Improved Method for the Incorporation of Heme Cofactors into

Subscriber access provided by UNIV OF DURHAM

Improved method for the incorporation of heme-cofactors into recombinant proteins using Escherichia coli Nissle 1917 Kerstin Fiege, Christine Joy Querebillo, Peter Hildebrandt, and Nicole Frankenberg-Dinkel Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.8b00242 • Publication Date (Web): 16 Apr 2018 Downloaded from http://pubs.acs.org on April 16, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Improved method for the incorporation of heme-cofactors into recombinant proteins using Escherichia coli Nissle 1917

Kerstin Fiege1, Christine Joy Querebillo2, 3, Peter Hildebrandt2 and Nicole FrankenbergDinkel1,*

1

Technische Universität Kaiserslautern, Fachbereich Biologie, Abt. Mikrobiologie, Erwin-

Schrödinger-Str. 56, D-67663 Kaiserslautern, Germany 2

Technische Universität Berlin, Institut für Chemie, Sekr. PC14, Straße des 17. Juni 135, D-

10623 Berlin, Germany 3

School of Analytical Sciences Adlershof, Humboldt-Universität zu Berlin, Unter den Linden 6,

D-10099 Berlin, Germany * Corresponding author: +49 631 2052353; [email protected]

1 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 26

ABSTRACT Recombinant production of heme proteins in Escherichia coli is often limited by the availability of heme in the host. Therefore, several methods, including the reconstitution of heme proteins after production but prior to purification or the HPEX system conferring the ability to take up external heme have been developed and used in the past. Here we describe the use of the apathogenic Escherichia coli strain Nissle 1917 (EcN) as a suitable host for the recombinant production of heme proteins. EcN has the advantage over commonly used lab strains that it is able to take up heme from the environment through the heme receptor ChuA. Expression of several heme proteins from different prokaryotic sources led to high yield and quantitative incorporation of the cofactor when heme was supplied in the growth medium. Comparative UVVis and Resonance Raman measurements revealed that the method employed has significant influence on heme coordination with the EcN system representing the most native situation. Therefore, the use of EcN as a host for recombinant heme protein production represents an inexpensive and straightforward method to facilitate further investigations on structure and function.

Keywords Heme protein, heme incorporation, E. coli Nissle 1917, MsmS, H-NOX, PhuS, recombinant protein production


Page 3 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

INTRODUCTION Heme proteins play an important role in a variety of biological processes, like cell respiration (cytochromes), oxygen binding and transport (hemoglobin, myoglobin), production and sensing of nitric oxide (NO synthase, heme/nitric oxide/oxygen (H-NOX) proteins), electron transfer (cytochromes) and signal transduction (FixL and CooA).1-9 In order to investigate their functional properties, high amounts of purified protein are required. Recombinant proteins from Escherichia coli are currently the most efficient and cost-saving method to produce sufficient amounts for biochemical and biophysical analysis. Unfortunately, the production is often limited by E. coli’s heme biosynthesis resulting in only partially assembled holo-heme protein.10 Hence, several methods to incorporate heme into the target proteins have been established during the last years. A widely-used method is the reconstitution of the protein with heme after its production by addition of hemin to the crude bacterial lysate prior to protein purification.11, 12 One emerging problem using this method is that the heme is incorporated into completely folded protein, often resulting in non-native heme coordination and therefore interference with its biological function. 13, 14

Therefore, the most desirable procedure is to increase the available amount of heme during

recombinant protein production to ensure an adequate supply. Thus, methods employing the addition of the heme precursor molecule δ-aminolevulinic acid (δ-ALA) to the expression culture have been used as synthesis of δ-ALA is a rate-limiting step during heme biosynthesis in E. coli.15 The disadvantage of using δ-ALA is the high amount needed, making it expensive for general lab work. In addition, this method alone is not suitable for every protein and needs combination with other optimization methods.16 Accordingly, one approach would be to supply heme to the growth medium for uptake by the bacteria. Unfortunately, common laboratory E. coli strains are not able to take up heme from the environment.17 One method to circumvent this drawback is the so-called heme protein expression system (HPEX). It is based on the coexpression of the heme receptor ChuA with the heme protein of interest.14 ChuA enables the common E. coli lab strains to take up heme from the culture medium.18 The disadvantage of this system, however, is the use of an additional plasmid within E. coli, which limits the use of selection markers, and can also have an impact on growth behavior and yield. Here we describe a new method for the recombinant production of heme proteins using the non-pathogenic E. coli strain Nissle 1917 (O6:K5:H1), EcN. This strain is a probiotic bacterium used to prevent digestive disruption.19-21 Notably, EcN possesses a chromosomal copy 3 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 26

of the gene encoding the heme receptor ChuA.22-24 ChuA is involved in heme uptake for iron supply and enables EcN to take up heme from the culture medium. We came across the issue of heme incorporation while studying the heme-containing sensor kinase MsmS from the methanogenic Archaeon Methanosarcina acetivorans. MsmS is a multidomain protein consisting of alternating PAS- and GAF-domains fused to a histidinekinase-like domain. A covalently bound heme-cofactor has been mapped to the second GAF domain. MsmS is thought to serve as a redox sensor in M. acetivorans, as the redox state of the heme-iron controls autophosphorylation activity of the kinase module.25 Expression of msmS or a truncated version containing only the heme-containing GAF domain (termed sGAF2) in E. coli BL21(DE3) resulted in only 10% holo-protein. From there on, the method of choice to obtain 100% holo-protein was to incubate the bacterial cell-free extract with hemin (i.e. heme reconstitution) followed by affinity chromatography.25 Spectral analysis (UV-Vis, Resonance Raman and magnetic circular dichroism), however, revealed that the protein contained a mixture of heme iron spin states and coordination structures.25 We therefore started to explore alternatives for heme incorporation to evaluate whether the observed heterogeneity in spin and coordination states arose from the heme incorporation method or whether it is a naturally occurring phenomenon. In order to test whether the system is of general use also for other heme proteins, we also applied the method to a heme/nitric oxide/oxygen (H-NOX) binding protein from Dinoroseobacter shibae, the heme-binding protein PhuS from Pseudomonas aeruginosa and the catalase-peroxidase KatG from E. coli. Here we show that E. coli Nissle 1917 can be efficiently used to produce holo-heme proteins with high yield and more importantly, correct heme incorporation.


Page 5 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

MATERIALS AND METHODS Used strains and expression plasmids. For the production of heme proteins the Escherichia coli strains BL21(DE3), BL21(DE3)-pHPEX3-Kan and Nissle 1917 were used (Tab. 1). Heme proteins with a C-terminal fused StrepII-tag were produced using a tet promoter-driven expression system (IBA). The gene katG was amplified from genomic DNA of E. coli DH10B using primers katG-BsaI-fwd and katG-BsaI-rev (Tab. 1). The PCR fragment was cut with BsaI and ligated into the expression vector pASK-IBA3, cut with the same enzyme. The gene phuS was cloned with a N-terminal His6-tag into the second multiple cloning site of pACYCduet1. For the co-expression of the heme receptor ChuA with the heme proteins, the plasmid pHPEX314 was used as a basic vector. In order to use anhydrotetracycline for induction of gene expression, a kanamycin resistance cassette was cut with EcoRI from pYBRUB311-I and cloned into the EcoRI restriction site of pHPEX3 for selection instead of tetracycline (Tab. 1). Table 1. Strains, plasmids and oligonucleotides used in this study plasmid

relevant characteristics

reference 14

pHPEX3 pHPEX3-Kan pASK-IBA3 pASK-msmS-sGAF2 pASK-katG

Kanr inserted in EcoRI Expression vector, AmpR MA4561-sGAF2 inserted into pASK-IBA3 E. coli katG inserted into pASK-IBA3

pASK-2815(hnox)

D. shibae orf2815 inserted into pASK-IBA3

pASK-msmS

M. acetivorans MA4561 inserted into pASK-IBA3 P. aeruginosa phuS inserted in 2nd MCS of pACYCDuet1, Nterminal His6-tag Source of Kanr resistance cassette genotype F– mcrA ∆(mrr-hsdRMS-mcrBC) Φ80lacZ∆M15 ∆lacX74 recA1 endA1 araD139 ∆(ara leu) 7697 galU galK rpsL nupG λ– F– ompT gal dcm lon hsdSB(rB- mB-) λ(DE3)

25

BL21(DE3) [pHPEX3-Kan Kanr Tetr ]

this study

Serotype O6:K5:H1 Sequence (5’-3’), restriction site in italics ATGGTAGGTCTCAAATGAGCACGTCAGACGATATCC ATGGTAGGTCTCAGCGCTCAGCAGGTCGAAACGG

22

pAHP4 pYPRUB311-I E. coli strain DH10B BL21(DE3) BL21(DE3) pHPEX3Kan Nissle 1917 oligonucleotide katG-BsaI-fwd katG-BsaI-rev

1

this study IBA GmbH 25

this study lab collection1 lab collection1 B. Masepohl Invitrogen 26

this study this study

cloning strategies for the lab collection plasmids are available upon request from the corresponding author.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 26

Recombinant protein production in E. coli BL21(DE3). E. coli BL21(DE3) containing the respective plasmid(s) was grown at 37 °C in LB medium supplemented with 100 µg/mL ampicillin for sGAF2 and KatG production. The cultures were incubated to an OD578 of ~0.5 and cooled down to 17 °C. Gene expression was induced with 200 ng/ml anhydrotetracycline and the cells were further incubated for 18-20 h at 17 °C. After harvesting cells, the pellet was either frozen at −20 °C or directly used for protein purification. For the co-expression experiments, the plasmid pHPEX3-Kan was used to express the heme receptor ChuA. Co-expression was performed as described for single expression of sGAF2 with the exception that the co-expression culture contained 25 µg/mL kanamycin and 50 µg/mL ampicillin expression of of chuA was induced by 1 mM isopropyl ß-thiogalactoside. Immediately before induction, 10 µM hemin (H9039 Sigma; freshly made 50 mM stock in dimethylsulfoxide) was added to the growth medium. After addition of hemin, the cultures were incubated in the dark. Recombinant heme protein production in E. coli Nissle 1917. Expression plasmids were transformed into into CaCl2 competent EcN cells .27 LB-agar plates were incubated overnight at 30 °C. Competent EcN cells were stored at −80 °C for not longer than three months. Expression in EcN was performed as described before for the expression in BL21(DE3) with the exception that the cultures were grown to an OD578 of ~1.2 before cooling down and induction. Directly before induction, 10 µM hemin was added and cultures were incubated overnight at 17 °C in the dark. The production of full-length MsmS was realized without additional heme in the growth medium. Protein production under anaerobic conditions was performed using sealed serum bottles in buffered (20 mM 3-(N-morpholino)propane sulfonic acid pH 7.0) 2YT medium containing 20 mM NaNO3. All other steps were done as described for aerobic expression. Cells were harvested under anoxic atmosphere using an anaerobic glove box (COY laboratories, Grass Lake, MI, USA). Purification of recombinant produced StrepII-tagged proteins. Cell pellets were suspended in buffer W (100 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM EDTA, 0.25 mM 4-(2aminoethyl)benzene-sulfonyl fluoride (for stabilization of MsmS 5% glycerol and 0.05% Tween20 were added). For sGAF2 and MsmS, 1 mM 1,4-dithiothreitol was added to buffer W. A StrepTactin chromatography column (IBA GmbH, Göttingen) was used for affinity chromatography and was equilibrated with buffer W. For washing off unwanted proteins, 10 column volumes of buffer W were used. Elution of StrepII-tagged proteins was performed with buffer E (buffer W containing 2.5 mM D-desthiobiotin). Elution fractions containing the desired protein were 6 ACS Paragon Plus Environment

Page 7 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

dialyzed and concentrated using Vivaspin concentrator devices (molecular weight cut-off 10,000 and for MsmS 50,000; Satorius Stedim Biotech). Anaerobic purifications were done in an anaerobic glove box employing degassed buffer solutions. Purification of recombinant produced His6-tagged proteins. Cell pellets were suspended in buffer WHis (50 mM Tris/HCl pH 7.0, 300 mM NaCl, 10 mM imidazole). For affinity chromatography a TALON resin affinity column (Clontech Lab.) was used and equilibrated with H2O and buffer WHis. For removing unwanted proteins the resin was washed with 20 column volumes of buffer WHis. Elution was done with buffer EW (buffer WHis with 150 mM imidazole). Elution fractions containing the desired protein were dialyzed and concentrated with Amicon Ultra-4 (PLGC Ultracell-PL membrane, molecular weight cut-off 10,000, Merck). UV-visible spectroscopy. UV-vis spectroscopy was performed using an 8453 UV-visible spectrophotometer (Agilent Technologies) at room temperature in 50 mM phosphate buffer, pH 7.0 containing 100 mM NaCl and for MsmS, additional 5% glycerol and 0.05% Tween-20. UVvis spectroscopy was used to compare the amount of incorporated heme using the three different incorporation methods. Spectra were taken from 350-700 nm in a sealed cuvette. For reduction of the heme iron, the sample was purged with a stream of nitrogen gas for 15 min to create anaerobic conditions and reduced with 5 mM sodium dithionite (NaDT). The Fe(II)-CO complex was obtained by sparkling the reduced sample for 5 min with CO. For preparation of the Fe(II)NO complex, MAHMA NONOate (Sigma-Aldrich) was diluted in buffer and directly added to the sample with a final concentration of 0.5 mM. Resonance Raman spectroscopy. Resonance Raman (RR) spectroscopy was performed using a Kr+ laser at 413 nm excitation (Coherent Innova 300c) coupled to a confocal Raman spectrometer (Jobin-Yvon, LabRam 800 HR) with a back-illuminated CCD detector cooled by liquid N2. The light was focused on the sample using a Nikon 20× objective (N.A. 0.35, WD 20 mm) at ~ 2.0 mW laser power. The spectral resolution was ~. 1.2 cm−1. Typical total accumulation time was 0.5−1 h. Prior to measurements, samples were chemically oxidized or reduced using sodium peroxodisulfate (Sigma-Aldrich, ≥99%) or NaDT (Fluka, ≥82 RT), respectively. Reduction was performed in a box purged with Argon or in an anaerobic glove box. These samples were then flash frozen using liquid N2. All RR measurements presented here were carried out at −120 °C in a cryostat (Linkam Scientific Instruments, Surrey, UJ) mounted on a XY stage (OWIS GmbH, 7 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 26

Germany). The samples were continuously moved through the laser beam to reduce unwanted laser-induced photochemical processes. Spectra were calibrated with respect to mercury lines and the Raman spectrum of toluene. A polynomial function was used for the background subtraction of the spectra. Band fitting and component analysis was carried out according to the procedure described elsewhere.28 Catalase activity assay. Catalase activity was measured spectroscopically by the decomposition of H2O2 in 50 mM phosphate buffer, pH 7.0 and 100 mM NaCl at room temperature.29 Acidified butanone extraction. For the verification of covalently bound heme, acidified butanone extraction was performed as described before.30 An aqueous protein sample was acidified with 1 M HCl to a pH of 1.5-2.0. An equal volume of ice-cold 2-butanone was added, mixed gently and incubated on ice. After cooling, an upper organic phase and a lower aqueous phase were separated. Covalently bound heme stayed in the aqueous phase, while non-covalently bound heme was extracted to the organic phase. Radioactive kinase assays. Autophosphorylation activity of MsmS was assayed using 20 µM protein in 50 mM Tris/HCl, pH 8, 5 mM MgCl2, 100 mM NaCl, 0.2 mM EDTA, 0.2 mM ATP and 0.16 nmol of [γ-32P]ATP (0.0185 MBq) at room temperature. For reduction of the heme iron, NaDT was used. The assay was stopped after different time points by the addition of SDS sample buffer without β-mercaptoethanol. Samples were separated with SDS-PAGE and transferred via electro blot onto a PVDF-membrane. The membrane was exposed to an imager plate for ~16 h at room temperature and the signals were recorded using a phosphor imager (Packard Cyclone PhosphorImager, Perkin Elmer).

RESULTS AND DISCUSSION In order to test whether EcN can serve as a production host for recombinant heme proteins, the model protein sGAF2 of M. acetivorans was employed in test expression experiments. EcN harboring the plasmid pASK-msmS-sGAF2 and heme in the growth medium was compared to the two other existing methods employing BL21(DE3) (heme reconstitution before purification) and BL21(DE3) pHPEX3-Kan (termed HPEX system thereafter; heme in growth medium) harboring the same expression plasmid. Interestingly, expression cultures of EcN exhibited a higher growth rate resulting in a higher final OD578 after the same incubation time compared to the other two systems (data not shown). 8 ACS Paragon Plus Environment

Page 9 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 1. sGAF2 produced by three different heme-incorporation methods. (A) SDS-PAGE of sGAF2 yield obtained by different methods from the same culture volume, (B) Acidified butanone extraction of sGAF2 produced in EcN: (a) organic phase with non-covalently bound and (b) aqueous phase with covalently bound heme cofactor. (C) UV-vis spectroscopy of sGAF2 from E. coli BL21(DE3) with heme reconstitution, (D) E. coli BL21(DE3) with co-expression of the chuA encoding plasmid pHPEX3-Kan and (E) EcN with heme addition to the growth medium. Shown is the ferric form of the heme iron (solid line), the ferrous form (dotted line) and the complex of the ferrous form with CO (dashed line).

Consequently, gene expression in EcN cultures was induced at a higher OD578 of 1.2 to yield a larger cell mass. Total amount of protein produced by the three methods was evaluated by a simple comparison. For each method, an identical aliquot of affinity purified sGAF2 from 1 L bacterial culture was loaded onto a SDS-PAGE. As already expected from the obtained fresh cell weight, the highest amount of protein was produced in EcN and the lowest from the HPEX system (Fig. 1A).14 9 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 26

Quantification revealed that EcN yielded 9.41 mg sGAF2/L bacterial culture, compared to 1.92 mg and 5.16 mg for HPEX and BL21(DE3), respectively. Protein heme saturation by E. coli strain Nissle 1917 Since EcN was shown to produce high amounts of recombinant protein, we next tested the efficiency of heme incorporation into the recombinant protein. Therefore, sGAF2 was produced in EcN with the addition of heme to the culture medium, to the cell-free lysate (heme reconstitution) or to both culture and lysate. Results were compared to protein production without additional heme. Heme saturation was quantified using the RZ value representing the ratio between the Soret band and A280. Previous heme titration experiments resulted in a ~10% heme saturation of sGAF2 when produced in BL21(DE3) without additional heme (RZ= 0.19). The Rz value for heme reconstitution (BL21(DE3)) was set to 100% as an excess of heme was used (RZ= 1.74).25 Production of sGAF2 in EcN with heme addition only to the growth culture (RZ= 1.30) or in excess to the cell-free lysate (RZ= 1.38) resulted in no significant differences (Tab. 2). This demonstrates that the heme addition to the growth medium alone is sufficient for high heme saturation of sGAF2. The values obtained for EcN with heme in the culture medium are comparable to those of the HPEX system (Table 2). Although additional heme reconstitution resulted in an even higher RZ-value of 1.61 (Table 2), we refrained from this additional heme incorporation as this might be the cause for the observed heterogeneity of the sample (see below). For future studies, we therefore decided to add heme only to the growth medium as this might represent the most natural heme reconstitution system. Furthermore, we were able to show that that EcN is able to incorporate more than twice the amount of heme in comparison to BL21(DE3) in the absence of any additional heme (RZ= 0.42). We have previously reported that the heme cofactor is covalently bound to sGAF2 via a single cysteine residue (Cys656).25 To test whether the use of EcN has an impact on covalent heme incorporation, the purified protein was treated with acidified butanone to extract the cofactor. The brownish color of the heme cofactor was observed in the aqueous phase indicating that the heme cofactor is covalently bound to sGAF2 (Fig. 1B).


Page 11 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Table 2. Quantification of heme incorporation into sGAF2

BL21(DE3) w/o heme BL21(DE3), heme reconstitution HPEX, heme in culture EcN w/o heme EcN, heme in culture EcN, heme reconstitution EcN, heme in culture & reconstitution

Purity value Rz (ASoret band/A280) 0.19 1.74 1.36 0.42 1.30 1.38 1.61

heme content 10% 100% 78% 23% 74% 79% 92%

UV-vis spectroscopy of sGAF2 produced with different heme incorporation methods To determine whether the new method employing EcN has any effect on the heme coordination, we characterized the purified protein using UV-vis spectroscopy. Purification of sGAF2 employing all three heme-incorporation methods yielded protein with typical heme spectra (Figure 1 C-E). The heme iron of the three samples was present in its ferric (Fe(III)) state and could be reduced by NaDT. In all three sGAF2 samples, the Soret band for the Fe(III) was observed between 406 nm and 408 nm (Table 3). Addition of NaDT led to the reduction of the heme iron indicated by a shift of the Soret band to longer wavelengths (428−432 nm). The ferrous form of all three samples displayed an additional peak in the visible region at 555 nm with more or less pronounced shoulders at shorter and longer wavelengths (Fig. 1 C-E, Table 3). The spectrum of the Fe(II) form of sGAF2 isolated from BL21(DE3) further showed a charge transfer band at 625 nm. Incubation of the Fe(II) complex with CO lead to a shift of the Soret band to 421 nm and 423 nm (Table 3). In addition, in the Q-band region, significant changes were noticable. While the reconstituted protein displayed two strong β/α-bands in the Q-region, sGAF2 from the other two systems only showed a distinct β-band and a shoulder in the α-band region.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 26

Table 3. Heme absorption maxima (in nm) of recombinant sGAF2 produced by three different methods Method

Fe(III)

Fe(II)

Soret BL21(DE3), heme reconstitution HPEX, heme in culture EcN, heme in culture

Fe(II)-CO

Soret

Soret

β

α

408

-

428

555

625

421

538

567

631

406

504

432

555

-

423

538

(565)

(631)

407

504

432

555

-

423

539

(562)

629

Although only minor differences were seen in the UV-vis spectra, we wished to explore whether incorporation of heme by these methods had an influence of the previously reported heterogeneity of the samples in terms of coordination state. Therefore, Resonance Raman (RR) spectroscopy was employed to compare the protein produced by EcN to that reconstituted from BL21(DE3). Resonance Raman spectroscopy of sGAF2 produced by different methods Unlike a previous study using Q-band excitation25, the present experiments were carried out in resonance with the Soret band (413 nm excitation) to predominantly enhance the totally symmetric modes that are the most sensitive spectral markers for the spin- and ligation state (ν3) and for the electron density distribution in the heme (ν4) (Fig. 2).31 The latter mode is therefore redox-state dependent and typically observed at ~ 1360 and 1373 cm−1 for ferrous and ferric iron porphyrins, respectively.


Page 13 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 2. RR spectra of ferrous (left panel) and ferric sGAF2 (right panel) obtained from E. coli BL21(DE3) (top, red traces) and EcN (bottom, blue traces) grown and purified under aerobic conditions. The solid and dotted traces refer to the samples with and without heme added to the lysate (i.e. reconstitution, only BL21(DE3) or growth culture (EcN only)), respectively. Unlike to the ferrous form, heme addition had no effect on the spin- and ligations state distribution of the ferric state such that here only the spectra from preparations with additional heme are shown. The bands of the HS and LS configurations are highlighted in blue and yellow, respectively.

RR spectra of sGAF2 produced in BL21(DE3) demonstrate a mixture between a high-spin (HS) and six-coordinated low-spin (6cLS) species in both oxidation states, consistent with previous RR and MCD spectroscopic results.25 In the ferrous form (Fig. 2, left panel, red traces), the spectra display distinct doublets of these modes with the low-frequency and high-frequency components corresponding to a HS- and 6cLS configuration, respectively. For the mode ν4, the frequency difference between both components of 11 cm−1 cannot be exclusively attributed to the different spin- and ligation states. Instead, the unusual low frequency of the HS species of 1352 cm−1 points to an increased electron density in the anti-bonding orbitals of the heme. This effect is expected when the axial His ligand serves as a hydrogen bond donor such that excess electron density is transferred to the heme.32 13 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 26

In the ferric state, the coexistence of HS and 6cLS species is clearly reflected by the ν3 modes (Fig. 2, right panel, red trace) which comprise the prevailing 6cLS (ν3 at 1508 cm−1) and fivecoordinated HS species (5cHS; ν3 at 1493 cm−1) as well as a smaller contribution of a sixcoordinated HS form (ν3 at 1479 cm−1). In the ferric state, the ν4 mode frequency is not very sensitive towards changes in the spin- and ligation state and thus the respective frequencies of both configurations overlap to afford a peak position at 1373 cm−1. sGAF2 reconstituted after production in BL21(DE3) displays a higher RR intensity but does not affect the distribution among the various spin- and ligation states in the ferric state. This is in contrast to the ferrous state, for which we note an increased 6cLS contribution at the expense of the HS form upon addition of heme (Fig. 2, solid red line, left) compared to the preparation restricted to the natural heme incorporation (dotted red line). Addition of heme into the growth medium in the EcN sGAF2 preparations has a distinctly smaller effect on the distribution among the various heme configurations (Fig. 2, blue traces), which highlights that the EcN can produce enough heme so that additional heme has no significant influence on the ligation- and spin state distribution and is not necessary for these purposes. Naturally though, similar to the BL21(DE3) preparation, addition of heme increased the amount of heme incorporation as reflected by the higher RR intensities and further confirming the results in Table 2. To summarize these findings, the ferric form of the BL21(DE3) preparation favors the 6cLS configuration over the HS species compared to EcN, regardless of further heme addition to the cell lysate. In the ferrous form, however, heme addition increases the amount of HS but only for BL21(DE3) whereas in the absence of additional heme both preparations give rise to similar spin state distributions. Next we studied the effect of oxygen during growth and purification of sGAF2 from EcN (in each case heme was added into the culture medium) (Fig. 3). Aerobic growth and purification affords a similar spin- and ligations state distribution as anaerobic growth and aerobic purification with the 6cLS and 5cHS species being particularly strong in the ferrous and ferric state, respectively (Figs. 2 and 3). The situation is reversed if, regardless of the growth conditions, purification is carried out anaerobically (Fig. 3). Then the HS species is the prevailing form in the ferrous state whereas in the ferric state the 6cLS configuration represents the major fraction.


Page 15 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 3. RR spectra of ferrous (left panel) and ferric sGAF2 (right panel) obtained from EcN under different conditions. Top (red traces), grown anaerobically but purified aerobically; middle (blue traces), grown aerobically but purified anaerobically; bottom (black traces), grown and purified anaerobically. The bands of the HS and LS configurations are highlighted in blue and yellow, respectively.

Production of MsmS from Nissle 1917, Resonance Raman, and autophosphorylation activity Finally, we tested whether full-length MsmS can also be produced as a functional protein in EcN. Interestingly, during these experiments we observed that EcN produced enough heme itself and 15 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 26

that there was no need to supply heme to the growth medium for spin- and ligation state distribution studies (see also RR spectra shown in Fig. 2, dotted blue trace). Subsequent spectroscopic analysis of the purified protein revealed a Soret band at 412 nm for the ferric form and a shift to 430 nm for the ferrous form. The Fe(II)-complex showed two β/α-bands in the Qregion (536 and 562 nm) indicating a 6-fold heme iron coordination. Incubation of the Fe(II) complex with CO gas lead to the formation of a Fe(II)-CO complex with a Soret band at 424 nm and two slight peaks in the Q-band region (536 and 556 nm) (Fig. 4A). Hence, the distal ligand was likely changed to CO.

Figure 4. UV-vis spectrum and kinase assay of MsmS. (A) UV-vis spectrum of MsmS full-length protein produced in EcN without additional heme; ferric heme iron (solid line) ferrous heme iron (dotted line) and complex of the ferrous heme iron with CO (dashed line).The box in the right corner shows a 4× enlargement of the wavelengths region from 490 nm to 650 nm. (B) Radiolabeled kinase assay of oxidized Fe(III) and reduced Fe(II) state of MsmS. Samples were taken after different time points.

It is now interesting to compare the RR spectra of the full-length protein (Fig. 5) to the sGAF2 produced from EcN (Fig. 2, blue traces). In the ferric state, the spin- and ligation state distributions of the full-length preparation (Fig. 5, blue trace) and the sGAF2 preparations (Fig. 2, left panel, blue trace) are essentially the same, with the 6cLS configuration as the prevailing 16 ACS Paragon Plus Environment

Page 17 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

species. In the ferrous state (Fig. 5, red trace), the HS species represents the prevailing species. We also note that the distributions for the full-length protein are very similar to those observed for the anaerobically purified sGAF2 samples (Fig. 3, black traces), which is dominated by the HS species in the ferrous state. This may indicate that the native state is HS in the ferrous state as observed for the anaerobically purified truncated and the full-length preparations, which are close to the conditions of protein synthesis in the organism, if we consider M. acetivorans as an anaerobic archaeon.33 The considerable extent of LS in the ferrous state obtained from BL21(DE3) and EcN purified aerobically (Fig. 2) may possibly mean that such preparations include a fraction of misfolded protein that give rise to a LS state in the ferrous form.

Figure 5. RR spectra of ferrous (top, red trace) and ferric (bottom, blue trace) full-length MsmS obtained from EcN under aerobic conditions (without any additional heme supplement). The bands of the HS and LS configurations are highlighted in blue and yellow, respectively.

M. acetivorans is a strictly anaerobic archaeon, 33-35 therefore we are inclined to consider that the full-length and anaerobic purifications from EcN are the most closely-related to its natural 17 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 26

conditions. From the RR in both cases, the HS state prevails for the ferrous, and the LS for the ferric state. These states are therefore considered to be the native configurations of MsmS. Autophosphorylation assays with MsmS full-length protein from EcN confirmed earlier results employing E. coli BL21(DE3) as a host strain. Phosphorylation was only observed for the ferric form but not for the ferrous complex (Fig. 4B). Hence, MsmS produced in EcN displays full activity as described previously.25 E. coli Nissle 1917 is a general suitable host for the expression of heme proteins The results employing sGAF2 and full-length MsmS suggest that EcN is a suitable host for the production of heme proteins. To test whether EcN is generally applicable to other heme proteins, three other heme proteins were tested: a heme-nitric oxide/oxygen binding (H-NOX) protein from Dinoroseobacter shibae, the cytoplasmic heme-binding protein PhuS from Pseudomonas aeruginosa and the catalase-peroxidase KatG from E. coli. H-NOX domains function as sensors for the gaseous signaling molecules like nitric oxide (NO) or oxygen in eukaryotes and bacteria.7 The UV-vis spectrum of the H-NOX protein produced in EcN with heme in the growth medium displayed a typical heme UV-vis spectrum. The Soret band for the ferric state was observed at 416 nm and a second peak at 538 nm (Fig. 6). The Fe(III) complex of the H-NOX protein can be reduced to Fe(II) by NaDT and the Soret band shifted to 426 nm. In the visible region two maxima at 531 nm and 559 nm were obtained indicating a 6-coordinated-heme complex. After addition of NO to the Fe(II) complex, the Soret band shifted to 398 nm which signifies the binding of NO to the heme iron typical for H-NOX proteins. No clear maxima was observed in the visible region for the Fe(II)-NO complex (Fig. 6A). The spectroscopic behavior of the H-NOX protein from D. shibae is comparable with the UV-vis spectrum observed for the H-NOX protein from Shewanella oneidensis.36 PhuS is encoded in the phu (Pseudomonas heme uptake) operon in P. aeruginosa and is responsible for the transfer of heme to the heme oxygenase pa-HO.37 PhuS was produced in EcN with addition of heme to the growth medium. The UV-vis spectrum revealed a Soret band at 413 nm for the ferric state. In the visible region a maximum at 539 nm was observed. Reduction with NaDT lead to a shift of the Soret band to 424 nm for the ferrous state and a maximum at 555 nm in the Q-band region (Fig. 6B). This spectrum is similar to former UV-vis measurements of PhuS produced in BL21(DE3)plysS cells with heme reconstitution, but depicts shifts of the peaks (410, 545, 570 nm for the ferric and 428 and 559 nm for the ferrous form).38 18 ACS Paragon Plus Environment

Page 19 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 6. UV-vis spectra of an H-NOX protein from D. shibae and PhuS from P. aeruginosa. Produced in EcN with 10 µM heme in growth medium: (A) H-NOX protein and (B) PhuS. Ferric form of the heme iron (solid line), ferrous form (dotted line) and the complex of ferrous form with NO (dashed line) for the H-NOX protein. The boxes in the right corners show enlargements of the wavelengths region from 490 to 650 nm.

Finally, the catalase-peroxidase KatG from E. coli was used to confirm that the strain EcN is a useful host. An UV-vis spectrum of purified KatG produced in EcN with addition of heme to the growth medium exhibited a Soret band for the Fe(III) state at 408 nm. In the visible region a second peak at 632 nm was obtained. Reduction with NaDT resulted in a shift of the Soret band to a longer wavelength (441 nm) and a second maximum at 560 nm with a shoulder at 590 nm (Fig. 7A). The successful heme incorporation in KatG from EcN is shown in Fig. 7B with overlaid UV-vis spectra of KatG obtained from heme reconstitution and EcN (Fig.7B). In addition to this spectroscopic characterization, we also tested the activity of the produced KatG. To analyze the catalase activity of the purified KatG, the decomposition of H2O2 was followed via UV-vis spectroscopy. KatG from EcN resulted in a decrease of H2O2 absorbance measured at 220 nm within 5 min reaction time. The same result was observed for KatG from BL21(DE3) 19 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 26

after heme reconstitution (Fig. 7C). KatG purified with both methods do not have a significant difference in their activity.

Figure 7. UV-vis spectra and activity of KatG. (A) UV-vis spectrum of KatG produced in EcN with 10 µM heme addition to growth medium: ferric heme iron (solid line) and ferrous heme iron (dotted line). The box in the right corner shows a 7× enlargement of the wavelength region from 490 nm to 700 nm. (B) Comparison of heme incorporation into KatG produced in BL21(DE3) (solid lane) and EcN (dashed line). (C) Catalase activity comparison by H2O2 consumption of KatG produced in E. coli BL21(DE3) with heme reconstitution (solid line) and EcN (dashed line).


Page 21 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

CONCLUSION Within this study we showed that EcN is a very suitable host for the recombinant production of heme proteins. The purified proteins from this host most likely represent the native conformation of the heme best, as the heme cofactor is present at sufficient amounts already during translation. Although the results are similar to the previously described HPEX system, EcN has the advantage of growing to higher cell densities enabling a higher protein yield from a smaller bacterial culture. In addition, the use of EcN renders the use of the pHPEX plasmid unnecessary as EcN encodes the chuA gene on its chromosome.

LIMITATIONS Thus far, the described synthesis of heme proteins within EcN is limited to those encoded on plasmids lacking a T7 promoter. The use of T7 RNA polymerase dependent expression would either require an EcN strain possessing the T7 RNA polymerase gene on its chromosome or a coexpression with a plasmid encoding T7 RNA polymerase.39 Our lab is currently in the process of construction a strain thus facilitation an even broader use of plasmids.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 26

AUTHOR INFORMATION

ORCID NFD: orcid.org/0000-0002-7757-6839

AUTHOR CONTRIBUTIONS KF and NFD conceived the study and planned the experiments, KF performed the biochemical experiments, CJQ performed RR measurements, CJQ and PH analyzed RR data, KF and NFD analyzed the biochemical data, all authors wrote the manuscript. All authors read and approved the final manuscript.

FUNDING The project has been funded by the Deutsche Forschungsgemeinschaft via a grant to NFD and UniCat (EXC414) to PH.

NOTES The authors declare no competing financial interest.

ACKNOWLEDGEMENTS We are thankful to Douglas C. Goodwin (Auburn University, USA) for providing the pHPEX3 plasmid, Ulrich Dobrindt (Münster, Germany) for the gift of E. coli Nissle 1917 and Bernd Masepohl (Ruhr University Bochum) for the gift of pYPRUB311-I. CJQ acknowledge the Deutsche Forschungsgemeinschaft for financing the SALSA Excellence Initiative and is grateful for the helpful discussions with H. K. Ly (University of Cambridge, UK) and I. M. Weidinger (Technische Universität Dresden, Germany).


Page 23 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

ABBREVIATIONS δ-ALA , δ-Aminolevulinic acid; H-NOX, heme/nitric oxide/oxygen ; EcN, E. coli strain Nissle 1917; HPEX, heme protein expression system; sGAF2, truncated MsmS variant with only second GAF domain; 6cLS, 6x coordinated low spin; 5cHS, 5x coordinated high spin; RR, Resonance Raman spectroscopy; AU, absorbance units; NaDT, sodium dithionite


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 26

REFERENCES

[1] Shimizu, T., Huang, D., Yan, F., Stranava, M., Bartosova, M., Fojtíková, V., and Martínková, M. t. (2015) Chem. Rev. 115, 6491-6533. [2] Girvan, H. M., and Munro, A. W. (2013) J. Biol. Chem. 288, 13194-13203. [3] Monson, E. K., Ditta, G. S., and Helinski, D. R. (1995) J. Biol. Chem. 270, 5243-5250. [4] Shelver, D., Kerby, R. L., He, Y., and Roberts, G. P. (1997) Proc. Natl. Acad. Sci. USA 94, 11216-11220. [5] Bilska-Wilkosz, A., Iciek, M., Górny, M., and Kowalczyk-Pachel, D. (2017) Int J Mol Sci 18, 1315. [6] Munro, A. W., and Lindsay, J. G. (1996) Mol. Microbiol. 20, 1115-1125. [7] Plate, L., and Marletta, M. A. (2013) Trends Biochem. Sci. 38, 566-575. [8] Hannibal, L., Somasundaram, R., Tejero, J., Wilson, A., and Stuehr, D. J. (2011) J. Biol. Chem. 286, 39224-39235. [9] Breuer, M., Rosso, K. M., Blumberger, J., and Butt, J. N. (2015) J. Royal. Soc. Interface 12, 20141117. [10] Gundinger, T., and Spadiut, O. (2017) J. Biotechnol. 248, 15-24. [11] Dalton, D. A., del Castillo, L. D., Kahn, M. L., Joyner, S. L., and Chatfield, J. M. (1996) Arch. Biochem. Biophys. 328, 1-8. [12] Metcalfe, C. L., Daltrop, O., Ferguson, S. J., and Raven, E. L. (2007) Biochem. J. 408, 355-361. [13] Sudhamsu, J., Kabir, M., Airola, M. V., Patel, B. A., Yeh, S.-R., Rousseau, D. L., and Crane, B. R. (2010) Protein Expr. Purif. 73, 78-82. [14] Varnado, C. L., and Goodwin, D. C. (2004) Protein Expr. Purif. 35, 76-83. [15] Woodard, S. I., and Dailey, H. A. (1995) Arch. Biochem. Biophys. 316, 110-115. [16] Weickert, M. J., Doherty, D. H., Best, E. A., and Olins, P. O. (1996) Curr. Opin. Biotechnol. 7, 494-499. [17] Mills, M., and Payne, S. M. (1995) J. Bacteriol. 177, 3004-3009. [18] Torres, A. G., and Payne, S. M. (1997) Mol. Microbiol. 23, 825-833. [19] Sonnenborn, U. (2016) FEMS Microbiol. Lett. 363, fnw212-fnw212. [20] Rembacken, B., Snelling, A., Hawkey, P., Chalmers, D., and Axon, A. (1999) The Lancet 354, 635-639. [21] Lodinová-Žádníková, R., Sonnenborn, U., and Tlaskalova, H. (1998) Veterinary Quart. 20, 78-81. [22] Grozdanov, L., Raasch, C., Schulze, J., Sonnenborn, U., Gottschalk, G., Hacker, J., and Dobrindt, U. (2004) J. Bacteriol. 186, 5432-5441. [23] Jacobi, C. A., and Malfertheiner, P. (2011) Digestive Dis. 29, 600-607. [24] Reister, M., Hoffmeier, K., Krezdorn, N., Rotter, B., Liang, C., Rund, S., Dandekar, T., Sonnenborn, U., and Oelschlaeger, T. A. (2014) J. Biotechnol. 187, 106-107. [25] Molitor, B., Stassen, M., Modi, A., El-Mashtoly, S. F., Laurich, C., Lubitz, W., Dawson, J. H., Rother, M., and Frankenberg-Dinkel, N. (2013) J. Biol. Chem. 288, 18458-18472. [26] Studier, F. W., and Moffatt, B. A. (1986) J. Mol. Biol. 189, 113-130. [27] Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press. [28] Ly, H. K., Utesch, T., Díaz-Moreno, I., García-Heredia, J. M., De La Rosa, M. A. n., and Hildebrandt, P. (2012) J. Phys. Chem. B 116, 5694-5702. [29] Beers, R. F., and Sizer, I. W. (1952) J. Biol. Chem. 195, 133-140. [30] Teale, F. (1959) Biochim. Biophys. Acta 35, 543. [31] Parthasarathi, N., Hansen, C., Yamaguchi, S., and Spiro, T. (1987) J. Am. Chem. Soc. 109, 3865-3871. [32] Smulevich, G., Mauro, J. M., Fishel, L. A., English, A. M., Kraut, J., and Spiro, T. G. (1988) Biochemistry 27, 5477-5485. [33] Lessner, D. J., and Ferry, J. G. (2007) J. Bacteriol. 189, 7475-7484. [34] Galagan, J. E., Nusbaum, C., Roy, A., Endrizzi, M. G., Macdonald, P., FitzHugh, W., Calvo, S., Engels, R., Smirnov, S., and Atnoor, D. (2002) Genome Res. 12, 532-542. 24 ACS Paragon Plus Environment

Page 25 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[35] Sowers, K. R., Baron, S. F., and Ferry, J. G. (1984) Appl. Environ. Microbiol. 47, 971-978. [36] Price, M. S., Chao, L. Y., and Marletta, M. A. (2007) Biochemistry 46, 13677-13683. [37] Ochsner, U. A., Johnson, Z., and Vasil, M. L. (2000) Microbiology 146, 185-198. [38] Lansky, I. B., Lukat-Rodgers, G. S., Block, D., Rodgers, K. R., Ratliff, M., and Wilks, A. (2006) J. Biol. Chem. 281, 13652-13662. [39] Tabor, S., and Richardson, C. C. (1985) Proc. Natl. Acad. Sci. USA 82, 1074.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 26

For Table of Contents Use Only

Title: Improved method for the incorporation of heme-cofactors into recombinant proteins using Escherichia coli Nissle 1917 Authors: Kerstin Fiege, Christine Joy Querebillo, Peter Hildebrandt and Nicole FrankenbergDinkel


Improved Method for the Incorporation of Heme Cofactors into

Recommend Documents