Internal Concentration and Time Are Important Modifiers of Toxicity

Aug 4, 2016 - The residual chlorpyrifos-oxon concentration, an acetylcholinesterase (AChE) inhibitor, continuously increased even after the recovery r...
1 downloads 7 Views 2MB Size
Download PDF
Article pubs.acs.org/est

Internal Concentration and Time Are Important Modifiers of Toxicity: The Case of Chlorpyrifos on Caenorhabditis elegans Ji-Yeon Roh, Hyun-Jeoung Lee, and Jung-Hwan Kwon* Division of Environmental Science and Ecological Engineering, Korea University, 145 Anam-ro, Seongbuk-gu, Seoul 02841, Republic of Korea S Supporting Information *

ABSTRACT: The internal concentration of chemicals in exposed organisms changes over time due to absorption, distribution, metabolism, and excretion processes since chemicals are taken up from the environment. Internal concentration and time are very important modifiers of toxicity when biomarkers are used to evaluate the potential hazards and risks of environmental pollutants. In this study, the responses of molecular biomarkers, and the fate of chemicals in the body, were comprehensively investigated to determine cause-and-effect relationships over time. Chlorpyrifos (CP) was selected as a model chemical, and Caenorhabditis elegans was exposed to CP for 4 h using the passive dosing method. Worms were then monitored in fresh medium during a 48-h recovery regime. The mRNA expression of genes related to CYP metabolism (cyp35a2 and cyp35a3) increased during the constant exposure phase. The body residue of CP decreased once it reached a peak level during the early stage of exposure, indicating that the initial uptake of CP rapidly induced biotransformation with the synthesis of new CYP metabolic proteins. The residual chlorpyrifos-oxon concentration, an acetylcholinesterase (AChE) inhibitor, continuously increased even after the recovery regime started. These delayed toxicokinetics seem to be important for the extension of AChE inhibition for up to 9 h after the start of the recovery regime. Comprehensive investigation into the molecular initiation events and changes in the internal concentrations of chemical species provide insight into response causality within the framework of an adverse outcome pathway.

■

INTRODUCTION In most environmental toxicity studies, dose−response relationships have been described using the concentration of toxic compound in the media surrounding test organisms. The initial toxicity response has also been linked to the ambient exposure concentration in biomarker studies in order to evaluate the potential hazards of pollutants. However, it is well acknowledged that only a fraction of the chemicals taken up by the body reaches the target sites is related with toxicological activation. Therefore, as a dose metric, the external concentration may lead to inaccurate estimates of toxicity.1,2 Although the concentration at target sites is the best in describing toxicity, it is difficult to measure target-site concentration, and whole-body internal concentration is considered a sufficient approximation.2−4 However, the internal concentration in the body continuously changes with absorption, distribution, metabolism, and excretion (ADME) processes.5,6 Thus, time is a very important modifier of toxicity, although standard toxicity protocols adopt a duration of fixed exposure. Before reaching an internal steady state, the internal concentration increases with the duration of exposure, and adverse outcomes at the molecular level occur sequentially from the moment the substrate reaches the corresponding target site(s). To better explain adverse outcomes in response to © 2016 American Chemical Society

toxicological indicators at various levels, including molecular markers, it is desired to understand the toxicokinetics and toxicodynamics of chemicals.6 Chlorpyrifos (O,O-diethyl O-3,5,6-trichloropyridin-2-yl phosphorothioate; CP) is an organophosphate insecticide that has been widely used to control agricultural, horticultural, and domestic pests. The well-known mechanism of CP toxicity is via inhibition of acetylcholinesterase (AChE) activity, which catalyzes the hydrolysis of the neurotransmitter, acetylcholine (ACh).7 Although the continuous inhibition of AChE activity leads to paralysis (behavior) and eventually to death,8 CP is a weak inhibitor of AChE. However, CP can be converted, via oxidative desulfuration, to chlorpyrifos-oxon (CPO), which has a high affinity for AChE, leading to its inhibition.9,10 Oxidative desulfuration is mainly catalyzed by the cytochrome P450 (CYP) isozymes.11 These biological activities, i.e., induction of metabolic enzymes (CYPs) and inhibition of AChE, have been used as biomarkers to investigate the initial toxic responses in aquatic organisms as well as terrestrial invertebrates.12−14 Many Received: Revised: Accepted: Published: 9689

June 2, 2016 August 3, 2016 August 4, 2016 August 4, 2016 DOI: 10.1021/acs.est.6b02751 Environ. Sci. Technol. 2016, 50, 9689−9696

Article

Environmental Science & Technology

PDMS sheets for passive dosing were described in Text S1 of the Supporting Information. One PDMS sheet was placed into each well of a 6-well-plate followed by the addition of 10 mL of K-media (0.032 M KCl and 0.051 M NaCl). The aqueous medium and PDMS phases were pre-equilibrated for 24 h before worms were added. The 100 μL volume of worm condensate was introduced to the test medium containing CP, and all worms were collected for analysis. Three tests (test I, II, and III) were conducted, and experimental details are presented in Text S2 and Table S1 of the Supporting Information. In test I, worms were exposed to four different concentrations of CP (0.03, 0.06, 0.15, and 0.30 mg L−1) for 1, 2, 4, 6, and 8 h in order to identify the inhibition of AChE activity according to CP exposure concentration and duration. In test II, we monitored the changes in toxic responses (i.e., mRNA expression and AChE inhibition) caused by different CP exposure durations (2, 4, 6, and 8 h) at 0.30 mg L−1. Recovery of toxic responses was also monitored by placing worms in a clean agar medium for 24 h. In test III, an extensive time-course monitoring of gene expression and AChE activity including the internal concentration of CP and CPO was conducted using 4 h exposure regime followed by 48 h recovery regime. Cytochrome P450 Family Gene Expression. The expression of CYP family genes in C. elegans was analyzed using quantitative real-time PCR (qRT-PCR). Worms were homogenized in a glass Dounce tissue grinder (Wheaton, Millville, NJ), and total mRNA was extracted with a NucleoSpin RNA kit (Macherey-Nagel GmbH & Co., Düren, Germany). Quantitative RT-PCR amplifications were performed using iQ SYBR Green Supermix (Bio-Rad) on an Eco Real-Time PCR System (Illumina, San Diego, CA, U.S.A.). Primers specific for cyp35a2 and cyp35a3 genes were designed according to sequences retrieved from the C. elegans database (www.wormbase.org; cyp35a2 [C03G6.15]: forward primer-5′ CCACGTGAGCATTGCGGATTATGA 3′; cyp35a3 [K09D9.2]: forward primer-5′ ATGGCGGATGCTCAAGAAATAGCG 3′). Three or five replicates were conducted for each sample, and gene expression was normalized using the glyceraldehyde 3phosphate dehydrogenase (GAPDH) gene, gpd-1. Statistical differences between the control and exposed worms were determined by a parametric t test. Acetylcholinesterase Activity. Worms were collected from experimental plates at each sampling time, pooled, and homogenized in 2.5 mL of Tris-EDTA buffer (40 mM, pH 7.8; Sigma-Aldrich, St. Louis, MO, U.S.A.) for AChE activity measurements. Crude homogenate was centrifuged for 30 min at 12,000 rpm (4 °C). The resultant supernatant of the postmitochondrial fraction was used to measure AChE activity using the method described by Ellman.25 Enzymatic activity was calculated relative to the protein content of the extracts, as measured by the Bradford method.26 Sample Preparation for CP and CPO Analysis in C. elegans. C. elegans were collected during the exposure and the recovery regime (total time 52 h) at each sampling time (details in Table S2 of the Supporting Information). Samples were ground in a glass Dounce tissue grinder with 0.5 mL cold methanol and a further 0.5 mL of methanol was used to rinse glass surfaces and the pestle. Whole samples were sonicated in an ultrasonic bath for 5 min and then centrifuged at 12,000 rpm and 4 °C for 15 min. The supernatant was collected and stored at 4 °C until analysis. Internal concentrations of CP and CPO were calculated based on the initial biomass of C. elegans because worms were

studies have investigated the inhibition of AChE activity for better understanding of the relationship between toxicity of organophosphate pesticides on the cellular level and the organism level responses using vertebrates and invertebrates.8,13−18 For example, Sanchez-Hernandez et al. 12 suggested that the rapid formation of CPO produced by the main detoxifying enzymes CYP 450s would explain the strong inhibition of AChE activity. To extend our understanding of the adverse outcomes of CP exposure, an investigation of changes in biological responses over time and evaluation of the fates of chemicals in the body are needed. The main goal of the present study was to investigate changes in the expression of genes associated with CYP metabolism and changes in AChE inhibition in accordance with the residual amount of CP and CPO in the body over time. Biological responses and changes in the internal concentrations of chemicals were monitored over time with 4 h exposure, followed by 48 h recovery. Passive dosing was used as the exposure method to exclude any uncertainties with CP concentration in the medium.19,20 Polydimethylsiloxane (PDMS) was used as the dosing phase, and the desired free concentration of CP in the exposure media was maintained constantly during the exposure regime. The soil nematode, Caenorhabditis elegans, was used as a model species because earlier studies have reported that P450 enzymes in C. elegans were up-regulated in response to various xenobiotics, and cyp35a family genes in C. elegans were the major contributors to the metabolism of organophosphate pesticides, such as CP and fenitrothion.18,21−24 Activation of CP catalyzed by CYPs was analyzed indirectly through changes in the expression of metabolism-related genes, cyp35a2 and cyp35a3, expressed greatly when C. elegans was exposed to CP in our previous study.18 In addition, AChE activity was measured over time as a biochemical indicator of the effects of CYP metabolism. The internal concentrations of CP and CPO were analyzed using HPLC-MS/MS at various time points during the experimental period. Finally, observed changes in the biomarkers were explained using time-course changes in the body residue concentrations of CP and CPO.

■

MATERIALS AND METHODS Organism. The wild-type C. elegans Bristol strain N2 was used as a model species. Worms were maintained on nematode growth medium (NGM) at 20 °C and fed Escherichia coli strain OP50. Young adults (3.5 days old) from age-synchronized cultures were used for all experiments, and 100 μL of worm condensate was transferred to the test medium (average tissue dry-weight: 10 mg/100 μL). Materials and Chemicals. CP was selected as the model hydrophobic chemical. CP was purchased from Sigma-Aldrich (CAS No. 2921-88-2, cat. 45359; St. Louis, MO, U.S.A.), and CPO was purchased from Dr. Ehrenstorfer GmbH (CAS No. 5598-15-2, cat. DRE-C11603000; Munich, Germany). Chlorpyrifos-diethyl-d10 was used as an HPLC internal standard for CP and was purchased from Santa Cruz Biotechnology (cat. Sc234352; Dallas, TX, U.S.A.). Medical grade PDMS sheets were purchased from Specialty Silicone Products Inc. (cat. SSPM8232; Ballston Spa, NY, U.S.A.). Methanol (HPLC grade) was purchased from Honeywell Burdick and Jackson (Ulsan, Korea). Test Conditions. PDMS sheets were prepared to maintain the intended CP concentration in the test media as described in our previous study.18 Methodological details of preparing 9690

DOI: 10.1021/acs.est.6b02751 Environ. Sci. Technol. 2016, 50, 9689−9696

Article

Environmental Science & Technology

Figure 1. Schematic description of toxicokinetic and toxicodynamic processes in C. elegans initiated by the exposure to chlorpyrifos (CP).

Instrumental Analyses. Concentrations of CP and CPO were determined by liquid chromatography−tandem mass spectrometry (LC-MS/MS). LC-MS/MS analysis was performed on an Agilent HP1200 series liquid chromatograph system (Agilent Technologies, Waldbronn, Germany) coupled to an API 3200 QTRAP mass spectrometer (ABSciex, Concord, Canada). Samples were separated by injecting 10 μL onto a Waters Atlantis dC-18 column (3.0 μm, 50 mm × 2.1 mm, Waters, Milford, MA, U.S.A.). The mobile phase used deionized water (A) and methanol (B) with the following multistep gradient:27 0−3 min: 70/30 (A/B, v/v) to 10/90 (A/ B, v/v); 10 min: 10/90 (A/B, v/v); 10−10.5 min: 10/90 (A/B, v/v) to 70/30 (A/B, v/v); 10.5−13 min: 70/30 (A/B, v/v) at a flow rate of 0.20 mL/min. The mass spectrometer employed an electrospray ionization (ESI) probe as an ion source that was operated in positive mode with multiple reaction monitoring and under the following conditions: ion spray voltage (IS), ion source temperature (TEM), declustering potential (DP), and entrance potential (EP) were 5500 V, 500 °C, 46 V, and 6.5 V, respectively. The MS/MS transitions of m/z 351.8 → m/z 199.9 and m/z 335.8 → m/z 279.8 were monitored for CP and CPO, respectively. Analyst software 1.4.2 was used for instrument control and data acquisition. The extraction recovery of CP and CPO, evaluated at the three concentrations of CP and CPO spiked into the collected worms (0.1, 0.3, and 0.5 mg L−1), were 90.0 ± 7.3 and 84.0 ± 5.3%, respectively.

not fed during the exposure regime. During the recovery regime, feeding worms resulted in new eggs and juveniles in NGM. After successful separation of new generations below the L4 juvenile (for the detailed experimental separation procedure, please refer to Text S2, Supporting Information), biomass of adult C. elegans was assumed to be the same as the initial mass. Single-Compartment Toxicokinetic Model. Biological processes regarding the expression of genes and AChE inhibition are schematically presented in Figure 1. Among those processes, toxicokinetic processes that determine the internal concentrations of CP and CPO in C. elegans can be described using a single compartment toxicokinetic model as follows: dCCP = k uCw − kdCCP − rmet dt

(1)

dCCPO = rmet_CPO − k lossCCPO dt

(2)

where CCP and CCPO are whole-body concentrations of CP and CPO [mol kgdw−1], ku is the uptake rate constant [L kg−1 h−1] from the constant aqueous concentration of CP maintained by passive dosing, kd is the depuration rate constant other than metabolic transformation [h−1], rmet is the overall metabolic transformation rate of CP [mol h−1], rmet_CPO is the metabolic rate forming CPO [mol h−1], and kloss is the first order elimination rate constant of CPO [h−1]. If metabolic transformation is regarded as a pseudo-firstorder process, rmet and rmet_CPO are given as

rmet = k metCCP

(3)

rmet_CPO = k met_CPOCCP

(4)

■

RESULTS AND DISCUSSION Identification of Toxic Response and Recovery Using Two Biomarkers at Different Levels. In our previous study, the expression of genes associated with the CYP metabolism in C. elegans increased linearly with time and exposure concentration when worms were exposed to CP using the passive dosing method.18 Figure 2 also shows that the AChE activity was increasingly inhibited with exposure time and concentration (test I). After 4-h exposure to 0.03, 0.06, 0.15, and 0.3 mg L−1 CP, AChE activity was inhibited by 30%, 47%, 55%, and 74%, respectively, compared with the control. When worms were exposed to 0.3 mg L−1 of CP, no significant

where kmet and kmet_CPO are first-order metabolic rate parameters which are often assumed constant. Metabolic transformation of CP is related with the activation and the amount of metabolizing enzyme. For simplicity, the rate parameters are thought to be proportional to the concentration of metabolizing enzymes that might change with the expression of cyp genes. 9691

DOI: 10.1021/acs.est.6b02751 Environ. Sci. Technol. 2016, 50, 9689−9696

Article

Environmental Science & Technology

AChE activity is likely due to slow dephosphorylation of enzyme as forming stable bonds.28−30 However, the inhibition of AChE activity is closely connected with the residual concentration of CPO, which is known as a source substance of CP toxicity. Internal concentration of CPO was investigated in test III. The free concentration of CP in the medium in equilibrium with the dosing phase (PDMS) was maintained constant during the experimental duration as shown in our previous study.18 The chemical depletion from the dosing phase was calculated approximately 0.5%, fulfilling a negligible depletion criteria (∼5%) of passive dosing.31 The results shown in Figure 2 and Table 1 indicate that time modifies biological reactions at the cellular level. Spurgeon et al.32 described a level of hierarchal biological organization that is dependent upon the concentration of chemical exposure, meaning that the initial effects (e.g., changes at the molecular level) appeared during low levels of stress (e.g., the low level of internal chemical) and will eventually lead to changes in life history parameters. Before a steady state is reached, the internal concentration of a chemical changes over time according to ADME processes, especially at the initial stage of the toxic response.1,33 That is, time is an important parameter that determines the initial effect of pollutants along with internal concentration.34 Although difference in the observed maximal toxicity might be due to short exposure and recovery time in this study, it is common that many toxicity studies have applied a fixed duration of exposure for practical reasons and reported different levels of toxic responses at the same level of exposure.35,36 This indicates that a fixed-duration test provides only a snapshot of the enzymatic status and might not be enough to reach specific conclusions. Complex biological cascades in response to a toxic chemical may not be fully understood because snapshot results were identified when observed at a fixed time. Thus, it is necessary to analyze the kinetics of the initial response at a molecular level, which include the investigation of gene and protein expression. Changes in Concentration of Chlorpyrifos and Chlorpyrifos Oxon in C. elegans. The concentrations of CP and CPO residues measured during the exposure and recovery regimes are shown in Figure 3. The residue of CP in the body reached the highest concentration of 2.1 mg kgdw−1 10 min after the beginning of exposure and then stabilized to about 1.6 mg kgdw−1, although this change is not statistically significant. When worms entered a recovery regime, the CP concentration rapidly declined by 50% of the stable concentration observed 30 min into the exposure regime, and then started to decrease gradually. At 36 h from the beginning of the recovery regime, the body residue concentration of CP could not be detected. However, the CPO concentration

Figure 2. Acetylcholinesterase (AChE) activity in Caenorhabditis elegans continuously exposed to chlorpyrifos (CP; 0.03, 0.06, 0.15, and 0.3 mg L−1) for 1, 2, 4, 6, and 8 h using the passive dosing method. The results are analyzed as unit per milligram of protein (significantly different from the control, *p < 0.05, **p < 0.01; n = 3). Error bars represent standard error of the mean.

changes in physiological activity of C. elegans, such as survival and behavior, were observed, although prolonged exposure up to 24 h to this concentration resulted mortality.18 Roh et al.21 reported that the 24-h LC50 of CP in C. elegans was 0.966 mg L−1. When worms were exposed to a sublethal concentration of 0.1 mg L−1 CP, AChE activity was inhibited by 20%. However, no significant effect of CP exposure on the body length or on the number of eggs per worm was observed. Although the exposure concentration of 0.3 mg L−1 is 3 times that in the previous study, it corresponds to LC10. The total exposure period is short (4 h) to observe organism level responses. The inhibition of AChE activity was not intensified after 4-h exposure to CP regardless of CP concentrations. Thus, 0.3 mg L−1 CP for 4 h was chosen to monitor the changes in toxic response including recoveries in tests II and III. In test II, changes in the expression of cyp35a2 and cyp35a3 genes and inhibition of AChE activity were monitored during the recovery regime (Table 1). Gene expression in all experimental samples was similar to that in the control group regardless of the duration of exposure at the end of the recovery regime. Although gene expression increased up to 4.7-fold (cyp35a2) and 3.5-fold (cyp35a3) compared with the control for the 8-h exposure, expression returned to levels similar to that observed in the control during the 24-h recovery regime. However, the recovered enzymatic activity following a 24-h clearance period was less than that of the control by at least 40% except for the case with a shorter exposure (1 h). When worms were exposed to CP for the longest duration (6 h), enzyme activity did not recover for 24 h. A slow recovery of

Table 1. Changes in Gene Expression and Enzymatic Activity in Caenorhabditis elegans after 24-h Recoverya 2hE cyp35a2 gene expression cyp35a3 gene expression acetylcholinesterase activity

2 h E/24 h R

2.00 ± 0.35* 1.07 ± 0.10 1.72 ± 0.28* 1.11 ± 0.05 1hE 1 h E/24 h R 0.88 ± 0.22**

0.93 ± 0.01*

4hE

4 h E/24 h R

2.66 ± 0.65* 1.14 ± 0.09 2.13 ± 0.38* 1.15 ± 0.07 2hE 2 h E/24 h R 0.45 ± 0.08**

0.59 ± 0.05*

6hE

6 h E/24 h R

3.52 ± 1.09* 1.09 ± 0.04 2.82 ± 0.77* 1.12 ± 0.08 4hE 4 h E/24 h R 0.27 ± 0.07**

0.38 ± 0.03**

8hE 4.73 ± 1.36* 3.45 ± 0.88* 6hE 0.22 ± 0.16**

8 h E/24 h R 1.23 ± 0.09 1.25 ± 0.08 6 h E/24 h R 0.24 ± 0.01**

Worms were exposed to 0.3 mg L−1 chlorpyrifos (CP) for each different CP exposure duration (1, 2, 4, 6, and 8 h) before being moved onto clean nematode growth medium (NGM). The expression of cyp35a2 and cyp35a3 genes was analyzed using quantitative real-time PCR and normalized to the expression of gpd-1. Inhibition of acetylcholinesterase (AChE) activity was analyzed as unit per milligram of protein (significantly different from control, *p < 0.05, **p < 0.01; n = 5). E represents exposure duration. R represents recovery duration. a

9692

DOI: 10.1021/acs.est.6b02751 Environ. Sci. Technol. 2016, 50, 9689−9696

Article

Environmental Science & Technology

Figure 3. Changes in the internal concentration of chlorpyrifos (CP) and chlorpyrifos-oxon (CPO). Worms were collected during the exposure (4 h) and recovery (48 h) regimes at each sampling time (25 points). In the exposure regime, 0.3 mg L−1 CP was introduced to Caenorhabditis elegans by passive dosing to control for the free concentration in the test medium. The internal concentrations were calculated as milligram per kilogram tissue dry weight (dw). All experiments were performed with five replicates. Dashed line indicates the predicted concentration of CP. Error bars represent standard error of the mean.

Figure 4. Changes in gene expression and enzymatic activity. Worms were collected during the exposure (4 h) and recovery (48 h) regimes at each sampling time (17 points). During the exposure regime, 0.3 mg L−1 CP was introduced to Caenorhabditis elegans using the passive dosing method to control for the free concentration of chemicals in the test medium. The expression of cyp35a2 and cyp35a3 genes was analyzed using quantitative real-time PCR, and values were normalized to those for gpd-1. Inhibition of acetylcholinesterase (AChE) activity is analyzed as unit per milligram protein (significantly different from the control, *p < 0.05, **p < 0.01; n = 5). Error bars represent standard error of the mean.

the best-fit value of kmet during the exposure regime is 9.0 h−1 (Figure 3), which is much greater than 0.21 h−1. This toxicokinetic analysis suggests that metabolic transformation rate is not explained by the first-order kinetics with a constant kmet. In the presence of CP during the exposure regime, activation of CYP proteins is likely to increase the apparent rate significantly. The initial peak of CP concentration around 10 min followed by a steady value of 1.6 mg kgdw−1 could be due to metabolic induction, although it is not statistically significant. This can be explained by the continuous uptake of CP inducing the activation of CP detoxification in C. elegans as described in Figure 1. The synthesis of new CYP metabolic proteins via transcription and translation might explain the increasing biotransformation rate during the exposure regime as a process of CP detoxification. Although the concentration of the CYP protein was not measured, increased transcription of metabolism-related mRNA suggests that protein synthesis was active. Xia et al.41 observed a similar trend for selected polycyclic aromatic hydrocarbons (PAHs) in zebrafish. They

increased continuously from the beginning of experiment, and the value peaked at 0.3 mg kgdw−1 2 h after the recovery regime started. Thereafter, the CPO concentration rapidly decreased and was not detected from 16 h. CP is a lipophilic chemical with a log Kow value of 5.0,37 and is known to be rapidly transformed in the body of various organisms such as rats, fishes, and invertebrates.38,39 The decrease in CCP during the recovery regime could be explained using eqs 1 and 3 assuming metabolic transformation is the dominating removal mechanism of CP and is described by firstorder kinetics. As shown in Figure 3, this approximation fits well with experimental data, and kmet was estimated as 0.21 h−1 during the recovery regime. Using the same value of kmet during the exposure regime, however, the uptake rate constant (ku) should be as low as 2 L kgdw−1 h−1, and this slow uptake does not fit the experimental data well. Area to weight ratio of C. elegans is about 60 m2 kgww−1, and the ku for aquatic organisms with similar size is thought to be in the order of 100 L kgww−1 h−1 on wet weight basis.40 Assuming that ku is 50 L kgdw−1 h−1, 9693

DOI: 10.1021/acs.est.6b02751 Environ. Sci. Technol. 2016, 50, 9689−9696

Article

Environmental Science & Technology

During the recovery regime, worms did not uptake CP, and the internal concentration of CP decreased rapidly within 30 min. In Figure 4, the elevated rate of mRNA expression during the exposure regime also decreased rapidly in the beginning of the recovery regime. The decrease in mRNA expression reduced mRNA transcription and the subsequent synthesis of new proteins. The transcription of genes associated with CYP metabolism in response to an internal signal induced by CP uptake was more rapid and sensitive than the activation of CYP protein synthesis. Golding et al.45 measured levels of fluorescent-labeled mRNA and protein at the same target sites in living cells. The mRNA fluorescence signal increased immediately, whereas that associated with protein increased much slower. There is a gap between the transcription of mRNA from DNA and the activity of the encoded protein after signal induction. During the recovery regime, the metabolic transformation of CP to CPO was likely to occur by a previously synthesized CYP protein, even though the transcription of mRNA was significantly reduced. Evidence for this time lag was provided by the continuous increase in CPO up to 2 h after the end of exposure. The continuity of CPO formation in the recovery regime seems to be an important factor leading the extension of AChE inhibition. All toxicological responses in organisms exposed to environmental pollutants should be time-dependent. The residue concentration of toxicants may vary with exposure and recovery time according to species-specific ADME processes. Thus, reactions in the biological cascade that lead to adverse outcomes at the molecular, cellular, tissue, and organism levels should also be time-dependent. The adverse outcome pathway (AOP) is a challenging conceptual framework that can facilitate the use of biomarkers for environmental risk assessment. Biomarker responses that can be contextualized in an AOP gain predictive and diagnostic credibility through their links to the initiating event and the fate of chemical in the body.46 The wellexplained cause-effect relationship over time between biological responses and the internal chemical concentration in this study supports the notion that molecular-level biomarkers in an AOP may be an alternative endpoint for environmental risk assessment. Furthermore, the overall results would help develop a potential TK−TD model for the environmental risk assessment of organophosphate pesticides to target various environmental species.

also adopted the passive dosing method to maintain a constant free concentration of chemicals in the test medium. The concentration of PAHs in the body increased at the initial exposure stage and was followed by a sharp decrease to a stable residue level. Xia et al. suggested that these results were likely caused by the increasing elimination rate constant including biotransformation. Despite species differences, the findings of their study are consistent with the temporal changes in CP and CPO levels in C. elegans as well as CYP gene expression and AChE inhibition. Several isoenzymes of the CYP family catalyze CP dearylation/dealkylation, which are considered detoxification reactions resulting in the generation of 3,5,6-trichloropyridinol (TCP). The detoxification metabolite TCP is formed more readily than CPO in most species,27 and some CPO produced may be transformed to TCP by plasma oxonases (PON1) (Figure 1).9,42 The measured concentration of CPO in the body was more than 1 order of magnitude lower than that of CP, likely due to the formation of TCP and other metabolites that were not quantified in this study. CPO formation in the body is very important because it causes the neurotransmitter acetylcholine to accumulate at neural junctions by inhibiting the activity of AChE. In Figure 3, the formation of CPO is shown to continually increase up to 2 h after the initiation of the recovery regime. Although changes of CCPO could not be modeled using eq 2 because rmet_CPO is not likely to be described by first-order kinetics (eq 4), measured changes of CCPO suggests that loss rate of CPO is slow, and CCPO was affected by the residual CP in the body and CYP metabolism. Association between Metabolic-Related Gene Expression and AChE Activity. Figure 4 shows the extended time-course of the expression of cyp genes and AChE activity following 4-h exposure and a subsequent 48-h recovery regime (test III). The gene expression and enzyme activity were normalized to response at time zero. Because 48 h is not a long period compared to the entire life span of C. elegans (40−50 days),43 we defined the baseline of toxic response as that at time zero. The expression of cyp genes increased during the 4-h exposure regime, and thereafter, gene expression decreased during the recovery regime. Four hours into the recovery regime, the expression of cyp35a2 and cyp35a3 genes decreased dramatically by up to 50% of the maximum expression level. After 16 h, the expression levels of cyp35a2 and cyp35a3 genes were not statistically different from those of the control. During the exposure regime, AChE activity was less than 30% of that in the control. AChE activity remained inhibited for about 9 h after the end of the exposure regime, which is in contrast to the results observed for gene expression. Enzymatic activity recovered slightly from 10 h in the recovery regime and reached 89% of that observed in the control after 48 h. The expression of genes related to CYP metabolism is an indirect index of phase I metabolism by the CYP protein. Many studies have investigated the up-regulation of P450 enzymes in C. elegans in response to various xenobiotics, such as PCB52, fluoranthene, benzo[a]pyrene, fenitrothion, and CP, and cyp35 genes have been shown to be strongly inducible by them.23,44 Among cyp35 genes, cyp35a2 and cyp35a3 genes acted to metabolize the organophosphate pesticides, CP and fenitrothion, to a more toxicologically active metabolite as shown in our previous studies.17,18 Although no increase in the activation of CP catalyzed by CYPs was measured, this could be inferred by changes in the expression of CYP metabolic-related mRNA over time.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.est.6b02751. Methodological details for passive dosing test are mentioned in Text S1. Methodological details for experiments are mentioned in Text S2. Experimental conditions are shown in Table S1. Time points for sample collection are shown in Table S2. Tables S3, S4, and S5 present measured values of acetylcholinesterase activity in test I, changes in the internal concentration of CP and CPO in test III, and changes in cyp35 gene expression and AChE activity in test III, respectively. (PDF) 9694

DOI: 10.1021/acs.est.6b02751 Environ. Sci. Technol. 2016, 50, 9689−9696

Article

Environmental Science & Technology

■

(14) Fulton, M. H.; Key, P. B. Acetylcholinesterase inhibition in estuarine fish and invertebrates as an indicator of organophosphorus insecticide exposure and effects. Environ. Toxicol. Chem. 2001, 20 (1), 37−45. (15) Patil, V. K.; David, M. 2010. Behavioral and morphological endpoints: as an early response to sublethal malathion intoxication in the freshwater fish, Labeo rohita. Drug Chem. Toxicol. 2010, 33 (2), 160−165. (16) Lionetto, M. G.; Caricato, R.; Calisi, A.; Schettino, T. Acetylcholinesterase Inhibition As a Relevant Biomarker in Environmental Biomonitoring: New Insights and Perspectives; Nova Science; New York, 2011. (17) Roh, J.-Y.; Choi, J. Cyp35a2 gene expression is involved in toxicity of fenitrothion in the soil nematode Caenorhabditis elegans. Chemosphere 2011, 84 (10), 1356−1361. (18) Roh, J.-Y.; Lee, H.; Kwon, J.-H. Changes in the expression of cyp35a family genes in the soil nematode Caenorhabditis elegans under controlled exposure to chlorpyrifos using passive dosing. Environ. Sci. Technol. 2014, 48 (17), 10475−10481. (19) Kwon, J.-H.; Wuethrich, T.; Mayer, P.; Escher, B. I. Development of a dynamic delivery method for in vitro bioassays. Chemosphere 2009, 76 (1), 83−90. (20) Kwon, H.-C.; Kwon, J.-H. Measuring aqueous solubility in the presence of small cosolvent volume fractions by passive dosing. Environ. Sci. Technol. 2012, 46 (22), 12550−12556. (21) Roh, J.-Y.; Choi, J. Ecotoxicological evaluation of chlorpyrifos exposure on the nematode Caenorhabditis elegans. Ecotoxicol. Environ. Saf. 2008, 71 (2), 483−489. (22) Menzel, R.; Bogaert, T.; Achazi, R. A systematic gene expression screen of Caenorhabditis elegans cytochrome P450 genes reveals CYP35 as strongly xenobiotic inducible. Arch. Biochem. Biophys. 2001, 395, 158−168. (23) Menzel, R.; Rödel, M.; Kulas, J.; Steinberg, C. E. CYP35: xenobiotically induced gene expression in the nematode Caenorhabditis elegans. Arch. Biochem. Biophys. 2005, 438, 93−102. (24) Harlow, P. H.; Perry, S. J.; Widdison, S.; Daniels, S.; Bondo, E.; Lamberth, C.; Currie, R. A.; Flemming, A. J. The nematode Caenorhabditis elegans as a tool to predict chemical activity on mammalian development and identify mechanisms influencing toxicological outcome. Sci. Rep. 2016, 6, 22965. (25) Ellman, G.; Courtney, D.; Andres, V.; Featherstone, R. M. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 1961, 7, 88−95. (26) Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248−254. (27) Ashauer, R.; Hintermeister, A.; O’Connor, I.; Elumelu, M.; Hollender, J.; Escher, B. I. Significance of xenobiotic metabolism for bioaccumulation kinetics of organic chemicals in Gammarus pulex. Environ. Sci. Technol. 2012, 46 (6), 3498−3508. (28) Kumar, A.; Doan, H.; Barnes, M.; Chapman, J. C.; Kookana, R. S. Response and recovery of acetylcholinesterase activity in freshwater shrimp, Paratya australiensis (Decapoda: Atyidae) exposed to selected anti-cholinesterase insecticides. Ecotoxicol. Environ. Saf. 2010, 73 (7), 1503−1510. (29) Abdullah, A.; Kumar, A.; Chapman, J. Inhibition of acetylcholinesterase in the Australian freshwater shrimp (Paratya australiensis) by profenofos. Environ. Toxicol. Chem. 1994, 13, 1861− 1866. (30) Habig, C.; DiGiulio, R. Biochemical Characteristics of Cholinesterases in Aquatic organisms. In Cholinesterase Inhibiting Insecticides: Their Impact on Wildlife and the Environment; Mineau, P., Ed.; Elsevier Science Publishers: New York, 1991; pp19−33. (31) Mayer, P.; Tolls, J.; Hermens, J. L.; Mackay, D. Equilibrium sampling devices. Environ. Sci. Technol. 2003, 37 (9), 184A−191A. (32) Spurgeon, D. J.; Ricketts, H.; Svendsen, C.; Morgan, A. J.; Kille, P. Hierarchical responses of soil invertebrates (earthworms) to toxic metal stress. Environ. Sci. Technol. 2005, 39 (14), 5327−5334.

AUTHOR INFORMATION

Corresponding Author

*Phone: +82 2 3290 3041. Fax: +82 2 953 0737. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This research was supported by the National Research Foundation of Korea (NRF) (Grant 2013R1A1A2060473) and a Korea University Grant.

■

REFERENCES

(1) Vogs, C.; Kühnert, A.; Hug, C.; Küster, E.; Altenburger, R. A toxicokinetic study of specifically acting and reactive organic chemicals for the prediction of internal effect concentrations in Scenedesmus vacuolatus. Environ. Toxicol. Chem. 2015, 34 (1), 100−111. (2) Escher, B. I.; Hermens, J. L. Internal exposure: linking bioavailability to effects. Environ. Sci. Technol. 2004, 38 (23), 455A− 462A. (3) Escher, B. I.; Ashauer, R.; Dyer, S.; Hermens, J. L.; Lee, J. H.; Leslie, H. A.; Mayer, P.; Meador, J. P.; Warne, M. S. Crucial role of mechanisms and modes of toxic action for understanding tissue residue toxicity and internal effect concentrations of organic chemicals. Integr. Environ. Assess. Manage. 2011, 7 (1), 28−49. (4) McCarty, L. S.; Landrum, P. F.; Luoma, S. N.; Meador, J. P.; Merten, A. A.; Shephard, B. K.; van Wezel, A. P. Advancing environmental toxicology through chemical dosimetry: external exposures versus tissue residues. Integr. Environ. Assess. Manage. 2011, 7 (1), 7−27. (5) Groh, K. J.; Carvalho, R. N.; Chipman, J. K.; Denslow, N. D.; Halder, M.; Murphy, C. A.; Roelofs, D.; Rolaki, A.; Schirmer, K.; Watanabe, K. H. Development and application of the adverse outcome pathway framework for understanding and predicting chronic toxicity: I. Challenges and research needs in ecotoxicology. Chemosphere 2015, 120, 764−777. (6) Ardestani, M. M.; Oduber, F.; van Gestel, C. A. A combined toxicokinetics and toxicodynamics approach to assess the effect of porewater composition on cadmium bioavailability to Folsomia candida. Environ. Toxicol. Chem. 2014, 33 (7), 1570−1577. (7) Klaassen, Curtis D., Eds.; Casarett and Doull’s Toxicology: The Basic Science of Poisons, 6th, ed.; McGraw-Hill Education; New York, 2001. (8) Rajini, P. S.; Melstrom, P.; Williams, P. L. A comparative study on the relationship between various toxicological endpoints in Caenorhabditis elegans exposed to organophosphorus insecticides. J. Toxicol. Environ. Health, Part A 2008, 71 (15), 1043−1050. (9) Eaton, D. L.; Daroff, R. B.; Autrup, H.; Bridges, J.; Buffler, P.; Costa, L. G.; Coyle, J.; McKhann, G.; Mobley, W. C.; Nadel, L.; Neubert, D.; Schulte-Hermann, R.; Spencer, P. S. Review of the toxicology of chlorpyrifos with an emphasis on human exposure and neurodevelopment. Crit. Rev. Toxicol. 2008, 38 (Suppl2), 1−125. (10) Elersek, T.; Filipic, M. Organophosphorous Pesticides Mechanisms of Their Toxicity. In Pesticides - The Impacts of Pesticides Exposure; Stoytcheva, M., Eds.; InTech: Croatia, 2001; pp 243−260. (11) Zanger, U. M.; Schwab, M. Cytochrome P450 enzymes in drug metabolism: regulation of gene expression, enzyme activities, and impact of genetic variation. Pharmacol. Ther. 2013, 138 (1), 103−141. (12) Sanchez-Hernandez, J. C.; Narvaez, C.; Sabat, P.; Martínez Mocillo, S. Integrated biomarker analysis of chlorpyrifos metabolism and toxicity in the earthworm Aporrectodea caliginosa. Sci. Total Environ. 2014, 490, 445−455. (13) Jeon, J.; Kretschmann, A.; Escher, B. I.; Hollender, J. Characterization of acetylcholinesterase inhibition and energy allocation in Daphnia magna exposed to carbaryl. Ecotoxicol. Environ. Saf. 2013, 98, 28−35. 9695

DOI: 10.1021/acs.est.6b02751 Environ. Sci. Technol. 2016, 50, 9689−9696

Article

Environmental Science & Technology (33) Ashauer, R.; Agatz, A.; Albert, C.; Ducrot, V.; Galic, N.; Hendriks, J.; Jager, T.; Kretschmann, A.; O’Connor, I.; Rubach, M. N.; Nyman, A. M.; Schmitt, W.; Stadnicka, J.; van den Brink, P. J.; Preuss, T. G. Toxicokinetic-toxicodynamic modeling of quantal and graded sublethal endpoints: a brief discussion of concepts. Environ. Toxicol. Chem. 2011, 30 (11), 2519−2524. (34) Lewis, J. A.; Gehman, E. A.; Baer, C. E.; Jackson, D. A. Alterations in gene expression in Caenorhabditis elegans associated with organophosphate pesticide intoxication and recovery. BMC Genomics 2013, 14, 291. (35) Houde, M.; Carter, B.; Douville, M. Sublethal effects of the flame retardant intermediate hexachlorocyclopentadiene (HCCPD) on the gene transcription and protein activity of Daphnia magna. Aquat. Toxicol. 2013, 140−141, 213−219. (36) Jiang, Y.; Chen, J.; Wu, Y.; Wang, Q.; Li, H. Sublethal Toxicity endpoints of heavy metals to the nematode Caenorhabditis elegans. PLoS One 2016, 11 (1), e0148014. (37) Mackay, D.; Giesy, J. P.; Solomon, K. R. Fate in the environment and long-range atmospheric transport of the organophosphorus insecticide, chlorpyrifos and its oxon. Rev. Environ. Contam. Toxicol. 2014, 231, 35−76. (38) Busby-Hjerpe, A. L.; Campbell, J. A.; Smith, J. N.; Lee, S.; Poet, T. S.; Barr, D. B.; Timchalk, C. Comparative pharmacokinetics of chlorpyrifos versus its major metabolites following oral administration in the rat. Toxicology 2010, 268 (1−2), 55−63. (39) Rubach, M. N.; Ashauer, R.; Maund, S. J.; Baird, D. J.; Van den Brink, P. J. Toxicokinetic variation in 15 freshwater arthropod species exposed to the insecticide chlorpyrifos. Environ. Toxicol. Chem. 2010, 29 (10), 2225−2234. (40) Bayen, S.; Ter Laak, T. L.; Buffle, J.; Hermens, J. L. M. Dynamic exposure of organisms and passive samplers to hydrophobic organic chemicals. Environ. Sci. Technol. 2009, 43 (7), 2206−2215. (41) Xia, X.; Li, H.; Yang, Z.; Zhang, X.; Wang, H. How does predation affect the bioaccumulation of hydrophobic organic compounds in aquatic organisms? Environ. Sci. Technol. 2015, 49 (8), 4911−4920. (42) Crane, A. L.; Klein, K.; Zanger, U. M.; Olson, J. R. Effect of CYP2B6*6 and CYP2C19*2 genotype on chlorpyrifos metabolism. Toxicology 2012, 293 (1−3), 115−122. (43) Gruber, J.; Ng, L. F.; Poovathingal, S. K.; Halliwell, B. Deceptively simple but simply deceptive–Caenorhabditis elegans lifespan studies: considerations for aging and antioxidant effects. FEBS Lett. 2009, 583 (21), 3377−3387. (44) Leung, M. C.; Goldstone, J. V.; Boyd, W. A.; Freedman, J. H.; Meyer, J. N. Caenorhabditis elegans generates biologically relevant levels of genotoxic metabolites from aflatoxin B1 but not benzo[a]pyrene in vivo. Toxicol. Sci. 2010, 118, 444−453. (45) Golding, I.; Paulsson, J.; Zawilski, S. M.; Cox, E. C. Real-time kinetics of gene activity in individual bacteria. Cell 2005, 123 (6), 1025−1036. (46) Ankley, G. T.; Bennett, R. S.; Erickson, R. J.; Hoff, D. J.; Hornung, M. W.; Johnson, R. D.; Mount, D. R.; Nichols, J. W.; Russom, C. L.; Schmieder, P. K.; Serrrano, J. A.; Tietge, J. E.; Villeneuve, D. L. Adverse outcome pathways: a conceptual framework to support ecotoxicology research and risk assessment. Environ. Toxicol. Chem. 2010, 29 (3), 730−741.

9696

DOI: 10.1021/acs.est.6b02751 Environ. Sci. Technol. 2016, 50, 9689−9696