ARTICLE pubs.acs.org/est
Impaired Gas Bladder Inflation in Zebrafish Exposed to a Novel Heterocyclic Brominated Flame Retardant Tris(2,3-dibromopropyl) Isocyanurate Juan Li,† Yong Liang,*,‡,§ Xu Zhang,† Jingyi Lu,‡ Jie Zhang,† Ting Ruan,§ Qunfang Zhou,§ and Guibin Jiang§ †
Key Laboratory of Subtropical Agriculture and Environment, Ministry of Agriculture, Huazhong Agricultural University, Wuhan 430070, China ‡ School of Medicine, Jianghan University, Hubei Province 430056, China § State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China ABSTRACT: The teleost gas bladder is a gas-filled internal organ that processes gas exchange and controls buoyancy. Here we report that an emerging heterocyclic brominated flame retardant, tris(2,3dibromopropyl) isocyanurate (TBC), causes defects in the inflation of the gas bladder of zebrafish larvae. This could cause impaired motility, which can ultimately lead to their death. Exposure to zebrafish embryos revealed that TBC had the most significant influence on the larvae at 7296 h postfertilization, which coincided with the time that the gas bladder first inflates. Critical factors involved in early zebrafish gas bladder development remained at normal levels, which indicated that TBC caused defects in the inflation of the gas bladder without disrupting early organogenesis. However, the ultrastructure of the gas bladder was altered in the TBC-treated groups: the electron density of cytoplasmic vesicles was changed and the mitochondria were damaged. We deduce that TBC causes damage to mitochondria that influences the secretion of mucus-like material, resulting in defects in gas bladder inflation. For the first time, we report that the gas bladder could be a primary target organ for TBC, and assessment of the gas bladder should be included in toxicity testing protocols of zebrafish embryos.
’ INTRODUCTION Brominated flame retardants (BFRs) are added to many consumer products including carpets, electronic cables, polyurethane foams, television sets, and computers.1 Some of the BFRs are stable in the environment,2 bioaccumulative, capable of longdistance transport, and potentially harmful to ecosystems and human health.3 Although use of polybrominated diphenyl ethers (PBDEs) has declined due to bans and restrictions in the developed world, other groups of alternative BFRs, such as tetrabromobisphenol A (TBBPA) and hexabromocyclododecanes (HBCD), appear to be increasing in the environment.46 Tris(2,3-dibromopropyl) isocyanurate (TBC) is a heterocyclic hexabrominated chemical with high Kow (octanolwater partition coefficient) and Koa (octanolair partition coefficient) values.7 Due to its good flame retardant properties, it is therefore used in certain glass fiber reinforced plastics.8 The annual production volume of TBC in China in the 1990s was more than 500 metric tons.9 Recently, TBC has been identified in soils, sediments, and earthworms around the Liuyang River in southern China. High relative levels of this chemical in biological samples suggested that TBC could bioaccumulate in some species.7 Also, high levels of TBC were detected in the intestine and brain of carp, which implies that this substance can pass r 2011 American Chemical Society
through the bloodbrain barrier.7 Although there are no current statistics on the overall production volume of TBC, increased production volumes are expected due to the enormous demand for electronic products. Furthermore, information about the toxicity of TBC is also limited. The only available data indicate that TBC exposure caused toxic effects on adult zebrafish (Danio rerio).10 Thus, further toxicological evaluation is urgently needed to evaluate the potential risks of this substance to wildlife and humans. Previous observations have shown that some BFRs, such as HBCD, could cause yolk sac edema, pericardial edema, axial spine curvature, and abnormal inflation of gas bladder of zebrafish larvae,11 whereas BDE-47 induced dorsal curvature, curved tail, and defects in the inflation of the gas bladder of zebrafish larvae.12 As a specific organ in teleosts, the gas bladder has important functions such as maintaining balance and producing space in the abdomen that protects other visceral organs from injury by external hydraulic pressure.13 In addition to its role in Received: December 13, 2010 Accepted: October 3, 2011 Revised: September 25, 2011 Published: October 03, 2011 9750
dx.doi.org/10.1021/es202420g | Environ. Sci. Technol. 2011, 45, 9750–9757
Environmental Science & Technology buoyancy, the gas bladder can provide oxygen when the fish is in an anoxic condition.14 Therefore, the gas bladder plays a vital role in maintaining the normal physiological activities of teleosts. This study was designed to investigate whether the gas bladder is a primary target organ of TBC in fish and, if so, what is the potential toxic mechanism of TBC on failed gas bladder inflation.
ARTICLE
Table 1. Primer Sequences for Real-Time PCR Used in This Study gene
’ MATERIALS AND METHODS
primer sequence
β-actin
β-actin F CAACAGAGAGAAGATGACACAGATCA
prolactin
β-actin R GTCACACCATCACCAGAGTCCATCAC prl F GTGGCTATTTTGATGTGTGC prl R
somatolactin
Chemicals. Tris(2,3-dibromopropyl) isocyanurate (TBC,
97% purity) was purchased from SigmaAldrich (St Louis, MO). Stock solutions (1 and 2.5 μg/mL), prepared by dissolving TBC in dimethyl sulfoxide (DMSO, Amresco), were stored at 4 °C. All the chemicals used in this study were analytical-grade. Animal Model. AB strain (wild type) zebrafish were kept under a 12-h light and 12-h dark photoperiod at 26 ( 1.5 °C. The fish were fed with live brine shrimp (Artemia nauplii) twice daily. Zebrafish were maintained and embryos were collected from tanks according to the procedures described by Westerfield.15 Normal fertilized eggs at 2 h postfertilization (hpf) were collected for exposure experiments after visual inspection with a stereomicroscope. TBC Exposure. The stock solution was diluted in water to create a graded series of TBC solutions. Zebrafish embryos were exposed to TBC at 0.5, 1, 2.5, 5, and 10 μg/mL with the final concentrations of DMSO in water less than 0.4%, or they were exposed to water containing 0.4% DMSO only (vehicle control). An Alliance 2695 model HPLC system (Waters, Milford, MA) equipped with a degasser and a quadruple pump was used for instrument analysis. To determine the actual concentration of TBC in the aqueous treatments, the TBC exposure solution in the 0, 1, 5, and 10 μg/mL groups was analyzed according to the method described by Ruan et al.7 Each exposure group was analyzed in triplicate. The embryos at 2 hpf were prepared for experimental treatments and were exposed to TBC or the vehicle control until 168 hpf. In addition, different stages of exposure were carried out in this study. The zebrafish embryos were exposed to TBC at 22, 46, 70, and 94 h intervals beginning at 2 hpf. Meanwhile, the embryos were also exposed to TBC at 166, 144, 120, 96, 72, and 48 h intervals beginning at 2, 24, 48, 72, 96, and 120 hpf respectively (Figure 3a). After each exposure, embryos from all treatments were removed, rinsed with water for 1 min over a plastic screen, and then transferred to clean water and observed periodically for development of the phenotype. For all exposure experiments, embryos and larvae were maintained at 26 ( 0.5 °C and reared in sterile 12 well cell culture plates (Corning International, Corning, NY) at a density of 20 embryos per well, each well containing 3 mL of treatment solution. Experiments were performed at least in triplicate, and the treatment solution of each well was replaced with fresh reagent every 24 h. At the end of each exposure period, the larvae were euthanized by an overdose of MS-222, and morphological observation was carried out under a stereomicroscope. Glass slides were used to hold the larvae so that the exact number of larvae that had defective gas bladders could be counted under the stereomicroscope. The scoring of the lethal and malformed end points was according to the methods described by Nagel16 and Hermsen et al.17 The gas bladder of zebrafish consists of posterior and anterior chambers that inflate at 4.5 and 21 days postfertilization, respectively.13 The region of the gas bladder hereinafter referred to in this paper is the posterior chamber. This study involving zebrafish larvae was conducted in accordance
primer name
Sonic Hedgehog
TTGGTGAGTGAGGTGCTGAG
sl-β F
GGAGTGTCCAGACCAAGAG
sl-β R
CCGAGAAGCGGTAAATGAG
shha F
TGTTTCCCAGGGTTCG
shha R
GGGTTCTTGCGTTTC
Indian Hedgehog ihha F
GCTCACGCCGAACTACAA
ihha R
TGCCGTCTTCATCCCAAC
with national and institutional guidelines for the protection of human subjects and animal welfare. Total RNA Extract. For each exposure experiment, zebrafish embryos were exposed to 0, 1, and 10 μg/mL TBC in two 12-well plates with 20 embryos per well, and each set of 40 embryos (from two wells) was pooled for RNA preparation. The larvae were washed twice in diethyl pyrocarbonate-treated water, and the total RNA was extracted from 40 homogenized zebrafish larvae (exposure durations were 072 and 096 hpf, respectively) by use of Trizol Reagent (Invitrogen) according to the manufacturer’s instructions. The purity of the total RNA was measured by a UV spectrophotometer (BioPhotometer plus, Eppendorf, Germany). The quality and integrity of the total RNA were verified by measuring the 260/280 nm ratios and by electrophoresis on a 1% agarose formaldehyde gel. The mortality, hatch rate, and gas bladder deformity rate were determined before the larvae were used for RNA extraction. Real-Time Polymerase Chain Reaction. Zebrafish larvae from 0, 1, and 10 μg/mL TBC exposure groups were chosen for gene detection. In this study, 2 μg of total RNA was reversetranscribed to cDNA by use of MMLV reverse transcriptase (Promega, Madison, WI) according to the manufacturer’s instructions. The primer sequences of β-actin, somatolactin (sl-β), prolactin (prl), Indian Hedgehog (ihha), and Sonic Hedgehog (shha) were designed with the assistance of the computer software Premier 5.0. All sequences of the primer are shown in Table 1. Each PCR reaction mixture in a total volume of 20 μL contained 1 μL of cDNA template, 0.1 μM primers, Milli-Q water, and 10 μL of 2 SYBR QPCR Master Mix (Toyobo). The thermal cycling program consisted of a denaturing step (94 °C for 5 min) followed by 45 cycles of denaturation (94 °C for 20 s), annealing (55 °C for 20 s), and extension (72 °C for 40 s) in a PTC-200 thermal cycler equipped with a Chromo4 real-time fluorescence detector (MJ Research). The gene expression levels were measured in four replicates for each treatment. The cycle threshold (CT) value was obtained from Opticon Monitor 3.0 software. The target gene expression level was normalized to that of β-actin. The x-fold change of the tested genes was analyzed by the 2ΔΔCt method.18 Transmission Electron Microscopy. Three zebrafish larvae were chosen randomly from each of the vehicle control, 1, and 10 μg/mL TBC treated groups for ultrastructural analysis. The whole zebrafish larvae exposed to TBC for 104 hpf were fixed in a solution of 2.5% glutaraldehyde adjusted to pH 7.4 with 0.1 M phosphate buffer, postfixed in 2% OsO4 in the same buffer, and then dehydrated and embedded in epoxy resin according to 9751
dx.doi.org/10.1021/es202420g |Environ. Sci. Technol. 2011, 45, 9750–9757
Environmental Science & Technology
ARTICLE
Figure 1. Toxic effects of TBC on zebrafish larvae following embryonic exposure from 0 to 168 hpf. (a) Mortality; (b) hatching rate. Each bar represents the mean ( SEM *Significant different from control group. P e 0.05.
Figure 2. Micrographs showing failed inflation of gas bladder induced by TBC exposure. (a) Top view and (c) lateral view of control (c) at 120 h postfertilization (hpf). (b, d) Lateral view of 10 μg/mL TBC-exposed larvae at 120 h postfertilization (hpf). Higher magnification views in panels c and d show the normal gas bladder and the failed inflation of the gas bladder, respectively. Arrows points to gas bladder of zebrafish larvae. Scale bars = 300 μm.
Luft.19 Ultrathin sections obtained with an ultramicrotome (LKB-II, Sweden) were stained with uranyl acetate and lead citrate. The observations and recording of images were performed with an FEI TECNAI-G2 transmission electron microscope at 200 KV. Statistical Analysis. Mortality, hatch rate, and deformation rate were compared statistically between TBC and the control by use of a χ2 test. LC50 (95% CI) and EC50 (95% CI) were calculated by the trimmed SpearmanKarber test. For other time course experiments, one-way analysis of variance (ANOVA) and Tukey’s multiple range tests were used to determine whether the differences between the control and TBC exposure groups were significant. SPSS 13.0 and Origin 7.5 were used for the statistical analysis. For all experiments, p e 0.05 was used to determine significance.
’ RESULTS Quantification of TBC in Exposure Concentration. Liquid chromatography/mass spectrometry (LC/MS) was used to determine the actual concentration of TBC present in the aqueous treatments. The 0, 1, 5, and 10 μg/mL TBC exposure solutions were analyzed, and results were 0, 0.80 ( 0.16, 4.61 ( 0.73 and 9.58 ( 0.31 μg/mL, respectively (n = 3), which indicated that TBC was well dissolved in the aqueous treatment with DMSO.
Toxic Effects of TBC on Zebrafish Larvae. Mortality and hatching rate of TBC-treated embryos are shown in Figure 1. Exposure to TBC caused high mortality of larvae at the longer exposure periods (144 and 168 hpf) (Figure 1a). Larvae in 5 and 10 μg/mL TBC treatment groups showed significantly higher mortality than that of the control groups at 120 hpf. There was a significant difference in mortality between 2.5, 5, and 10 μg/mL TBC treatments and the control group after 144 and 168 hpf, and the values of LC50 were 6.85 ( 0.42 and 2.66 ( 0.23 μg/mL at 144 and 168 hpf, respectively. However, during the exposure duration from 0 to 168 hpf, there was a significant change in mortality between the 0.5 and 1 μg/mL TBC treatments and control groups (Figure 1a). Hatching rate declined significantly after TBC exposure 72 hpf (Figure 1b). Morphological Change of Zebrafish Larvae following TBC Exposure. Larvae exposed to TBC from 0 to 168 hpf showed highly reproducible defects in the inflation of the gas bladder, which mostly occurred after 96 hpf. Larvae in the control group swam normally and had a normal gas bladder (Figure 2a,c). As shown in Figure 2a,c, the normal gas bladder is oval, transparent, and filled with gas, which is easily detected under the microscope. After TBC exposure, the gas bladder inflation was defective, and instead of being transparent and oval, had the appearance of a “black line”. Less than 10% of larvae exposed to 1 μg/mL TBC exhibited abnormal swimming behavior. However, more than 9752
dx.doi.org/10.1021/es202420g |Environ. Sci. Technol. 2011, 45, 9750–9757
Environmental Science & Technology 80% of larvae lost their swimming ability and lay on their sides at the bottom of the well in the 2.5, 5, and 10 μg/mL TBC treatments. Because of the “side lying” phenomenon, we could not capture the top view of those larvae, so the lateral view of larvae that did not have inflated gas bladders was recorded (Figure 2b,d). Apart from the noninflation effect on the gas bladder, TBC did not induce other toxic effects, such as yolk sac edema, pericardial edema, or curved tail. The failed inflation of the gas bladder was dose-dependent and a significant increase was found in the 2.5, 5, and 10 μg/mL TBC-treated groups compared with the control group (Figure 3). The corresponding EC50 values for 96, 120, 144, and 168 hpf were 1.69 ( 0.11, 1.70 ( 0.13, 1.71 ( 0.09, and 1.72 ( 0.08 μg of TBC/mL, respectively. Toxic Window of TBC on Defects in the Inflation of Zebrafish Larvae Gas Bladders. To observe the narrow window
Figure 3. Failure in inflation of gas bladder in zebrafish larvae following TBC exposure from 0 to 168 hpf.
ARTICLE
when TBC affected zebrafish larvae, we exposed them at various time frames (Figure 4a). At 5 and 10 μg/mL TBC exposure, gas bladder malformation occurred at exposure periods of 0168, 24168, 48168, and 72168 hpf (Figure 4c), and a positive correlation was found between malformation rate and exposure time. However, in the 5 and 10 μg/mL TBC treatments, the malformation rate decreased significantly during the exposure period of 96168 hpf and disappeared at 120168 hpf. A similar trend of malformation rate was observed, where no effect was found during 024, 048, and 072 hpf but significant effects were found in the 096 hpf exposure experiment (Figure 4b). Therefore, the most sensitive period during which TBC affects the gas bladder seems to be from 72 to 96 hpf, while no significant impact was observed on the gas bladder in the other periods. On the basis of the above observations, we further investigated whether TBC would have toxic effects on zebrafish larvae when the gas bladder was completely inflated. Zebrafish larvae were exposed to TBC from 120 to 288 hpf. The failed inflation rate in the 0, 1, 5, and 10 μg/mL TBC treatment groups was 0%, 0%, 0%, and 1.7%, respectively; and no mortality was observed for either the control or TBC treatment groups Gene Expression of Zebrafish Larvae following TBC Exposure. The larvae used for RNA extraction were affected by TBC exposure in a similar way to those used for morphological observation. We chose the time point between 72 hpf and 96 hpf to investigate the expression of gas bladder development related genes, including prl, sl-β, shha, and ihha. The expression of both prl and sl-β genes, which are members of the growth hormone and prolactin (GH/PRL) superfamily and play vital roles in gas bladder development, was detectable at 72 and 96 hpf in both the vehicle and TBC-treated groups. Neither prl nor sl-β showed any difference between the TBC-exposed group and the control group (Figure 5a, b). Both shha and ihha are crucial genes in the
Figure 4. (a) Exposure methods (based on the TBC exposure durations). (b, c) Defects in the inflation of the gas bladder, detected at the given end point (168 hpf). 9753
dx.doi.org/10.1021/es202420g |Environ. Sci. Technol. 2011, 45, 9750–9757
Environmental Science & Technology
ARTICLE
Figure 5. Gene expression in the GH/PRL superfamily and Hedgehog pathways under TBC treatment. Real-time PCR results of the tested genes in the control group and exposed to TBC groups until 72 and 96 hpf: (a) prl; (b) sl-β; (c) shha; (d) ihha. Each set of 40 embryos was pooled for RNA preparation, n = 4.
Hedgehog (hh) pathway, and the expression of both ihha and shha genes in TBC-treated larvae showed no significant difference compared with the control (Figure 5c,d). This result suggests that induction of severe malformations in the gas bladder by TBC was independent of the GH/PRL and hh gene pathways. TBC Induced Changes in Ultrastructure of Zebrafish Gas Bladder. The ultrastructure of the zebrafish gas bladder was examined by transmission electron microscopy (TEM), and by imaging directly through the cross section of the larval gas bladder (104 hpf). In the control group, a large number of cytoplasmic vesicles with an electron lucent appearance were found in the epithelial lining of the gas bladder (Figure 6ac). Some of the cytoplasmic vesicles were present in the lumen of the gas bladder (Figure 6c). The mitochondria of the control group had a normal appearance with intact cristae (Figure 6 b). However, cytoplasmic vesicles were atrophied and electron-dense in the 1 μg/mL TBC treated group (Figure 6df), and this phenomenon was more severe in the 10 μg/mL TBC group (Figure 6g, h). Furthermore, the mitochondrial cristae were disrupted in the 1 and 10 μg/mL TBC treated groups. This resulted in the cells having a vacuolar appearance and mitochondria with myelin figures (Figure 6d,fi). In addition, intact smooth muscle could be found in all experimental groups, which implied TBC might have no effect on muscle formation in the gas bladder.
’ DISCUSSION The gas bladder, commonly referred to as the swim bladder, is a vascularized internal organ that is found in almost all teleosts. It
controls the buoyancy and locomotory movements of fishes.20,21 In this study, the most conspicuous development defect caused by TBC treatment was the failure of the gas bladder to inflate. This is similar to the effect of some other BFRs such as HBCD and BDE-47.11,12 Results in this study showed that 0168 hpf TBC exposure caused defects in the inflation of the gas bladder of zebrafish larvae, resulting in the impairment of free motility. The yolk sac, which provides nutritive material vital for the movement of larvae, plays an important role in the early development of zebrafish.22 Inflation of the zebrafish gas bladder began at around 72 hpf, coinciding with the time of yolk sac reabsorption and the beginning of feeding.23 Once gas bladder inflation occurred, zebrafish larvae swam freely and began to seek nutrition. Our results showed that treatment with 0.5, 1, 2.5, 5, and 10 μg/mL TBC for 0168 hpf caused mortality of zebrafish larvae in a dosedependent manner. We hypothesized that zebrafish larvae are unable to feed themselves after TBC exposure, finally leading to their death once the yolk sac is depleted. In this study, TBC exposure (0168 hpf) induced gas bladder malformation in zebrafish larvae at 96 hpf, with a 96 hpf EC50 of 1.69 ( 0.11 μg of TBC/mL. TBC exposure did not cause high mortality until 144 hpf, with a 144 hpf LC50 value of 6.85 ( 0.42 μg of TBC/mL. This means that the failure of gas bladder inflation appear earlier than the death of larvae in our study, suggesting failed gas bladder inflation is a sensitive index to evaluate the toxic effects of TBC. With the increase of mortality, a decreasing EC50 would be expected, but results in this study showed that the EC50 values remained almost constant for all exposure periods, which indicated 9754
dx.doi.org/10.1021/es202420g |Environ. Sci. Technol. 2011, 45, 9750–9757
Environmental Science & Technology
ARTICLE
Figure 6. Ultrastructure of zebrafish gas bladder after TBC exposure for 104 h. Numerous vesicles (V), mitochondria (M), myelin figure (F), and lumen (L), are shown. (c) Some of the vesicles have been released into the lumen (arrow). (f, i) Mitochondrial damage with the presence of myelin figures.
that there might be a defined time window of toxicity. In addition, the hatch rate of TBC-treated larvae was significantly lower at 72 hpf compared with the control group, indicating TBC might affect early development of zebrafish larvae. The results from different exposure methods showed that when the exposure duration was from 0 to 72 hpf, the fish did not show obvious gas bladder defects, whereas when exposure duration was from 0 to 96 hpf, zebrafish larvae exhibited abnormal gas bladders in the 5 and 10 μg/mL TBC exposure groups. When the exposure duration was from 72 to 168 hpf, zebrafish larvae exhibited severe defects in their gas bladders, while exposure periods from 96 to 168 hpf resulted in few abnormalities in the gas bladders of fish treated with 10 μg/mL TBC. On the basis of these results, we deduce that the toxic window where TBC affects the gas bladders of zebrafish larvae is from 72 to 96 hpf, and this is consistent with development of the zebrafish gas bladder, which begins to inflate at around 72 hpf. It has been reported that the posterior chamber of the gas bladder of zebrafish is completely inflated at about 120 hpf, after which zebrafish larvae can swim freely and feed themselves.13,23 Notably, when exposure duration was 120168 hpf and 120288 hpf in the present experiment, we found neither defects in gas
bladder nor death of larvae, suggesting that TBC has little effect as long as the gas bladder has been completely inflated. This result strongly enhances our finding that the gas bladder is a target organ of TBC. The gas bladder of zebrafish is made up of an epithelial, mesodermal, and outer mesodermal layer from the lumen to stratum externum, and the mesenchyme differentiates into the muscle layer.13 Hedgehog genes in the epithelia, such as shha and ihha, play an essential role in the formation and organization of all the three tissue layers of the swim bladder.13 The knockdown of shha and ihha genes led to failed inflation of the gas bladder at 72 hpf. Knockdown of ihha resulted in mild reduction of the epithelium and mesenchyme, absence of smooth muscle differentiation, and a reduction of the outer mesothelium. Similarly, shha knockdown caused prominent reduction of the epithelium, disorganization of the mesenchyme in the absence of smooth muscle differentiation, and disorganization of the outer mesothelium at 72 hpf.13 Members of the GH/PRL superfamily, such as prl and sl-β, play an important role in the development of the gas bladder of zebrafish by regulating growth and osmoregulation. In addition, prl and sl-β knockdown led to failure of the gas bladder to inflate.24 The expression of those four genes showed no significant 9755
dx.doi.org/10.1021/es202420g |Environ. Sci. Technol. 2011, 45, 9750–9757
Environmental Science & Technology difference between TBC-treated and control groups, indicating the defect in inflation of the gas bladder in TBC-treated larvae was independent of Hedgehog and GH/PRL gene pathways. Combined with our result that perfect smooth muscle was found in the gas bladder, it is suspected that TBC has a direct effect on the inflation of the gas bladder instead of influencing its early formation and development. Teleosts are classified as physostomes or physoclists according to their gas bladder structure, and zebrafish belong to physostomes.25 Brooks26 noted that there was mucus-like material along the surface of the physostomatous swim bladder. Such material, which originates from cytoplasmic vesicles and is commonly referred to as surfactant production, enables the fish to maintain the surface tension of the gas bladder and protect microbubbles from collapse until they are released into the lumen of the gas bladder.24 Furthermore, the final act of gas secretion into the gas bladder occurs by formation of small cytoplasmic bubbles in the secretory epithelium coupled with relatively quick release into the lumen of the gas bladder.27,28 Thus, the cytoplasmic vesicles are closely related to the secretion of mucuslike material, which in turn is closely related to the surface tension of the gas bladder. Our TEM results showed a large amount of electron lucent cytoplasmic vesicles in the epithelium of the control group, and we also found that mucus-like material in cytoplasmic vesicles was released into the lumen of the gas bladder. In the TBC exposure groups, the cytoplasmic vesicles were electron-dense, which suggested that the mucus-like material might still reside in them. Mitochondria are the site for mitochondrial respiration and ATP synthesis. It is known that the formation of myelin figures is one of the indicators of mitochondrial damage, and the presence of myelin figures in mitochondria in TBC exposure groups indicated that mitochondrial elimination was ongoing in the epithelium of the gas bladder. Our data showed that TBC caused cytological damage to the gas bladder, including a decrease of cytoplasmic vesicles, change in the electron density of cytoplasmic vesicles, and mitochondrial damage. However, how exactly TBC gains access to and induces mitochondrial damage is currently unknown, and further study is needed. In this study, we have reported that TBC caused damage to the mitochondria of gas bladder epithelial cells, which might block the energy acquirement of the cells to release the mucus-like material from the cytoplasmic vesicles into the lumen of the gas bladder. This would result in a shortage of the surfactants that usually maintain the surface tension of the gas bladder and lead to defects in the inflation of the gas bladder as well as inhibition of larval motility, causing the fish to fail in swimming into surface waters to acquire food. As a result, zebrafish larvae could die of starvation. The results from this study also indicate that the teleost gas bladder is an important target organ to evaluate toxic effects and should be added as an end point in test protocols for zebrafish embryos.
’ AUTHOR INFORMATION Corresponding Author
*Telephone: +86 27-8423-8886; e-mail:
[email protected].
’ ACKNOWLEDGMENT We thank the National Natural Science Foundation of China (20890112, 20907017), the Major State Basic Research Development
ARTICLE
Program of China (973 Program) (2009CB421605), National Key Technology R&D Program of China (2007BAC27B01), and the State Key Laboratory of Environmental Chemistry and Ecotoxicology, RCEES, CAS (KF2009-05) for funding during the study.
’ REFERENCES (1) Stapleton, H. M.; Allen, J. G.; Kelly, S. M.; Konstantinov, A.; Klosterhaus, S.; Watkins, D.; McClean, M. D.; Webster, T. F. Alternate and new brominated flame retardants detected in US house dust. Environ. Sci. Technol. 2008, 42 (18), 6910–6916. (2) Birnbaum, L. S.; Staskal, D. F. Brominated flame retardants: cause for concern?. Environ. Health.Perspect. 2004, 112 (1), 9. (3) De Wit, C. A. An overview of brominated flame retardants in the environment. Chemosphere. 2002, 46 (5), 583–624. (4) Thomsen, C.; Lundanes, E.; Becher, G. Brominated flame retardants in archived serum samples from Norway: a study on temporal trends and the role of age. Environ. Sci. Technol. 2002, 36 (7), 1414–1418. (5) Zhang, X. L.; Luo, X. J.; Chen, S. J.; Wu, J. P.; Mai, B. X. Spatial distribution and vertical profile of polybrominated diphenyl ethers, tetrabromobisphenol A, and decabromodiphenylethane in river sediment from an industrialized region of South China. Environ. Pollut. 2009, 157 (6), 1917–1923. (6) Lam, J. C. W.; Lau, R. K. F.; Murphy, M. B.; Lam, P. K. S. Temporal trends of hexabromocyclododecanes (HBCDs) and polybrominated diphenyl ethers (PBDEs) and detection of two novel flame retardants in marine mammals from Hong Kong, South China. Environ. Sci. Technol. 2009, 43 (18), 6944–6949. (7) Ruan, T.; Wang, Y. W.; Wang, C.; Wang, P.; Fu, J. J.; Yin, Y. G.; Qu, G. B.; Wang, T.; Jiang, G. B. Identification and evaluation of a novel heterocyclic brominated flame retardant tris(2,3-dibromopropyl) isocyanurate in environmental matrices near a manufacturing plant in southern China. Environ. Sci. Technol. 2009, 43 (9), 3080–3086. (8) Xiong, X. Y. Microencapsulated flame retardant of TBC and its implication. Flame Retard. Mater. Technol. 1999, 3, 1–3 (in Chinese). (9) Cao, J. The developmental trend of plastics additives. China Chem. Ind. 1996, 8, 48–50 (in Chinese). (10) Zhang, X.; Li, J.; Chen, M. J.; Wu, L.; Zhang, C.; Zhang, J.; Zhou, Q. F.; Liang, Y. Toxicity of the brominated flame retardant tris-(2,3-dibromopropyl) isocyanurate in zebrafish (Danio rerio). Chin. Sci. Bull. 2011, 56, 1548–1555. (11) Deng, J.; Yu, L.; Liu, C.; Yu, K.; Shi, X.; Yeung, L. W. Y.; Lam, P. K. S.; Wu, R. S. S.; Zhou, B. S. Hexabromocyclododecane-induced developmental toxicity and apoptosis in zebrafish embryos. Aquat. Toxicol. 2009, 93 (1), 29–36. (12) Lema, S. C.; Schultz, I. R.; Scholz, N. L.; Incardona, J. P.; Swanson, P. Neural defects and cardiac arrhythmia in fish larvae following embryonic exposure to 2,20 ,4,40 -tetrabromodiphenyl ether (PBDE 47). Aquat. Toxicol. 2007, 82 (4), 296–307. (13) Winata, C. L.; Korzh, S.; Kondrychyn, I.; Zheng, W.; Korzh, V.; Gong, Z. Development of zebrafish swimbladder: The requirement of Hedgehog signaling in specification and organization of the three tissue layers. Dev. Biol. 2009, 331 (2), 222–236. (14) Todd, E. S. Positive buoyancy and air-breathing: a new piscine gas bladder function. Copeia 1973, 461–464. (15) Westerfield, M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Brachydanio rerio); University of Oregon Press: Eugene, OR, 1995. (16) Nagel, R. DarT: The embryo test with the zebrafish Danio rerio--a general model in ecotoxicology and toxicology. Altex 2002, 19, 38. (17) Hermsen, S. A. B.; Brandhof, E. J.; Van der Ven, L. T.; Piersma, A. H. Relative embryotoxicity of two classes of chemicals in a modified zebrafish embryotoxicity test and comparison with their in vivo potencies. Toxicol. In Vitro 2011, 25, 745–753. (18) Ding, L.; Murphy, M. B.; He, Y.; Xu, Y.; Yeung, L. W. Y.; Wang, J.; Zhou, B. S.; Lam, P. K. S.; Wu, R. S. S.; Giesy, J. P. Effects of brominated flame retardants and brominated dioxins on steroidogenesis 9756
dx.doi.org/10.1021/es202420g |Environ. Sci. Technol. 2011, 45, 9750–9757
Environmental Science & Technology
ARTICLE
in H295R human adrenocortical carcinoma cell line. Environ. Toxicol. Chem. 2007, 26 (4), 764–772. (19) Luft, J. H. Improvements in epoxy resin embedding methods J. Biophys. Biochem. Cytol. 1961, 9 (2), 409. (20) Fange, R. Gas exchange in fish swim bladder. Rev. Physiol. Biochem. Pharmacol. 1983, 97, 111–158. (21) Teoh, P. H.; Shu-Chien, A. C.; Chan, W. K. Pbx1 is essential for growth of zebrafish swim bladder. Dev. Dyn. 2010, 239 (3), 865–874. (22) Liu, Y. W.; Chan, W. K. Thyroid hormones are important for embryonic to larval transitory phase in zebrafish. Differentiation 2002, 70 (1), 36–45. (23) Robertson, G. N.; McGee, C. A.; Dumbarton, T. C.; Croll, R. P.; Smith, F. M. Development of the swimbladder and its innervation in the zebrafish, Danio rerio. J. Morphol. 2007, 268 (11), 967–985. (24) Zhu, Y.; Song, D.; Tran, N. T.; Nguyen, N. The effects of the members of growth hormone family knockdown in zebrafish development. Gen. Comp. Endocrinol. 2007, 150 (3), 395–404. (25) Finney, J. L.; Robertson, G. N.; McGee, C. A. S.; Smith, F. M.; Croll, R. P. Structure and autonomic innervation of the swim bladder in the zebrafish (Danio rerio). J. Comp. Neurol. 2006, 495 (5), 587–606. (26) Brooks, R. E. Ultrastructure of the physostomatous swimbladder of rainbow trout (Salmo gairdneri). Cell. Tissue. Res. 1970, 106 (4), 473–483. (27) Wittenberg, J. B. The secretion of inert gas into the swimbladder of fish. J. Gen. Physiol. 1958, 41 (4), 783. (28) Copeland, D. E. Fine structural study of gas secretion in the physoclistous swim bladder of Fundulus heteroclitus and Gadus callarias and in the euphysoclistous swim bladder of Opsanus tau. Cell Tissue Res. 1969, 93, 305–331.
9757
dx.doi.org/10.1021/es202420g |Environ. Sci. Technol. 2011, 45, 9750–9757
