C and 5F), suggesting the 9 and 10 diverted the metabolic pathway from glycolysis to mitochondrial respiration and led to cancer cells death.

Figure 5 The compounds altered mitochondrial bioenergetics in cancer cells. 9 and 10 increased OCR, decreased ECAR and improved OCR/ECAR ratio in A549 cells. Assessment of OCR (A, D) and ECAR (B, E) values in A549 cells after treatment with 9 and 10 for 12 h. The OCR/ECAR ratios (C, F) were calculated and cell viability were normalized at the end.

Compound 10 rectified the Warburg effect in cancer cells. In cancer cells, PDK1 inhibitors diverted pyruvate from aerobic glycolysis to oxidative phosphorylation through stimulating PDH and accordingly attenuated the Warburg effect. Here, in order to assess the metabolic profile, a LC-MS/MS method19 was employed to quantify endogenous metabolites in A549 cells after treatment with 10. Owing to the solubility issue, the detailed effects of 9 on metabolic intermediates were not investigated, although 9 seemed to be 15



better at rectifying the Warburg effect based on Seahorse data. As shown in Figure 6 and Table S-2, 10 did not exhibit a significant impact on glucose or pyruvate concentrations, indicating that 10 did not influence glucose uptake or glycolysis from glucose to pyruvate. Next, after treatment with 50 and 100 μM of 10, acetyl-CoA showed a dose-dependent increase in concentration (P < 0.05), which was the principal substrate for mitochondrial respiration. Moreover, similar significant increases were observed in the downstream intermediates of the TCA cycle, i.e. citrate, succinate, fumarate, malate and oxaloacetate, in A549 cells after treatment with serial doses of 10 for 12 h. It is noteworthy that 10 elevated every intermediate in the TCA cycle other than αketoglutarate, which remained at a comparable level in the four groups. It was speculated that glutamine, another carbon source in cancer cells, transformed into acetyl-CoA and compensated for this. Of note, relative to the control group, lactate concentrations declined dramatically in cells treated with 50 and 100 μM 10 (P < 0.05, Figure 6 and Table S-2). Meanwhile, a remarkable decrease was also found in lactate levels in the culture medium of 10 dosed cells (P < 0.05), indicating that 10 reduced lactate production in cancer cells. Collectively, 10 increased TCA cycle intermediate concentrations and decreased lactate levels in a dose-dependent manner. The LC-MS/MS data showed that 10, as a PDK1 inihibitor, inhibited cancer cell proliferation by rectifying the Warburg effect.

16


Page 16 of 36

Page 17 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6 Compound 10 increased TCA cycle intermediate production and decreased lactate formation. Measurement of intracellular glucose, pyruvate, acetyl-CoA, lactate, citrate, α-ketoglutarate, succinate, fumarate, malate and oxaloacetate concentrations as well as extracellular lactate production in A549 cells after treatment with 10 (20 μM, 50 μM and 100 μM) for 12 h. 10 dose-dependently increased TCA cycle intermediate production (other than α-ketoglutarate) and decreased lactate formation in A549 cells. Cell viability were normalized at last of the experiment. Data were presented as mean ± SD (n = 3) and representative of three independent experiments. * P < 0.05, ** P < 0.01, *** P < 0.001, versus control group.

Molecular modeling. Blind docking of 10 to PDK1 indicated that nine out of top ten conformations generated by Autodock vina were localized around the N-terminal lipoamide site. Swiss Dock likewise clearly indicated its preference for the same site. Swiss dock resulted in 256 binding models grouped in thirty five clusters. The top three minimum energy conformers were found to be localized in or around the N-terminal lipoamide site (Figure 7). Molecular dynamics (MD) simulation, of the minimum energy complex, was performed for a period of 30ns. The last 10ns of the simulation was analyzed for the 17



stability of the ligand in the protein ligand complex. 10 was found to be very stable, with an average RMSD of 0.768 Å, at the lipoamide binding site (Figure S-10). As shown in Figure 7, Ethyl 5-benzylthiophene-3-carboxylate moiety is buried inside the cavity, while, N-Cyclohexyl carbothioamide group is projected towards the surface. The latter is stabilized by several van der Waals interactions with Ser55, Pro56 and C-terminal Ile397. The molecule is anchored to this site by H-bonding formed between Gln61 with thioamide and thiophene group. Asp64 forms a pi-anion interaction with the phenyl ring which further helps to hold the molecule into the grove. Four small molecule binding sites in PDK1 have been identified, namely the pyruvate site, the lipoamide site, the nucleotide site and the allosteric site.15 Our modeling results suggested that 10 binds to the lipoamide site, which is the same binding site of a known PDK1 inhibitor, 13 (AZD7545, Figure 3). However, the binding mode was found to be different from that of 13. It has been reported that the hydroxyl group of 13 formed an Hbond with the conserved Ser75 in PDK1, with the trifluoromethylpropanamide group projected into the lipoamide site.20 Moreover, an extensive H-bonding network was formed involving a water molecule trapped inside the lipoamide binding pocket of PDK1, Phe62, Gln197, and the amide oxygen of 13.20 It is noted that 13 was developed for treating type II diabetes. The anticancer eﬀects of 13 were weak. According to our own data, 13 at a high concentration of 400 μM inhibited cancer cell growth by only about 10% (in three diﬀerent cancer cell lines)21 and did not alter the profiles of the TCA cycle intermediates.19 By comparing the moeities projecting into the lipoamide site, the ethyl 5-benzylthiophene-3-carboxylate group of 10 is apparently 18


Page 18 of 36

Page 19 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


more bulky than the trifluoromethylpropanamide group of 13. It is plausible that the differences in the molecular interactions between the projecting group and the lipoamide site might lead to the observed anticancer effects in 10. Undoubtedly, the rationalization of the binding mode of 10 opens up the possibility for future rational molecular design of more potent PDK1 inhibitors exhibiting anticancer effects.

Figure 7 Compound 10 bound to the lipoamide site of PDK1 (2Q8G). (A) 10 bound to the lipoamide site of PDK1 (2Q8G). (B) Enlarged image of the binding site. Gln61 involves in H-bonding with thioamide and thiophene group, while Asp64 participates in pi-anion interaction with the phenyl ring. N-cylcohexyl carbothioamide group is projected towards the surface stabilized by several Vander Walls interactions with Ser55, Pro56 and Leu5. Protein is shown in ribbon, 10 in ball and stick model and interacting residues in line representation.

CONCLUSIONS A kinase activity-based high-throughput screening assay for the identification of novel PDK1 inhibitors was validated. The developed method was sensitive and reproducible, with Z’-factor of around 0.75. The method was then applied to screen the Chembridge™ library consisting of 150,000 compounds, from which 12 compounds were found to inhibit PDK1 activity and reactivate PDH. Cancer cell assays indicated that two hits (9 and 10) inhibited cancer cell proliferation at the micromolar level by rekindling mitochondrial 19



respiration and suppressing glycolysis by inhibiting PDK1. Molecular docking and molecular dynamics simulation revealed that 10 bound to the lipoamide site of PDK1 with favorable interactions with several amino acid residues in close proximity to the active site. However the binding mode of 10 was found to be different from that of an anti-diabetic PDK inhibitor 13 suggesting the differences in binding modes might contribute to the dissimilar anticancer effects of these two compounds. We have shown that targeting PDK1 was a feasible and attractive approach for anticancer treatment while the novel chemical scaffolds of 9 and 10 may provide opportunities for future structural optimization. METHODS Preparation of recombinant PDK1. The sequence corresponding to human PDK1 amino acid number 29-436 was amplified from pDONR223-PDK1 (Addgene #23804) by DNA polymerase chain reaction (PCR) with primers (tacttccaatccaatgcatcggactcgggctcc and ttatccacttccaatgttattactaggcactgcggaac). Then the PCR product was inserted into the pET His6-tagged small ubiquitin modifier (SUMO) tobacco-etch virus (TEV) ligationindependent cloning (LIC) vector (Addgene #29659). DNA sequencing was used to confirm the total PDK1 sequence. The His6-tagged SUMO-PDK1 fusion protein was coexpressed with chaperonin coding plasmid pBB550 (Addgene #27396) in the Escherichia coli (E.coli) BL-21 cells.22 0.5 mM isopropyl thiogalactoside (IPTG) was employed to induce cells with OD600 values between 0.6 to 0.8 and allowed to grow overnight at 23 ° C. Harvested cells were disrupted by sonication. The resulting cell lysate was centrifuged and the supernatant was passed through a Ni-charged HiTrap IMAC column and HiLoad 16/600 superdex 200 column on an AKTA Avant150 fast flow liquid chromatograph 20


Page 20 of 36

Page 21 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


system. The collected fractions were assessed by SDS-PAGE and coomassie staining to confirm the purification results.20 Compound library. The diverse compound library consisted of about 15,000 compounds was selected from a collection of 191,157 synthetic compounds from the ChemBrdigeTM screening library. In the compound selection process, several criteria were adopted, which included molecular weight between 300 to 600, cLogP ≤ 6, H-bond acceptor ≤ 10, Hbond donor ≤ 5, tPSA ≤ 150 and bond count ≤ 12. This gave 117,771 compounds from which about 15,000 compounds were selected using the Diverse Compound Packer in the LICSS software23 with a Tanimoto cutoff value of 0.7 to ensure diversity. Dilution of library compounds. The 15,000 compounds purchased from Chembridge™ were prepared at concentrations of 10 mM in DMSO. A Biomek FXP liquid handling station was used to dilute library compounds in 384-well plates. After the first dilution, stock solutions were diluted with Tris-buffered saline (TBS) from 10 mM to 1 mM. Subsequently, the compound solutions were further diluted in TBS from 1 mM to 50 μM. High throughput screening development and implementation based on PDK1 kinase activity. The Kinase-Glo Luminescent Kinase Assay (Promega) was employed to assess PDK1 kinase activity. The kit evaluated kinase activity by detecting the amount of ATP remaining in the system after the reaction. To facilitate programming, a Biomek FXP liquid handling station was used to add kinase activity reaction ingredients as three separate components into 384-well opaque white plates: 3 μL pre-diluted library compounds (final concentration at 10 µM) or control; 4 μL ATP (1 μM) and 8 μL of the kinase mixture including recombinant PDK1 (2 μM), peptide (1 μM, amino acid sequence: 21



RYHGHSMSDP, a fragment corresponding to the sequence around Ser293 of the E1 subunit of PDH) and reaction buffer (Tris-HCl 25 mM, EDTA 1 mM, EGTA 0.5 mM, DTT 1 mM and MgCl2 5 mM). After overnight incubation in a humid incubator at 37 °C, 15 μL of the five-fold diluted Kinase-Glo kit reagent (a mixture of the equal amount of KinaseGlo Max Buffer and Kinase-Glo Max Substrate) was added. After shaking and incubating for another 10 min at room temperature in the dark, the plate was placed in a microplate reader for detection of the luminescent signal. The procedure of the HTS assay was summarized in Figure S-7. PDK1 activity was determined according to the formula (in which L is short for the average luminescence of the group): Percent inhibition (I%) = (Ltest well – Lnegative control group)/(Lpositive control group

– Lnegative

control group)

ⅹ 100%. The plate layout and group composition were

provided in Table S-1. The Z’-factor was calculated according to Equation 1, where the symbols μ and σ represented respectively the averages and standard deviations, while the subscripts p and n denoted the positive and negative controls, respectively. All of the assays were repeated three times to calculate total Z'-factor. Z -factor = 1 

3( p   n ) |  p  n |

Equation 1 Calculation of Z’-factor.

When the Z’-factor was between 0.5 and 1, it meant the assay was excellent. The assay was marginal when the Z’-factor was between 0 and 0.5.

Counter screening assays. The activity of potential PDK1 inhibitory compounds was confirmed manually in a 384-well plate with the same assay procedures as the HTS assay. Moreover, to investigate whether the compounds themselves had any influence on the 22


Page 22 of 36

Page 23 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


signal of the Kinase-Glo kit, the luminescence of the hits was also measured. In the counter screening assay, the PDK1, peptide and ATP in the system were replaced with H2O. The other reagents and procedures remained that same as the screening assay and Figure S-7. IC50 determinations for PDK1 inhibition. The half-maximal inhibitory concentration (IC50) of the hit compounds identified in high throughput screening was assessed manually. The kinase reaction mixture contained 2 µM PDK1, 50 µM peptide, 100 µM ATP and the desired concentrations of the PDK1 inhibitors, incubated together for 1.5 h at 37 °C. An equal amount of the five-fold diluted Kinase-Glo reagent was mixed with each sample. After incubation in the dark for another 10 min, the reaction system was diluted with water by ten-fold and luminescence was detected by a plate reader. The experiment was repeated for three times and the IC50 value of each compound was calculated by fitting luminescence values to a dose-response curve with Prism software. Binding studies by Isothermal Titration Calorimetry (ITC). The NanodropTM 2000 spectrophotometer (Thermo Scientific) was employed to measure the concentration of PDK1 protein by determining absorbance at 280 nM. The recombinant PDK1 was diluted to 150 μM and dialyzed in the buffer composed of 50 mM KH2PO4/K2HPO4, 250 mM KCl, 2 mM MgCl2 and pH was adjusted to 7.4. The hits identified from the primary kinase assay were prepared with concentrations at 10 μM in the protein buffer with 0.1% DMSO at 25 °C. The recombinant PDK1 was positioned in the titration syringe and the compound solution was positioned in the reaction cell. The increments were injected into the reaction cell in the micro calorimeter maintained at 25 °C. The Microcal iTC200 microcalorimeter (GE Healthcare) was used to detect the heat generated from the titrations of the protein into 23



ligands. The data were fit into the one-site model with MicroCal-customized Origin7 software. PDH primary enzymatic assay. PDH primary enzymatic assay was performed as previously described.24 In brief, 0.08 mg/mL pyruvate dehydrogenase complex (PDC) (Sigma 9014-20-4, including PDK1 and PDH) was incubated in PDC buffer (40 mM Mops, 30 mM KCl, 10 mM NaF, 2 mM dithiothreitol, 1.5 mM MgCl2, 0.5 mM EDTA, 0.25 mM acetyl-CoA, 0.05 mM NADH, pH = 7.2) at 37 °C for 40 min. Then, PDK1 inhibitors and ATP were added. PDC buffer containing 55 µM ADP and 100 µM ATP was used to dilute the mixture for 2.2-fold and then the reaction was initiated. After three minutes, the stopping buffer containing 55 mM ADP and 55 mM pyruvate was added to terminate the reaction. Then the buffer (120 mM Tris, 11 mM 2-mercaptoethanol, 2.2 mM thiamine pyrophosphate, 2.2 mM nicotinamide adenine dinucleotide (NAD+), 2.2 mM pyruvate, 1.1 mM CoA, 0.73 mM MgCl2, 0.61 mM EDTA) was mixed. At last, the residual PDH activity was assessed by the reduction of NAD+ to reduced nicotinamide adenine dinucleotide (NADH) at 340 nm with a microplate reader. Cell lines and cell culture experiments. Cell lines of A549, NCI-H1650 and NCI-H1975 were bought from American Type Culture Collection (ATCC, Manassas, VA). DLD-1, MIA PaCa-2 and PANC-1 cell lines were gifts from Prof. Henry Hang Fai KWOK (Faculty of Health Sciences, University of Macau, shorten as FHS, UM). HCT116 and RKO cell lines were gifts from Prof. Joong Sup SHIM (FHS, UM). MCF7 and VCaP cell lines were gifts from Prof. Edwin Chong Wing CHEUNG (FHS, UM). MDA-MB-231 cell line was a gift from Prof. Chuxia DENG (FHS, UM). T98G and U251 cell lines were gifts from Prof. 24


Page 24 of 36

Page 25 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Gang Li (FHS, UM). A549 cells were cultured in F-12K/DMEM 1:1. DLD1, HCT116, MDA-MB-231, MIA PaCa-2 and PANC-1 cells were cultured in DMEM. MCF7, RKO, T98G and U251 cells were cultured in EMEM. DLD1, NCI-H1650 and NCI-H1975 cells were cultured in RPMI-1640 medium. All media were supplied with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin for culture. Cells that grew exponentially were used for the experiments. Cancer cell proliferation and viability assay. Cell viabilities after treatment with PDK1 inhibitors were assessed by the alamarBlue assay. Briefly, suspensions of different cell lines were inoculated into 96-well plates. After incubation overnight, serial concentrations of PDK1 inhibitors or vehicle control were added. Three days later, the culture media were replaced with fresh ones containing alamarBlue reagent (Thermo Fisher). After another 4 h of incubation at 37 °C, the plates were submitted to a microplate reader for the measurement of fluorescence intensity (excitation at 560 and emission at 590 nm). The IncuCyte live-cell analysis system (Essen BioScience Company) was employed to monitor the growth of cancer cells after treatment with PDK1 inhibitors. Real-time cell images were taken every 2 h and the phase object confluences were analyzed automatically by the system. Colony formation assay. Anti-cancer effects of PDK1 inhibitors were evaluated with colony formation assay. A549 cells were cultured overnight in six-well plates with 300 cells every well, after which cells were refreshed with media containing serial concentrations of 10 for 3 days. After treatment, media were changed with fresh ones every 3 days. On the 16th day after cell seeding, the cell colonies were fixed with 95% ethanol 25



and then stained by 0.01% crystal violet. Colony clusters with more than 50 cells were counted as positive. PDK1 knock down cell line. After NCI-H1975 lung cancer cells were cultured in six-well plates overnight, control/PDK1 shRNA lentiviral particles together with polybrene were added. After another 24 h of incubation, media were replaced by fresh ones. The transfected cells were then separated and cultured in 96-well plates under puromycin selection. The stable colonies were picked out and amplified for further cell viability and proliferation assay. PDK1 expression level were evaluated by western-blotting assay. Analysis of PDH phosphorylation level by western blotting. Cancer cells were seeded in a six-well plate at a density of 2 ×105 cells/well and cultured overnight. After treatment with vehicle or serial concentrations of HTS compounds for 12 h, protein samples were collected with radioimmunoprecipitation assay (RIPA) buffer. Equal amounts of protein were loaded into an SDS-PAGE gel. After being separated by electrophoresis, protein samples were transferred to a nitrocellulose membrane (Millipore), blocked with 5% nonfat milk at room temperature for 1 h and incubated overnight with diluted primary antibodies (including phospho-S293 PDH, PDH and α-tubulin) in 3% BSA in cold room. Blots were then incubated with anti-rabbit or anti-mouse secondary antibody conjugated with HRP in 5% non-fat milk at room temperature for 1 h. Pierce™ ECL Western Blotting Substrate (Thermo) was applied on the blots and the chemiluminescent signals were captured with a ChemiDocMP imaging system (Bio-Rad). Oxygen consumption and extracellular acidification rate analysis. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) which indicated 26


Page 26 of 36

Page 27 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mitochondrial respiration level and lactate production rate were measured by Agilent Seahorse XF technology according to the manufacturer’s instruction. Briefly, the sensor cartridges were hydrated with Seahorse calibration buffer in a 37 °C CO2-free incubator one night before the assay. Cancer cells were seeded in Agilent Seahorse microplate and then treated with vehicle or hits for 12 h. After that, the cells were washed twice and the medium was replaced with Seahorse assay medium or base medium for measurement of OCR or ECAR values, respectively. Next, the plate was incubated in the non-CO2 incubator for 1 h prior to the test. Finally, OCR and ECAR values were measured by the Seahorse XF analyzer. LC-MS/MS analyzation of metabolic switch in cancer cells. Analyzation of metabolic switch in cancer cells with LC-MS/MS equipment was carried out in a similar manner as previously described.19 In brief, after culturing A549 cells on 6-cm dishes overnight, the medium was replaced by fresh ones containing 0.1% DMSO or indicated concentrations of hits. After treatment for another 12 h, the cells and medium were collected and prepared according to the method previously reported.25 Chromatographic assay was performed on the Waters Acquity UPLC H-Class system equipped with a 150 mm ⅹ 2.1 mm Acquity UPLC BEH HILIC 1.7 µm column and the MS/MS detection was carried out on the Waters Xevo TQD with an ESI. The concentrations of intermediates including glucose, pyruvate, lactate, acetyl-CoA, citrate, α-ketoglutarate, fumarate, succinate, malate and oxaloacetate were analyzed to evaluate the metabolic switch in cancer cells after treatment potential PDK1 inhibitors.

27



Molecular docking and molecular dynamics simulation. The PDK1 crystal structure was known to have four binding sites which modulated its activities divergently. In absence of a clear knowledge of the possible binding site, for the hit, we performed a blind docking using Swiss Model

26

and Autodock Vina.27 The crystal structure of PDK1 2Q8G was

downloaded from Protein data Bank (http://www.rcsb.org/). Protonation states were corrected. Ligand and water molecules were removed, Protein and ligand structures were prepared using Autodock tools. Entire protein was set as grid (Docking parameters; x = 1.76, y = 27.35, z = -7.51 size 126 x 126 x 126 and exhaustiveness 500). Molecular docking was repeated thrice by increasing and decreasing the exhaustiveness. Accurate docking type was selected to perform blind docking in Swiss Dock. Results hence obtained were analyzed using UCSF Chimera (https://www.cgl.ucsf.edu/chimera/). To confirm the stability of the ligand into the lipoamide site molecular dynamics (MD) simulation of the protein ligand complex was performed. Two minimum energy conformers obtained from Swiss Dock were chosen for dynamics simulation. The complex was solvated and counter ions were added in an orthorhombic box with an explicit periodic boundary model. 'Standard Dynamics Cascade' Protocol of Discovery Studio 2017 (DS 2017) program was used to perform the minimization, heating and equilibrating the system. Two step minimization was attained using steepest-descent algorithm for 20,000 steps and conjugate gradient minimization for 10,000 steps. Heating was carried out for 400ps where the initial temperature of 50K was raised to 300K at a step size of 2fs. The structure was equilibrated for 1ns and was further run under NVT conditions for additional 1ns. Simulations were conducted for 30ns in an isothermal-isobaric ensemble using NAMD 28


Page 28 of 36

Page 29 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.1.28 Integration time was set to 2fs. Twin range cut off at 10 and 12 Å using switching function was used calculate short range Vander-walls interactions and Particle Mesh Ewald method was used to calculate long range electrostatic interactions. Langevin algorithm, and the Langevin Piston Nose–Hoover method was used to maintain temperature coupling and pressure respectively. Root mean Square Deviation (RMSD) of the ligand, in the complex, was analyzed for the last 10ns to determine its stability in the protein. The protein-ligand interactions were visualized using the final structure obtained from the MD. Statistical analysis. Data were presented as mean ± SD (n = 3) and represented three independent experiments. Student’s t-test was used to calculate the statistical differences between groups. A p value of less than 0.05 was considered significant.

ASSOCIATED CONTENT Supporting Information. The Supporting Information is available free of charge on the ACS Publications website Assay conditions, ITC data, 384-well plate layout, TCA cycle intermediate concentrations and Molecular dynamics. AUTHOR INFORMATION Corresponding Author E-mail: [email protected] ORCID Kin Y. Tam: http://orcid.org/0000-0001-5507-8524 CONFLICT OF INTEREST 29



The authors declare no conflict of interest for this article. ACKNOWLEDGEMENTS We thank the financial support from the Science and Technology Development Fund, Macao S.A.R. (FDCT) (project reference no. 0057/2018/A2). We are also in debt to Cynthia Fu’s technical support in recombinant protein preparation. Thanks are due to Dr. Li Wang from Metabolomics Core at Faculty of Health Sciences, University of Macau for the access of the Seahorse assay.

30


Page 30 of 36

Page 31 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES 1.

Warburg, O., On the origin of cancer cells. Science 1956, 123 (3191), 309-314.

2.

Liberti, M. V.; Locasale, J. W., The Warburg Effect: How Does it Benefit Cancer Cells?

Trends in biochemical sciences 2016, 41 (3), 211-218. 3.

Lunt, S. Y.; Vander Heiden, M. G., Aerobic glycolysis: meeting the metabolic

requirements of cell proliferation. Annu Rev Cell Dev Biol 2011, 27, 441-64. 4.

Xie, H.; Hanai, J.; Ren, J. G.; Kats, L.; Burgess, K.; Bhargava, P.; Signoretti, S.; Billiard,

J.; Duffy, K. J.; Grant, A.; Wang, X.; Lorkiewicz, P. K.; Schatzman, S.; Bousamra, M., 2nd; Lane, A. N.; Higashi, R. M.; Fan, T. W.; Pandolfi, P. P.; Sukhatme, V. P.; Seth, P., Targeting lactate dehydrogenase--a inhibits tumorigenesis and tumor progression in mouse models of lung cancer and impacts tumor-initiating cells. Cell Metab 2014, 19 (5), 795-809. 5.

Martinez-Outschoorn, U. E.; Peiris-Pages, M.; Pestell, R. G.; Sotgia, F.; Lisanti, M. P.,

Cancer metabolism: a therapeutic perspective. Nat Rev Clin Oncol 2017, 14 (1), 11-31. 6.

Holness, M.; Sugden, M., Regulation of pyruvate dehydrogenase complex activity by

reversible phosphorylation. Portland Press Limited: 2003. 7.

McFate, T.; Mohyeldin, A.; Lu, H.; Thakar, J.; Henriques, J.; Halim, N. D.; Wu, H.;

Schell, M. J.; Tsang, T. M.; Teahan, O.; Zhou, S.; Califano, J. A.; Jeoung, N. H.; Harris, R. A.; Verma, A., Pyruvate dehydrogenase complex activity controls metabolic and malignant phenotype in cancer cells. The Journal of biological chemistry 2008, 283 (33), 22700-8. 31



8.

Hur, H.; Xuan, Y.; Kim, Y. B.; Lee, G.; Shim, W.; Yun, J.; Ham, I. H.; Han, S. U.,

Expression of pyruvate dehydrogenase kinase-1 in gastric cancer as a potential therapeutic target. Int J Oncol 2013, 42 (1), 44-54. 9.

Fujiwara, S.; Kawano, Y.; Yuki, H.; Okuno, Y.; Nosaka, K.; Mitsuya, H.; Hata, H.,

PDK1 inhibition is a novel therapeutic target in multiple myeloma. British journal of cancer 2013, 108 (1), 170. 10. Baumunk, D.; Reichelt, U.; Hildebrandt, J.; Krause, H.; Ebbing, J.; Cash, H.; Miller, K.; Schostak, M.; Weikert, S., Expression parameters of the metabolic pathway genes pyruvate dehydrogenase kinase-1 (PDK-1) and DJ-1/PARK7 in renal cell carcinoma (RCC). World journal of urology 2013, 31 (5), 1191-1196. 11. Pópulo, H.; Caldas, R.; Lopes, J. M.; Pardal, J.; Máximo, V.; Soares, P., Overexpression of pyruvate dehydrogenase kinase supports dichloroacetate as a candidate for cutaneous melanoma therapy. Expert opinion on therapeutic targets 2015,

19 (6), 733-745. 12. Zhang, W.; Zhang, S. L.; Hu, X.; Tam, K. Y., Targeting Tumor Metabolism for Cancer Treatment: Is Pyruvate Dehydrogenase Kinases (PDKs) a Viable Anticancer Target? Int J

Biol Sci 2015, 11 (12), 1390-400. 13. Dhar, S.; Lippard, S. J., Mitaplatin, a potent fusion of cisplatin and the orphan drug dichloroacetate. Proc Natl Acad Sci U S A 2009, 106 (52), 22199-204.

32


Page 32 of 36

Page 33 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


14. Sun, W.; Xie, Z.; Liu, Y.; Zhao, D.; Wu, Z.; Zhang, D.; Lv, H.; Tang, S.; Jin, N.; Jiang, H.; Tan, M.; Ding, J.; Luo, C.; Li, J.; Huang, M.; Geng, M., JX06 Selectively Inhibits Pyruvate Dehydrogenase Kinase PDK1 by a Covalent Cysteine Modification. Cancer

research 2015, 75 (22), 4923-36. 15. Zhang, S. L.; Hu, X.; Zhang, W.; Yao, H.; Tam, K. Y., Development of pyruvate dehydrogenase kinase inhibitors in medicinal chemistry with particular emphasis as anticancer agents. Drug discovery today 2015, 20 (9), 1112-9. 16. Aicher, T. D.; Anderson, R. C.; Gao, J. P.; Shetty, S. S.; Coppola, G. M.; Stanton, J. L.; Knorr, D. C.; Sperbeck, D. M.; Brand, L. J.; Vinluan, C. C.; Kaplan, E. L.; Dragland, C. J.; Tomaselli, H. C.; Islam, A.; Lozito, R. J.; Liu, X. L.; Maniara, W. M.; Fillers, W. S.; DelGrande, D.; Walter, R. E.; Mann, W. R., Secondary amides of (R)-3,3,3-trifluoro-2hydroxy-2-methylpropionic acid as inhibitors of pyruvate dehydrogenase kinase. Journal

of Medicinal Chemistry 2000, 43 (2), 236-249. 17. Huang, H.; Zhang, X.; Li, S.; Liu, N.; Lian, W.; McDowell, E.; Zhou, P.; Zhao, C.; Guo, H.; Zhang, C.; Yang, C.; Wen, G.; Dong, X.; Lu, L.; Ma, N.; Dong, W.; Dou, Q. P.; Wang, X.; Liu, J., Physiological levels of ATP negatively regulate proteasome function. Cell Res 2010, 20 (12), 1372-85. 18. Jackson, J. C.; Vinluan, C. C.; Dragland, C. J.; Sundararajan, V.; Yan, B.; Gounarides, J. S.; Nirmala, N. R.; Topiol, S.; Ramage, P.; Blume, J. E.; Aicher, T. D.; Bell, P. A.; Mann, W. R., Heterologously expressed inner lipoyl domain of dihydrolipoyl acetyltransferase 33



inhibits ATP-dependent inactivation of pyruvate dehydrogenase complex. Identification of important amino acid residues. Biochem J 1998, 334 ( Pt 3), 703-11. 19. Zhang, W.; Hu, X.; Zhou, W.; Tam, K. Y., Liquid Chromatography-Tandem Mass Spectrometry Method Revealed that Lung Cancer Cells Exhibited Distinct Metabolite Profiles upon the Treatment with Different Pyruvate Dehydrogenase Kinase Inhibitors.

Journal of proteome research 2018, 17 (9), 3012-3021. 20. Kato, M.; Li, J.; Chuang, J. L.; Chuang, D. T., Distinct structural mechanisms for inhibition of pyruvate dehydrogenase kinase isoforms by AZD7545, dichloroacetate, and radicicol. Structure 2007, 15 (8), 992-1004. 21. Zhang, S. L.; Yang, Z.; Hu, X.; Chakravarty, H.; Tam, K. Y., Anticancer effects of some novel dichloroacetophenones through the inhibition of pyruvate dehydrogenase kinase 1.

Eur J Pharm Sci 2018, 123, 43-55. 22. De Marco, A.; Deuerling, E.; Mogk, A.; Tomoyasu, T.; Bukau, B., Chaperone-based procedure to increase yields of soluble recombinant proteins produced in E. coli. BMC

biotechnology 2007, 7 (1), 1. 23. Lawson, K. R.; Lawson, J., LICSS - a chemical spreadsheet in microsoft excel.

Journal of Cheminformatics 2012, 4 (1), 3. 24. Zhang, S. L.; Hu, X.; Zhang, W.; Tam, K. Y., Unexpected Discovery of Dichloroacetate Derived Adenosine Triphosphate Competitors Targeting Pyruvate Dehydrogenase Kinase To Inhibit Cancer Proliferation. J Med Chem 2016, 59 (7), 3562-8. 34


Page 34 of 36

Page 35 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


25. Kaplon, J.; Zheng, L.; Meissl, K.; Chaneton, B.; Selivanov, V. A.; Mackay, G.; van der Burg, S. H.; Verdegaal, E. M.; Cascante, M.; Shlomi, T.; Gottlieb, E.; Peeper, D. S., A key role for mitochondrial gatekeeper pyruvate dehydrogenase in oncogene-induced senescence. Nature 2013, 498 (7452), 109-12. 26. Arnold, K.; Bordoli, L.; Kopp, J.; Schwede, T., The SWISS-MODEL workspace: a webbased environment for protein structure homology modelling. Bioinformatics 2006, 22 (2), 195-201. 27. Trott, O.; Olson, A. J., AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem 2010, 31 (2), 455-61. 28. Phillips, J. C.; Braun, R.; Wang, W.; Gumbart, J.; Tajkhorshid, E.; Villa, E.; Chipot, C.; Skeel, R. D.; Kale, L.; Schulten, K., Scalable molecular dynamics with NAMD. J Comput

Chem 2005, 26 (16), 1781-802.

35



Table of Contents


Page 36 of 36

Identification of Novel Pyruvate Dehydrogenase Kinase 1 (PDK1

Recommend Documents