Lipidated Brartemicin Analogues Are Potent Th1-Stimulating Vaccine

Subscriber access provided by READING UNIV

Article

Lipidated brartemicin analogues are potent Th1-stimulating vaccine adjuvants Amy J. Foster, Masahiro Nagata, Xiuyuan Lu, Amy T. Lynch, Zakaria Omahdi, Eri Ishikawa, Sho Yamasaki, Mattie S. M. Timmer, and Bridget L. Stocker J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jmedchem.7b01468 • Publication Date (Web): 30 Dec 2017 Downloaded from http://pubs.acs.org on December 31, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Medicinal Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

Lipidated brartemicin analogues are potent Th1stimulating vaccine adjuvants Amy J. Foster,a Masahiro Nagata,b Xiuyuan Lu,b,c,d Amy T. Lynch,a Zakaria Omahdi,b,c,d Eri Ishikawa,b,d Sho Yamasaki,b,c,d,e,* Mattie S. M. Timmer,a,* and Bridget L. Stockera,* a.

School of Chemical and Physical Sciences, Victoria University of Wellington, PO Box 600,

Wellington 6140, New Zealand. Email: [email protected]; [email protected]; [email protected]. b.

Department of Molecular Immunology, Research Institute for Microbial Diseases, Osaka

University, Suita, 565-0871, Japan. c.

Division of Molecular Immunology, Medical Institute of Bioregulation, Kyushu University,

Fukuoka 812-8582, Japan d.

Laboratory of Molecular Immunology, Immunology Frontier Research Center, Osaka

University, Suita, 565-0871, Japan e.

Division of Molecular Immunology, Medical

Keywords: Mincle, Vaccine adjuvant, Glycolipid

ACS Paragon Plus Environment

1

Journal of Medicinal Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 66

Abstract

Effective Th1-stimulating vaccine adjuvants typically activate antigen presenting cells (APCs) through pattern recognition receptors (PRRs). Macrophage inducible C-type lectin (Mincle) is a PRR expressed on APCs and has been identified as a target for Th1-stimulating adjuvants. Herein, we report on the synthesis and adjuvanticity of rationally designed brartemicin analogues containing long-chain lipids and demonstrate that they are potent Mincle agonists that activate APCs to produce inflammatory cytokines in a Mincle-dependent fashion. Mincle binding, however, does not directly correlate to a functional immune response. Mutation studies indicated that the aromatic residue of lead compound 9a has an important interaction with Mincle Arg183. In vivo assessment of 9a highlighted the capability of this analogue to augment the Th1 response to a model vaccine antigen. Taken together, our results show that lipophilic brartemicin analogues are potent Mincle agonists and that 9a has superior in vivo adjuvant activity compared to TDB.


2

Page 3 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Adjuvants have traditionally been used to enhance the adaptive immune response to a vaccine, with most current vaccines providing protection primarily through humoral (Th2) immunity.1 A strong and enduring antibody response is suitable for protection against many pathogens however, humoral immunity is insufficient to confer protection against diseases such as malaria, tuberculosis, and leishmaniasis.2-4 In these cases, adjuvants stimulating acquired cellular (Th1) immunity, which is characterised by the release of interferon (IFN)-γ, have proven effective.2,5 Effective Th1-stimulating adjuvants often engage the innate immune system by activating pattern recognition receptors (PRRs) on professional antigen presenting cells (APCs).4,6 Pathogen associated molecular patterns (PAMPs) bind to PRRs, with the specificity of the ensuing immune response being directed by the type of PRR activated and the structure of each specific PAMP. There has been much interest in the Toll-like receptors (TLRs) as targets for vaccine adjuvants,3,4 however more recently, Macrophage inducible C-type lectin (Mincle, Clec4e, or Clecf9) has been identified as a PRR on the surface of macrophages and dendritic cells (DCs)7,8 and is a promising new target for vaccine development.9 Mincle is activated by a number of PAMPs,10-11 including the Mycobacterium tuberculosis cell wall glycolipid trehalose dimycolate (TDM, 1, Figure 1), with Mincle activation leading to the induction of the FcRγ-Syk-Card9-Bcl10-Malt1 signalling axis and a Th1-polarised immune response.12-15 This response involves ligand binding and activation of Mincle, followed by dual phosphorylation of the immunoreceptor tyrosinebased activation motif (ITAM) of the Fc receptor γ-chain (FcRγ) which then becomes a highaffinity docking site for Syk (spleen tyrosine kinase) family proteins.15 The subsequent formation of the Card9-Bcl10-Malt1 complex then leads to the activation of transcription factors that mediate the production of Th1 cytokines.


3


Page 4 of 66

In addition to TDM, a number of synthetically derived ligands also bind and activate Mincle.16-21 Notably, trehalose dibehenate (TDB, 2), a synthetic analogue of TDM, activates Mincle with a comparable efficacy to TDM.12,13 TDB has been formulated into dimethyldioctadecylammonium bromide (DDA):TDB cationic liposomes leading to a mixed Th1 and Th17 immune response, as evidenced by IFN-γ and IL-17 production, respectively.13,22 These liposomes have shown efficacy in vaccination studies for HIV23,24 and tuberculosis.25,26 Various additional compounds have been shown to bind to and activate Mincle,27-28 and in particular glucose and mannose esterified at the 6-position with α-branched fatty acids (GlcC14C18, ManC14C18) exhibited agonist activity similar to TDM.19 There has also been interest in the ability of the natural product brartemicin (3) to bind and activate Mincle,29,30 however, a functional Mincledependent immune response to this ligand was not reported. O n

R=

HO

HO HO

OR O

O

OMe

HO O

z

y

x

O

OH

O RO

A

OH OH

TDM (1)

B C D e.g., n = 13, x = 16, y = 12, z = 17

O

O R=

20

OH

R= OH

TDB (2)

Brartemicin (3)

Figure 1. Representative trehalose glycolipids.


4

Page 5 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Given the ability of Mincle ligands to promote a Th1/Th17 immune response, we were interested in developing a potent Mincle agonist for use as a vaccine adjuvant. The crystal structure of human Mincle (hMincle)31 and bovine Mincle (bMincle)32 revealed a common Glu-Pro-Asn (EPN) motif (residues 169-171), which is often observed in calcium-dependent lectin receptors (CLRs). Mincle uses the Ca2+ ion in this EPN motif to bind the equatorial 3- and 4-OH groups of one glucose residue in trehalose,30-32 with molecular modelling studies showing similar binding to monoesters of glucose.19 On one side of the EPN motif there is a binding site for the second glucose residue in trehalose, while the other side contains a hydrophobic groove capable of binding linear or branched fatty acids.19,30-32 The precise molecular mechanisms of glycolipidMincle interactions are far from being understood, with subtle changes in lipid structure leading to different proposed binding modes for similar molecules.19,29,30 Notwithstanding, it has been suggested that in hMincle, Arg183 is in a suitable position to interact with the hydroxyl groups of trehalose,31 and that the hydrophobic groove plays an essential role in binding Mincle ligands.19,31,32 This is supported by structure-activity studies that indicate that trehalose diesters with lipid chains ≥ C18 are required for bone marrow derived macrophages (BMDMs) to produce the pro-inflammatory cytokines interleukin (IL)-6, IL-1β, and the cellular mediator nitric oxide.16 Computational studies using bMincle have also determined that brartemicin strongly binds to Mincle with one aromatic ester occupying the hydrophobic groove and the second ester potentially being involved in π-cation interactions with the aforementioned arginine residue (Arg182/183, bovine/human).29 Taken together, we proposed that trehalose glycolipids containing an aromatic residue and long lipophilic tails would be potent Mincle agonists and Th1-stimulating vaccine adjuvants.


5


Page 6 of 66

Results and Discussion Design of brartemicin analogues. While brartemicin can bind Mincle,29,30 the ability of this natural product to signal through Mincle has not been reported. Notwithstanding, we envisioned that incorporation of lipophilic groups onto the brartemicin scaffold would significantly increase Mincle affinity, and that such derivatives would have strong immunostimulatory activity.16,30 In particular, attachment of lipid chains to the 4-hydroxyls of the brartemicin benzoates could allow for the formation of compounds capable of strong interactions with Mincle’s hydrophobic grooves; an effect previously observed in binding experiments using linear trehalose mono- and di-esters of increasing lipid lengths.30,31 As changes to the glycolipid structure can affect binding modes of Mincle ligands,19,29,30 we set out to determine whether lipidated brartemicin analogues could be accommodated in the Mincle binding site. To this end, molecular docking of brartemicin containing lipophilic ethers at the 4-hydroxyls of the brartemicin benzoates was undertaken using UCSF Chimera/DOCK6.33,34 These studies suggested that, like brartemicin itself, the lipidated structures would bind in the carbohydrate recognition domain (CRD) of Mincle with the 3- and 4-hydroxyls of the trehalose moiety anchoring the ligand to the Ca2+ ion (Figure 2, SI Fig 1). Moreover, the docking study suggested that the lipid-portion of one of the aromatic esters occupies a hydrophobic region comprised of the Leu199, Phe198, Leu176, and Val145 side chains. The second aromatic ester was calculated to reside 3.37 Å away from Arg183, which suggested π-cation interactions, as previously observed in molecular modelling studies of brartemicin itself.29 While further modelling studies could be conducted, the relationship between Mincle binding and signalling is not well understood. For example, C5 and C6 diacylated linear trehalose glycolipids bind Mincle,30 however in vitro assays showed that C4, C7, and C10 derivatives are unable to activate BMDMs.16 Accordingly, we set out to synthesise a


6

Page 7 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


variety of 4-O-alkylated brartemicin analogues with different lipid chain lengths and varying functionalities on the aromatic rings, so that these could be tested in functional assays.

Figure 2. Molecular docking pose of lipidated brartemicin interacting with hMincle (Protein Data Bank ID code 3WH2) using UCSF Chimera/DOCK6.33,34 Synthesis of brartemicin analogues. To determine whether brartemicin derivatives can bind and activate Mincle, we synthesised a series of 4-O-alkyl, desmethyl, and dehydroxy brartemicin analogues. In addition, in order to investigate the effect of lipid length on macrophage activation, we prepared substituted 4-alkoxy-benzoic acid derivatives that incorporated long (C18), medium (C7), or short (C4 or C1) alkyl chains (Scheme 1). To this end, methyl 2,4-dihydroxybenzoate (4) was selectively alkylated at the 4-position, before benzyl protection and ester hydrolysis, to afford benzoic acid derivatives 4a-e in good to excellent yield over the three steps (50-87%). The effect of the substitution pattern on the aromatic ring was then considered via the alkylation of 4hydroxybenzoic acid 5 with long and medium length alkyl groups, followed by hydrolysis to provide 2-deoxy-derivatives 5a and 5b, again in excellent yield (62-79%). Finally, alkylation of ethyl 2,4-dihydroxy-6-methylbenzoate (6), the core aromatic residue found in brartemicin,


7


Page 8 of 66

followed by benzylation of the 2-position and hydrolysis of the ester group gave the benzyl protected alkoxybenzoate 6a. In addition, 6 was dibenzylated and hydrolysed (→ 6b) en route to the total synthesis of brartemicin.

Scheme 1. Reagents and conditions a) CH3(CH2)17Br/TBAI, CH3(CH2)6I, CH3(CH2)3I, or MeI, K2CO3, acetone, reflux; b) BnBr, TBAI, K2CO3, acetone, reflux; c) NaOH (5M), MeOH, reflux. The overall yield for each benzoate is reported in parentheses. The final glycolipids were assembled via esterification of partially protected trehalose 7 (prepared in three steps according to literature procedures)16 with the aforementioned benzoic acids. The esterification reactions were performed in the presence of 1-ethyl-3-(3dimethylaminopropyl)carbodiimide (EDCI) and 4-(dimethylamino)pyridine (DMAP) and gave the desired benzyl-protected trehalose diesters 8a-i in good yields (Table 1). Global debenzylation using Pearlman’s catalyst and H2 then gave brartemicin (9i) and analogues 9a-h in good to excellent yields.


8

Page 9 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Synthesis of Brartemicin analogues

Yield (%)a Entry

Benzoate 7→8

8→9

1

8a, 66

9a, 68

2

8b, 70

9b, 83

3

8c, 61

9c, 86

4

8d, 65

9d, 62

5

8e, 58

9e, 92

6

8f, 80

9f, 51

7

8g, 83

9g, 73


9


a

Page 10 of 66

8

8h, 68

9h, 69

9

8i, 52

9i, 89

All synthesised compounds were determined to be endotoxin free (≤ 0.1 EU/mL) by using the

limulus amebocyte lysate (LAL) chromogenic assay.

Lipid-containing brartemicin analogues bind and activate mMincle and hMincle. To test whether human and murine Mincle can recognise the synthesised brartemicin analogues, the compounds were tested in an enzyme-linked immunosorbent assay (ELISA) using soluble Mincle-Ig fusion-proteins, in which the extracellular domain of mouse Mincle was fused to human IgG Fc for detection (Figure 3a).8,10 Here, compounds lacking a lipophilic group, i.e. 4′O-methyl-desmethyl-brartemicin (9d), desmethyl-brartemicin (9e), and brartemicin (9i), along with 4′-O-butyl-desmethyl-brartemicin (9c), which contains a short lipid, did not bind hMincleor mMincle-Ig to any great extent. By comparison, the C18 containing analogues, 9a, 9f, and 9h, showed good binding affinity. Strongest binding, however, was observed for the analogues containing C7 lipid tails (9b and 9g) for both the human and murine fusion-proteins. The enhanced binding of the C7 lipidated brartemicin derivatives compared to those with longer (C18) lipid lengths was unexpected, particularly as competition assays involving the displacement of mannose-conjugated serum albumin from bMincle by mono- and di-acylated trehalose diesters bearing 5–12-carbon linear fatty acids revealed increasing binding affinity as lipid length


10

Page 11 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Lipid-containing brartemicin analogues bind and signal through mMincle and hMincle (a) Plates coated with Brartemicin analogues (0.1 nmol/well) were incubated with IgmMincle, Ig-hMincle, or Ig-only and ligand bound protein was detected via ELISA. Data is representative of three independent experiments performed in triplicate (mean ± SD). (b) NFATGFP 2B4 reporter cells expressing mMincle + FcRγ or (c) hMincle + FcRγ were stimulated using ligand-coated plates (0.01, 0.1, or 1 nmol/well) for 18 hours. The reporter cells were harvested and examined for NFAT-GFP expression. Data represents the mean of three independent experiments performed in duplicate (mean ± SEM).


11


Page 12 of 66

increased.30 Earlier studies investigating the binding affinities of monoacylated trehalose derivatives with different carbon lengths (C8, C10 and C12) by surface plasmon resonance (SPR) also revealed that the C8 derivative showed much lower binding affinity to hMincle than the C10 and C12 analogues.31 As we are the first to investigate the binding affinity of longer chain trehalose diesters, it would seem that there is an optimum lipid length for brartemicin-derived trehalose diesters binding to Mincle that is centered around lipids of intermediate length. However, it should also be noted that previous competitive binding assays demonstrated that brartemicin (9i) bound bMincle with strong affinity (Ki = 5.5 ± 0.9)29 while we did not observe binding of brartemicin to hMincle or mMincle. This difference in binding affinity could be attributed to differences in the hMincle and bMincle binding sites, but could also point to the general differences that arise when comparing competition assays and more direct measures, such as SPR or ELISA-based Ig-fusion assays, to determine relative binding affinities.

Next, we were curious to determine whether the observed Mincle binding correlated with cellular activation. To this end, we stimulated nuclear factor of activated T cells (NFAT)-green fluorescent protein (GFP) reporter cells8 expressing mMincle or hMincle coupled to FcRγ using plates coated with TDM, TDB, brartemicin (9i), or analogues 9a-9h. Activation of the reporter cells was measured through the production of GFP, which was monitored by flow cytometry, with cells only expressing FcRγ being used as negative controls (Figure 3b and 3c). In contrast to our binding studies, ligands incorporating C18 lipids (9a, 9f, and 9h) strongly activated both murine and human Mincle NFAT-GFP reporter cells in a dose-dependent manner, while the C7containing analogues (9b and 9g) also activated mMincle and hMincle NFAT-GFP reporter cells but to a lesser extent than the C18 analogues. The C4 analogue (9c) was able to activate mMincle


12

Page 13 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and hMincle only at high ligand concentrations, while the non-lipidated analogues 9e and brartemicin (9i) did not significantly activate mMincle, with 9d showing only modest activation of hMincle at a high ligand concentration. These findings support previous structure-activity studies with acylated trehalose derivatives whereby trehalose diesters with lipid chains ≥ C18 were required for the production of inflammatory cytokines by BMDMs16 and moreover illustrate that ligand binding does not exactly correlate to Mincle activation. The reason for the absence of a direct correlation between ligand binding and Mincle-activation is unclear, though it is possible that the functional receptor undergoes a conformational change upon ligand binding, which might alter the receptor activation state and receptor-ligand affinity. Our findings also demonstrate the subtle species-specific differences between hMincle and mMincle,20,21 despite the sequence of mMincle and hMincle being highly conserved.7 Notwithstanding, at all concentrations tested, 9a was best able to activate hMincle. Lipid-containing brartemicin analogues induce BMDMs to produce inflammatory cytokines in a Mincle-dependent manner. Although the NFAT-GFP reporter assay is useful for the identification of Mincle ligands, we sought to assess the interaction of the receptor with candidate ligands in a more physiological setting. Accordingly, we examined the capability of the brartemicin analogues to induce an inflammatory response by APCs. First, the ability of the glycolipids to activate GM-CSF BMDMs was determined by monitoring the secretion of the inflammatory cytokines TNF, IL-6, and IL-1β and the chemokine, MIP-2, in a ligand-coated plate assay (Figure 4). As illustrated, stimulation of BMDMs with the C18 brartemicin derivatives (9a, 9f and 9h) led to the significant production of all cytokines and MIP-2. This response was similar to that induced by TDM and TDB, whereby the latter has deemed safe and tolerable as part of the CAF01 liposome formulation in clinical trials.35 On the other hand, C7-derivatives (9b


13


Page 14 of 66

Figure 4. Lipidated brartemicin analogues induce Mincle dependent inflammatory cytokine production. TNF, MIP-2, IL-6 and IL-1β production by harvested wild-type or Mincle/-

GM-CSF BMDMs treated with brartemicin derivatives. Harvested GM-CSF BMDMs were

stimulated using TDB, TDM, or brartemicin derivative-coated plates (0.1 or 1 nmol/well) or solubilised LPS (100 ng/mL). Cytokine production was measured by ELISA from the supernatant collected after 24 hours. Data is representative of three independent experiments performed in triplicate (± SD).


14

Page 15 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and 9g) resulted in only modest production of MIP-2, IL-1β, TNF, and IL-6, while the C4 brartemicin derivative (9c) induced MIP-2 but not TNF, IL-6, and IL-1β. The non-lipidated derivatives (9d and 9e) and brartemicin itself (9i) did not induce the production of any of the cytokines measured. This data supports the observation that BMDM stimulation with trehalose diesters with longer lipid tails leads to an enhanced inflammatory response. In the absence of Mincle, the production of MIP-2, IL-1β, TNF, and IL-6 in response to the synthetic ligands was abolished, suggesting that Mincle is the major receptor involved in mediating BMDM activation by lipophilic brartemicin derivatives. At this stage, the C18-alkylated desmethyl brartemicin analogue (C18dMeBrar, 9a) was chosen as the lead candidate for subsequent assays. Of the three C18 brartemicin derivatives best able to activate mMincle and hMincle (9a, 9f and 9h), 9a exhibited the greater hMincle activation at low glycolipid concentrations (0.01 ng/mL) in the NFAT-GFP reporter assay (Figure 3). Moreover, 9a, which contains an additional hydroxyl at the 2-position of the aromatic ring, was easier to synthesise than the other potential lead agonist, 9f, and was more soluble in the in vitro assays.

Arginine 183 is essential for hMincle activation by 9a. We then examined the contribution of Arg183 to hMincle-ligand binding, as our molecular modelling studies of lipidated brartemicin analogues indicated a potentially important interaction between the benzoate group of 9a and Arg183 in hMincle via π-cation interactions. To this end, we established an NFAT-GFP reporter cell line expressing hMincle mutants, where Arg183 was replaced with an alanine residue (hMincleR183A). The mutant Mincle was expressed normally on the cell surface of the reporter cells (Figure 5a) and NFAT-GFP production was induced when stimulated with TDM (Figure 5b). Conversely, the hMincleR183A mutant failed to recognise 9a, indicating that this residue is


15


Page 16 of 66

essential for hMincle binding of 9a. Previously it was suggested that Arg183 might enhance the binding affinity of linear acylated trehalose derivatives by binding to additional hydroxyl residues on the trehalose moiety.31 Indeed, the slightly lower binding affinity of TDM to hMincleR183A compared to hMincle WT further supports the general importance of Arg183 in binding Mincle ligands.

a

b

c

Figure 5. Arginine 183 is essential for the activation of hMincle expressing NFAT-GFP 2B4-cells by 9a. a) hMincleR183A NFAT-GFP reporter cells were stained with anti-hMincle (bold) or isotype control (dashed). b) hMincle WT or c) hMincleR183A reporter cells were stimulated using plates coated with increasing amounts of TDM or 9a and cultured for 18 hours. The cells were harvested and analysed for NFAT-GFP expression. Data represents the mean of two independent experiments performed in duplicate (mean ± SEM).

C18dMeBrar 9a is a Th1/Th17 inducing adjuvant in vitro. The ability of an adjuvant to qualitatively affect the outcome of the immune response is an important consideration as most licensed subunit vaccines contain the adjuvant alum, which elevates serum antibody titres but elicits a Th2 antibody response that can be weak and often requires repeated immunisations.36 In


16

Page 17 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


addition, alum-based adjuvants are not sufficient for eliminating intracellular pathogens. To this end, the vaccine adjuvant monophosphoryl lipid A (MPL), which binds TLR-4 to elicit a Th1 immune response has been developed and used in the licensed AS04 vaccine adjuvant system.37 Notwithstanding, the need for vaccines against chronic infections [e.g., HIV, hepatitis C virus (HCV), tuberculosis and herpes simplex virus (HSV)] remains, and in particular, the development of adjuvants that generate Th1/Th17 cellular immune responses is a pressing goal.38,39 To evaluate the potential of 9a as a Th1/Th17 adjuvant, we co-cultured GM-CSF BMDMs and T-cells from OVA-specific OT-II TCR Tg mice on plates coated with TDM (0.1 nmol/well), TDB (0.1 nmol/well), or 9a (0.1 nmol/well), stimulated the cells with OVA (0, 0.1, and 1 µM), and after 48 hours, collected the supernatant. Levels of the key Th1 cytokine IFN-γ, which is indicative of an enhanced host defense response,40 and the Th17 cytokine IL-17 were measured via ELISA (Figure 6). The OVA-specific production of IL-17 was significantly augmented by 9a, albeit to a lesser extent than TDM and TDB. Antigen-specific secretion of IFN-γ however, was not enhanced by treatment with 9a.


17


Page 18 of 66

Figure 6. Brartemicin 9a displays adjuvant activity in vitro. OT-II CD4+ T-cells were cocultured with GM-CSF BMDMs in the presence of TDM (0.1 nmol/well), TDB (0.1 nmol/well), 9a (0.1 nmol/well) and OVA323-339 peptide (0, 0.1, and 1 µM). After 48 hours, the supernatant was collected and levels of IFN-γ and IL-17 were measured using ELISA. Data is representative of two experiments performed in triplicate (mean ± SD). *P≤ 0.05; **P≤ 0.01; ***P≤ 0.005; ****P≤ 0.001.

C18dMeBrar 9a is a potent Th1-stimulating adjuvant in vivo. Adjuvant 9a was then evaluated in vivo to confirm its capacity to induce a Th1 antigen-specific response. While Mincle agonists are often formulated into cationic (CAF01) liposomes for in vivo testing, these liposomes are thought to directly activate antigen-presenting cells and can effect both CD4 and CD8 T cell responses.41 Thus we sought to explore the adjuvanticity of 9a in the absence of other immunostimulatory agents, such as DDA, so as to obtain an immune profile that is associated with 9a alone. Accordingly, we employed a delayed-type hypersensitivity immunisation protocol, as it is a convenient, sensitive, and well established model for the assessment of in vivo immune responses. Four groups of C57BL/6 mice were immunised by subcutaneous injection with oil-in-water emulsions containing either OVA only, OVA + 9a, OVA + TDB, or no OVA. After seven days the mice were challenged with OVA (100 µg per footpad) and after a further seven days, the splenocytes were isolated and restimulated with OVA at three concentrations (10, 30, or 100 µg/mL). The immune response was measured by determining footpad swelling (SI Fig 2), T cell proliferation (Figure 7a), production of IFN-γ and IL-17 (Figure 7b), and antibody titres (Figure 7c). While neither 9a nor TDB induced footpad swelling (SI Fig 2) or IL17 production, immunisation of mice using 9a gave rise to a polarised immune response with a


18

Page 19 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


distinct Th1 profile. A trend towards increased antigen-specific IFN-γ production was observed for all concentrations of OVA when 9a was used as the adjuvant, with significantly enhanced cytokine production when re-stimulating with 100 µg/mL of antigen. In contrast, the Mincle agonist TDB did not lead to a significant increase in IFN-γ at any of the concentrations of OVA tested. A significantly larger number of splenocytes was also observed from mice that received 9a, as compared to those that received OVA alone (Figure 7a). Moreover, at all concentrations of OVA re-stimulation, 9a led to a significant increase in cell count compared to TDB. The limited efficacy of TDB in these in vivo assays was initially surprising, however studies addressing the adjuvanticity of TDB have largely focussed on the TDB:DDA (CAF01) liposome system.13,22,25,26,42,43 Accordingly, the ability of 9a to lead to an enhanced Th1 immune response was even more striking.

This overall immune profile was also reflected in the antibody production by immunised mice. While 9a and TDB elevated the production of IgG antibodies, the increase in antibody production was only significant for C18dMeBrar (9a). When looking at the subclasses of antibodies produced, both Th1 associated subclasses IgG2b and IgG2c and Th2 associated IgG144,45 showed increases for 9a and TDB, with the largest increases observed for 9a, for which IgG1 doubled and IgG2c tripled. In conclusion, C18dMeBrar (9a) is qualitatively similar to TDB with regard to its ability to enhance antibody production, however 9a leads to a stronger immune response.


19


Page 20 of 66

Figure 7. Brartemicin analogue 9a displays potent adjuvant activity in vivo. C57BL/6 mice (n = 5 per group) were immunised subcutaneously with oil-in-water emulsions containing OVA only (200 µg), OVA + TDB (OVA = 200 µg, TDB = 0.3 µmol) OVA + 9a (OVA = 200 µg, 9a = 0.3 µmol), or emulsion only. After seven days, the mice were challenged with OVA (100 µg/footpad). After a further seven days, the mice were sacrificed, blood samples taken, and their spleens were harvested. Total splenocyte number (a) and cytokine production (b) was measured following restimulation with OVA. Blood serum was analysed for OVA-specific antibody production (c). *P≤ 0.05; **P≤ 0.01; ***P≤ 0.005; ****P≤ 0.001.


20

Page 21 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


To date, TDB is the leading Mincle agonist and has found application as a key constituent of the highly promising CAF01 liposomal vaccine adjuvant for the treatment of TB25,26 and HIV.23,24 This, in turn, has led to much interest in the development of other Mincle ligands as adjuvants, particularly as combinations of adjuvants may be required to confer protection against pathogens that have thus far evaded vaccination efforts.46 Indeed, the recently identified GlcC14C18 Mincle agonist has shown promise as a Th1/Th17 adjuvant when administered in a liposomal formulation containing immunostimulatory DDA.19 The synthesis of GlcC14C18, however, appears challenging (5.7% overall yield as a mixture of diastereoisomers).19 In contrast, our lead Mincle-agonist, 9a, can be synthesised using a practical and scalable synthesis involving fivelinear steps to give the glycolipid as a single compound and in 22% overall yield. Moreover, 9a exhibited excellent Th1 adjuvant activity, which was greater than TDB. Accordingly, C18dMeBrar (9a) is one of the most promising Mincle agonists to date and is an ideal candidate for further vaccination studies.


21


Page 22 of 66

Conclusion In conclusion, we have developed a highly potent Th1 stimulating vaccine adjuvant, C18dMeBrar (9a), which was based on the structure of the natural product brartemicin. This glycolipid was synthesised from readily available starting materials in five linear steps and in excellent overall yield. Computational studies provided insight into the potential binding of the brartemicin derivatives to hMincle and suggested that the benzoate of brartemicin may interact with Arg183 by π-cation interactions. This was confirmed by the absence of activity of C18dMeBrar (9a) in an NFAT-GFP reporter cell line containing Mincle with an alanine, rather than arginine, residue at position 183. During the course of our studies we also demonstrated that longer lipids led to a better functional immune response. This was an important observation for while trehalose glycolipids incorporating shorter lipid chains have previously been shown to bind Mincle, binding does not always correlate to cellular activation. In our assays, brartemicin did not activate mMincle or hMincle NFAT-GFP reporter cells or BMDMs. Notwithstanding, all three C18 lipidated brartemicin analogues 9a, 9f and 9h activated both mMincle and hMincle, with high levels of TNF, IL-6, IL-1β and MIP-2 being produced by the BMDMs upon stimulation with the ligands. When 9a was combined with an antigen in vivo, a strong Th1 recall response was observed, and the adjuvanticity of 9a was greater than TDB. Accordingly, our Mincle agonist C18dMeBrar (9a) is not only a powerful adjuvant in its own right, but it could be used in tandem with other adjuvants, such as TLR agonists, to develop an optimal adjuvant combination for vaccination against pathogens that have thus far resisted our efforts in this respect.


22

Page 23 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Experimental General experimental. Unless otherwise stated, all reactions were performed under an atmosphere of argon. Acetone, methyl iodide, 1-iodoheptane and 1-iodobutane were distilled and stored over molecular sieves (4Å). Methyl 2,4-dihydroxy benzoate (BDH), methyl 4hydroxybenzoate (BDH), 1-bromooctadecane (Aldrich), TBAI (Riedel-de Haen), benzyl bromide (Aldrich), methanol (Fischer Scientific), sodium hydroxide (Vickers), K2CO3 (Panreac) ethanol (Fischer Scientific), EDCI (Chem Impex), DMAP (Lab Supply), toluene (ROMIL), Pd(OH)2 (Aldrich), CH2Cl2 (Fischer Scientific), pyridine (ROMIL), C5D5N (Apollo), CDCl3 (Aldrich), CD3OD (Cambridge Isotopes Laboratories Inc.), H2 (BOC), EtOAc (Pure Science), and petroleum ether (Pure Science) were used as received. 2,2',3,3',4,4'-hexa-O-benzyl-α,α'-Dtrehalose was prepared according to a literature procedure.16 Methyl 2,4-dihydroxy benzoate47 and ethyl 2,4-dihydroxy-6-methylbenzoate48 were prepared according to adapted literature procedures. All solvents were removed by evaporation under reduced pressure. Reactions were monitored by TLC-analysis on Macherey-Nagel silica gel coated plastic sheets (0.20 mm with fluorescent indicator UV254) via detection by UV-absorption (254 nm), dipping in 10% H2SO4 in EtOH followed by charring, dipping in KMnO4 solution (2% in H2O), or dipping in ceric ammonium molybdate solution. Column chromatography was performed using Pure Science silica gel (40-63 µm), and size exclusion chromatography was performed using lipophilic Sephadex (25-100 µm, Sigma). All compounds were confirmed to be ≥95% pure by NMR analysis. High resolution mass spectra were recorded on an Agilent 6530 Q-TOF mass spectrometer utilising a JetStream electrospray ionisation source in positive and negative mode. Optical rotation were recorded on an Autopol II or IV (Rudolph Research Analytical) at 589 nm (sodium D-line). Infrared spectra were recorded as thin films using a Bruker Platinum ATR and


23


Page 24 of 66

are reported in wave numbers (cm-1). Nuclear magnetic resonance spectra were recorded at 20 °C in C5D5N, CD3OD, or CDCl3 using a varian INOVA operating at 500 or 600 MHz. Chemical shifts are given in ppm (δ) relative to residual solvent peaks. NMR peak assignments were made using COSY, HSQC, and HMBC 2D experiments. Melting points were obtained using a Gallenkamp Melting Point Apparatus. Quantitative NMR was used to confirm the purity of 9a was ≥95%. General procedure for the synthesis of 4-O-alkyl-benzoates. To a solution of benzoate (1 equiv.) in acetone (20 mL) was added K2CO3 (1.4-2 equiv.), alkyl halide (1.2–1.5 equiv.) and TBAI (for 4-O-octadecyloxy-benzoates only, 0.05-0.1 equiv.) The mixture was heated at reflux until the reaction was completed (as gauged by TLC analysis, 18-48 h). The reaction mixture was cooled to rt and concentrated under reduced pressure. The resulting residue was purified using gradient silica gel flash column chromatography (petroleum ether to petroleum ether:EtOAc; 9:1; v/v). Methyl 2-hydroxy-4-methoxybenzoate. By subjecting methyl 2,4-dihydroxybenzoate (400 mg, 2.39 mmol), methyl-iodide (0.19 mL, 3.12 mmol), and K2CO3 (528 mg, 3.82 mmol) to the general procedure for the synthesis of 4-O-alkyl-benzoates, the title compound was obtained as a clear oil (390 mg, 2.14 mmol, 90%). Rf = 0.58 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 10.98 (s, 1H, OH), 7.73 (d, J6,5 = 9.0 Hz, 1H, H-6), 6.43 (m, 2H, H-3 & H-5), 3.91 (s, 3H, CO2Me), 3.82 (s, 3H, OMe); 13C NMR (125 MHz, CDCl3) δ 170.4 (C-7), 165.6 (C-4), 163.8 (C-2), 131.3 (C-6), 107.6 (C-5), 105.5 (C-1), 100.7 (C-3), 55.5 (OMe), 52.0 (CO2Me); IR (film): 3080, 3013, 2957, 1665, 1620, 1583, 1504, 1434, 1349, 1255, 1225, 1191, 1139, 773 cm-1; HRMS (ESI) m/z calcd. for [C9H10O4+H]+: 183.0652; obsd.: 183.0650.


24

Page 25 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Methyl 4-butoxy-2-hydroxybenzoate. By subjecting methyl 2,4-dihydroxybenzoate (205 mg, 1.22 mmol), 1-iodobutane (0.20 mL, 1.55 mmol), and K2CO3 (291 mg, 2.11 mmol) to the general procedure for the synthesis of 4-O-alkyl-benzoates, the title compound was obtained as a clear oil (248 mg, 1.10 mmol, 90%). Rf = 0.58 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 10.96 (s, 1H, OH), 7.72 (d, J6,5 = 7.2 Hz, H-6), 6.41-6.44 (m, 2H, H-3 & H-5), 3.98 (t, J8,9 = 6.5 Hz, 2H, CH2-8), 3.91 (s, 3H, CO2Me), 1.77 (p, J9,8 = J9,10 = 6.8 Hz, 2H, CH2-9), 1.48 (sext, J10,9 = J10,11 = 7.5 Hz, 2H, CH2-10), 0.97 (t, J11,10 = 7.5 Hz, 3H, CH3-11). 13C NMR (125 MHz, CDCl3) δ 170.4 (C-7), 165.2 (C-4), 163.7 (C-2), 131.2 (C-6), 108.0 (C-5), 105.2 (C-1), 101.1 (C-3), 68.0 (C-8), 52.0 (CO2Me), 31.1 (C-9), 19.2 (C-10), 13.9 (C-11). IR (film): 3111, 2957, 2874, 1666, 1621, 1505, 1439, 1395, 1347, 1251, 1137, 730 cm-1; HRMS (ESI) m/z calcd. for [C12H16O4+H]+: 225.1121; obsd.: 225.1118. Methyl 4-(heptyloxy)-2-hydroxybenzoate. By subjecting methyl 2,4-dihydroxybezoate (310 mg, 1.84 mmol), K2CO3 (395 mg, 2.86 mmol), and 1-iodoheptane (0.38 mL, 2.31 mmol) to the general procedure for the synthesis of 4-O-alkyl-benzoates, the title compound was obtained as a colourless oil (479 mg, 1.80 mmol, 98%). Rf = 0.85 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 10.96 (s, 1H, OH), 7.72 (d, J6,5 = 9.3 Hz, 1H, H-6), 6.41-6.44 (m, 2H, H-3 & H-5), 3.96 (t, J8,9 = 6.5 Hz, 2H, CH2-8), 3.91 (s, 3H, CO2Me), 1.77 (p, J9,8 = J9,10 = 7.5 Hz, 2H, CH2-9), 1.47-1.40 (m, 2H, CH2-10), 1.38-1.26 (m, 6H, CH2-11-CH2-13), 0.89 (t, J14,13 = 6.7 Hz, 3H, CH3-14); 13C NMR (500 MHz, CDCl3) 170.6 (C-7), 166.3 (C-4), 163.9 (C-2), 131.3 (C-6), 108.1 (C-3), 105.3 (C-1), 101.2 (C-5), 68.4 (C-8), 52.1 (CO2Me), 31.9 , 29.2, 29.1, 26.1, 22.7 (C-9–C-13), 14.2 (C14); IR (film): 3143, 2928, 2857, 1669, 1623, 1582, 1505, 1468, 1440, 1254, 1140, 780 cm-1; HRMS (ESI) m/z calcd. for [C15H22O4+H]+: 267.1591; obsd.: 267.1593.


25


Page 26 of 66

Methyl 2-hydroxy-4-(octadecyloxy)benzoate. By subjecting methyl 2,4-dihydroxybenzoate (357 mg, 2.12 mmol), K2CO3 (429 mg, 3.10 mmol), 1-bromooctadecane (836 mg, 2.50 mmol), and TBAI (71 mg, 0.19 mmol) to the general procedure for the synthesis of 4-O-alkyl-benzoates, the title compound was obtained as an amorphous off-white solid (695mg, 1.65 mmol, 78%). Rf = 0.83 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 10.95 (s, 1H, OH), 7.72 (d, J6,5 = 9.5 Hz, 1H, H6), 6.41-6.43 (m, 2H, H-3 & H-5), 3.96 (t, J8,9 = 6.6 Hz, 2H, CH2-8), 3.91 (s, 3H, CO2Me), 1.78 (p, J9,8 = J9,10 = 7.1 Hz, 2H, CH2-9), 1.40-1.47 (m, 2H, CH2-10), 1.24-1.35 (m, 28H, CH2-11CH2-24), 0.88 (t, J25,24 = 6.6 Hz, 3H, CH3-25); 13C NMR (125 MHz, CDCl3) δ 170.6 (C-7), 165.4 (C-4), 163.9 (C-2), 131.3 (C-6), 108.1 (C-5), 105.3 (C-1), 101.2 (C-3), 68.4 (C-8), 52.1 (CO2Me), 32.1, 29.9, 29.84, 29.83, 29.81, 29.80, 29.73, 29.70, 29.52, 29.49, 22.9 (C-11-C-24), 29.14 (C-9), 26.1 (C-10), 14.3 (C-25); IR (film): 2916, 2850, 1674, 1583, 1473, 1441, 1350, 1258, 781 cm-1; HRMS (ESI): calcd. for [C26H44O4+H]+: 421.3312; obsd.: 421.3303. Methyl 4-(heptyloxy)-benzoate. By subjecting methyl 4-hydroxybenzoate (550 mg, 3.62 mmol), K2CO3 (1.01 g, 7.33 mmol), and 1-iodoheptane (0.77 mL, 4.70 mmol) to the general procedure for the synthesis of 4-O-alkyl-benzoates, the title compound was obtained as an amorphous white solid (853 mg, 3.41 mmol, 94%). Rf = 0.66 (Petroleum ether:EtOAc, 5:1, v/v); 1

H-NMR (500 MHz, CDCl3) δ 7.98 (d, J2,3 = 9.1 Hz, 2H, H-2), 6.90 (d, J3,2 = 8.8 Hz, 2H, H-3),

4.00 (t, J6,7 = 6.6 Hz, 2H, CH2-6), 3.88 (s, 3H, CO2Me), 1.80 (p, J7,6 = J7,8 = 6.8 Hz, 2H, CH2-7), 1.42-1.49 (m, 2H, CH2-8), 1.37-1.31 (m, 6H, CH2-9-CH2-11), 0.90 (t, J12,11 = 6.1 Hz, 3H, CH312); 13C-NMR (125 MHz, CDCl3) 166.9 (C-5), 163.0 (C-4), 131.6 (C-2), 122.3 (C-1), 114.0 (C3), 68.2 (C-6), 51.8 (CO2Me), 31.9, 29.18, 22.8 (C-9-C-11), 29.3 (C-7), 26.1 (C-8), 14.2 (C-12); IR (film): 2919, 2851, 1716, 1606, 1512, 1436, 1251, 1168, 850 cm-1; HRMS (ESI) calcd. for [C15H23O3]+: 251.1642; obsd.: 251.1630.


26

Page 27 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Methyl 4-(octadecyloxy)benzoate. By subjecting methyl 4-hydroxybenzoate (406 mg, 2.67 mmol), K2CO3 (565, 4.09 mmol), 1-bromooctadecane (1.31 g, 3.92 mmol), and TBAI (101 mg, 0.27 mmol) to the general procedure for the synthesis of 4-O-alkyl benzoates, the title compound was obtained as an amorphous white solid (968 mg, 2.39 mmol, 90%). Rf = 0.54 (petroleum ether:EtOAc, 24:1, v/v); 1H-NMR (500 MHz, CDCl3) δ 7.98 (d, J2,3 = 8.3 Hz, 2H, H2), 6.90 (d, J3,2 = 8.6 Hz, 2H, H-3), 4.00 (t, J6,7 = 6.6 Hz, 2H, CH2-6), 3.88 (s, 3H, CO2Me), 1.79 (p, J7,6 = J7,8 = 7.1 Hz, 2H, CH2-7), 1.45 (p, J8,7 = J8,9 = 7.3 Hz, 2H, CH2-8), 1.42-1.26 (m, 28H, CH2-9-CH2-22), 0.88 (t, J23,22 = 6.5 Hz, 3H, CH3-23); 13C-NMR (125 MHz, CDCl3) 166.9 (C-5), 163.0 (C-4), 131.6 (C-2), 122.3 (C-1), 114.0 (C-3), 68.2 (C-6), 51.8 (CO2Me), 31.9, 29.7, 29.6, 29.5, 29.4, 26.0, 22.7 (C-8-C-22), 29.1 (C-7), 14.1 (C-23); IR (film): 2916, 2847, 1723, 1608, 1510, 1473, 1256, 850 cm-1; HRMS (ESI) calcd. for [C26H45O3] + 405.3363; obsd. 405.3359. Methyl 2-hydroxy-6-methyl-4-(octadecyloxy)benzoate. By subjecting ethyl 2,4-dihydroxy6-methylbenzoate (500 mg, 2.55 mmol), K2CO3 (478 mg, 3.46 mmol), 1-bromooctadecane (1.047, 3.14 mmol), and TBAI (50 mg, 0.14 mmol) to the general procedure for the synthesis of 4-O-alkyl-benzoates, the title compound was obtained as an amorphous pale yellow solid (1.13 g, 2.52 mmol, 99%). Rf = 0.58 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 11.85 (s, 1H, OH), 6.31 (d, J3,5 = 2.5 Hz, 1H, H-3), 6.28 (d, J5,3 = 2.5 Hz, 1H, H-5), 4.39 (q, J = 7.2 Hz, 2H, CH2-OEt), 3.94 (t, J8,9 = 6.6 Hz, 2H, CH2-8), 2.50 (s, 3H, 6-Me), 1.76 (p, J9,8 = J9,10 = 7.4 Hz, 2H, CH2-9), 1.39-1.45 (m, 5H, CH3-OEt & CH2-10), 1.24-1.36 (m, 28H, CH2-11-CH2-24), 0.88 (t, J25,24 = 7.0 Hz, 3H, CH3-H-25); 13C NMR (125 MHz, CDCl3) δ 171.9 (C-7), 165.7 (C-2), 163.6 (C-4), 143.2 (C-6), 111.7 (C-5), 105.3 (C-1), 99.3 (C-3), 68.2 (C-8), 61.3 (CH2-OEt), 32.1, 29.9, 29.83, 29.82, 29.81, 29.74, 29.70, 29.52, 29.49, 22.9 (C-11-C-24), 29.2 (C-9), 26.1 (C-10), 24.6 (6-Me),


27


Page 28 of 66

14.4 (CH3-OEt), 14.3 (C-25); IR (film): 2917, 2848, 1648, 1613, 1581, 1365, 1262, 1178, 1041, 815 cm-1; HRMS (ESI) calcd. For [C28H48O4+H]+: 449.3625; obsd.: 449.3631. General benzylation procedure. To a solution of benzoate (1 equiv.) in acetone (20 mL) was added K2CO3 (1.2-3 equiv.), benzyl bromide (1.2–3 equiv), and TBAI (0.03–0.1 equiv.). The resulting mixture was refluxed for 18 hours, cooled to room temperature, and concentrated in vacuo. The residue was then purified using silica-gel flash column chromatography (petroleum ether to petroleum ether:EtOAc; 4:1; v/v). Methyl 2,4-bis(benzyloxy)benzoate. By subjecting methyl 2,4-dihydroxybenzoate (178 mg, 1.15 mmol), benzyl bromide (0.41 mL, 3.46 mmol), K2CO3 (478 mg, 3.46 mmol), and TBAI (43 mg, 0.12 mmol) to the general procedure for benzylation, the title compound was obtained as an amorphous yellow solid (378 mg, 1.08 mmol, 94%). Rf = 0.82 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 7.88 (d, J6,5 = 8.6 Hz, 1H, H-6), 7.50 (d, J = 7.6 Hz, 2H, CHarom), 7.42-7.30 (m, 8H, CHarom), 6.61 (d, J3,5 = 2.2 Hz, 1H, H-3), 6.59 (dd, J5,6 = 8.8 Hz, J5,3 = 2.2 Hz, 1H, H-5), 5.15 (s, 2H, CH2Ph), 5.07 (s, 2H, CH2Ph), 3.88 (s, 3H, CO2Me);

13

C NMR (125 MHz, CDCl3) δ 166.4

(C-7), 163.4, 160.4 (C-2, C-4), 136.3 (Ci, CH2Ph), 134.1 (Ci, CH2Ph), 128.8 (C-6), 128.7, 128.4, 127.9, 127.7, 126.9 (CHarom), 113.3 (C-1), 106.2 (C-5), 101.6 (C-3), 70.7 (CH2Ph), 70.4 (CH2Ph), 51.9 (CO2Me); IR (film): 3026, 2949, 2853, 1723, 1700, 1605, 1250, 1178, 1141, 1087, 1024, 848, 734 cm-1; HRMS (ESI) m/z calcd. for [C22H20O4+H]+: 349.1434; obsd.: 349.1434. Ethyl

2,4-bis(benzyloxy)-6-methylbenzoate.

By

subjecting

ethyl

2,4-dihydroxy-6-

methylbenzoate (300 mg, 1.53 mmol), K2CO3 (517 mg, 3.74 mmol), benzyl bromide (0.47 mL, 3.82 mmol) to the general procedure for benzylation, the title compound was obtained as an amorphous white solid (566 mg, 1.50 mmol, 98%). Rf = 0.42 (Petroleum ether:EtOAc, 4:1, v/v);


28

Page 29 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1

H NMR (600 MHz, CDCl3) δ 7.40-7.28 (m, 10H, CHarom), 6.43 (d, J3,5 = 2.2 Hz, 1H, H-3), 6.42

(d, J5,3 = 2.2 Hz, 1H, H-5), 5.04 (s, 2H, CH2Ph), 5.02 (s, 2H, CH2Ph), 4.34 (q, J = 7.2 Hz, 2H, CH2-OEt), 2.30 (s, 3H, 6-Me), 1.30 (t, J = 7.2 Hz, 3H, CH3-OEt); 13C NMR (150 MHz, CDCl3) δ 168.3 (C-7), 160.4 (C-4), 157.3 (C-2), 138.4 (C-6), 136.8 (Ci, CH2Ph) , 136.7 (Ci, CH2Ph), 128.8, 128.6, 128.2, 127.9, 127.6, 127.2 (CHarom), 117.6 (C-1), 108.3 (C-5), 98.6 (C-3), 70.5 (CH2Ph), 70.2 (CH2Ph), 61.1 (CH2-OEt), 20.0 (6-Me), 14.4 (CH3-OEt); IR (film): 2930, 2901, 2873, 1716, 1590, 1432, 1365, 1334, 1286, 1264, 1160, 1096, 1038, 775, 696 cm-1; HRMS (ESI) calcd. for [C24H24O4+H]+: 377.1747; obsd.: 377.1760. Methyl

2-(benzyloxy)-4-methoxybenzoate.

By

subjecting

methyl

2-hydroxy-4-

methoxybenzoate (290 mg, 1.59 mmol), benzyl bromide (0.26 mL, 2.07 mmol), K2CO3 (297 mg, 2.15 mmol), and TBAI (55 mg, 0.15 mmol) to the general procedure for benzylation, the title compound was obtained as a pale yellow oil (422 mg, 1.55 mmol, 97%). Rf = 0.56 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 7.89 (d, J6,5 = 9.3 Hz, 1H, H-6), 7.52 (d, J2',3' = 7.2 Hz, 2H, H-2'), 7.40 (t, J3',2' = J3',4' = 7.2 Hz, 2H, H-3'), 7.32 (d, J4',3' = 7.2 Hz, 1H, H-4'), 6.50-6.53 (m, 2H, H-3 & H-5), 5.17 (s, 2H, CH2Ph), 3.87 (s, 3H, CO2Me), 3.82 (s, 3H, OMe);

13

C NMR (125 MHz,

CDCl3) δ 166.4 (C-7), 164.2 (C-4), 160.4 (C-2), 136.8 (C-1'), 134.1 (C-6), 128.7 (C-3'), 127.9 (C-4'), 126.9 (C-2'), 113.1 (C-1), 105.3 (C-5), 100.8 (C-3), 70.7 (CH2Ph), 55.6 (OMe), 51.9 (CO2Me); IR (film): 2948, 2839, 1719, 1698, 1606, 1249, 1167, 1086, 1026, 734, 695 cm-1; HRMS (ESI) calcd. for [C16H16O4+H]+: 273.1121; obsd.: 273.1122. Methyl 2-(benzyloxy)-4-butoxybenzoate. By subjecting methyl 4-butoxy-2-hydroxybenzoate (243 mg, 1.08 mmol), K2CO3 (240 mg, 1.73 mmol), benzyl bromide (0.21 mmol, 1.73 mmol), and TBAI (13 mg, 0.04 mmol) to the general procedure for benzylation, the title compound was obtained as a white crystalline solid (312 mg, 0.99 mmol, 92%). Rf = 0.54 (CH2Cl2); Mp. 39.8 –


29


Page 30 of 66

41.2 °C; 1H NMR (500 MHz, CDCl3) δ 7.87 (d, J6,5 = 8.7 Hz, 1H, H-6), 7.52 (br d, J2',3' = 7.7 Hz, 2H, H-2'), 7.39 (t, J3',2' = J3',4' = 7.5 Hz, 2H, H-3'), 7.29-7.33 (m, 1H, H-4'), 6.53 (d, J3,5 = 2.3 Hz, 1H, H-3), 6.50 (dd, J5,6 = 8.7 Hz, J5,3 = 2.3 Hz, 1H, H-5), 5.16 (s, 2H, CH2Ph), 3.97 (t, J8,7 = 6.5 Hz, 2H, CH2-8), 3.87 (s, 3H, CO2Me), 1.72-1.79 (m, 2H, CH2-9), 1.44-1.52 (m, 2H, CH2-10), 0.97 (t, J11,10 = 7.4 Hz, 3H, CH3-H-11); 13C NMR (125 MHz, CDCl3) δ 166.4 (C-7), 163.9 (C-4), 160.4 (C-2), 136.9 (C-1') , 134.1 (C-6), 128.7 (C-3'), 127.9 (C-4'), 126.9 (C-2'), 112.7 (C-1), 105.8 (C-5), 101.1 (C-3), 70.7 (CH2Ph), 68.1 (C-8), 51.8 (CO2Me), 31.3 (C-9), 19.3 (C-10), 14.0 (C-11); IR (film): 2961, 2874, 1691, 1574, 1096, 733 cm-1; HRMS (ESI) m/z calcd. For [C19H22O4+H]+: 315.1591; obsd.: 315.1600. Methyl

2-(benzyloxy)-4-heptyloxybenzoate.

By

subjecting

methyl

4-(heptyloxy)-2-

hydroxybenzoate (270 mg, 1.01 mmol), benzyl bromide (0.15 mL, 1.21 mmol), K2CO3 (167 mg, 1.21 mmol), and TBAI (28 mg, 0.08 mmol) to the general procedure for benzylation, the title compound was isolated as a colourless oil (318 mg, 0.89 mmol, 88%). Rf = 0.16 (petroleum ether:CH2Cl2, 2:3, v/v); 1H NMR (500 MHz, CDCl3) δ 7.87 (d, J6,5 = 8.7 Hz, 1H, H-6), 7.52 (d, J2',3' = 7.8 Hz, 2H, H-2'), 7.39 (t, J3',2' = J3',4' = 7.7 Hz, 2H, H-3'), 7.29-7.33 (m, 1H, H-4'), 6.53 (s, 1H, H-3), 6.50 (d, J5,6 = 8.6 Hz, 1H, H-5), 5.16 (s, 2H, CH2Ph), 3.96 (t, J8,9 = 6.44 Hz, 2H, CH28), 3.87 (s, 3H, CO2Me), 1.77 (p, J9,8 = J9,10 = 7.2 Hz, 2H, CH2-9), 1.40-1.47 (m, 2H, CH2-10), 1.28-1.39 (m, 6H, CH2-11–CH2-13), 0.90 (t, J14,13 = 6.5 Hz, 3H, CH3-14); 13C NMR (125 MHz, CDCl3) δ 166.4 (C-7), 163.9 (C-4), 160.4 (C-2), 136.9 (C-1'), 134.0 (C-6), 128.7 (C-3'), 127.9 (C-4'), 126.9 (C-2'), 112.7 (C-1), 105.9 (C-5), 101.1 (C-3), 70.7 (CH2Ph), 68.4 (C-8), 51.8 (CO2Me), 31.9, 29.24, 29.17, 22.8 (C-9-C11), 26.1 (C-10), 14.2 (C-14); IR (film): 2928, 2857, 1723, 1606, 1574, 1458,1248, 1185, 1141, 1088, 734 cm-1; HRMS (ESI) m/z calcd. For [C22H28O4+H]+: 357.2060; obsd.: 357.2064.


30

Page 31 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Methyl 2-(benzyloxy)-4-(octadecyloxy)benzoate. By subjecting methyl 2-hydroxy-4(octadecyloxy)benzoate (250 mg, 0.59 mmol), benzyl bromide (0.12 mL, 0.95 mmol), K2CO3 (139 mg, 0.95 mmol), and TBAI (22 mg, 0.059 mmol) to the general procedure for benzylation, the title compound was isolated as an amorphous off-white solid (296 mg, 0.58 mmol, 98%). Rf = 0.47 (petroleum ether:EtOAc, 4:1, v/v); 1H NMR (500 MHz, CDCl3) δ 7.87 (d, J6,5 = 8.7 Hz, 1H, H-6), 7.52 (d, J2',3' = 7.5 Hz, 2H, H-2'), 7.39 (t, J3',2' = J3',4' = 7.5 Hz, 2H, H-3'), 7.29–7.31 (m, 1H, H-4'), 5.16 (s, 2H, CH2Ph), 3.96 (t, J8,7 = 6.5 Hz, 2H, CH2-8), 3.87 (s, 3H, OMe), 1.77 (p, J9,8 = J9,10 = 6.6 Hz, 2H, CH2-9), 1.40–1.47 (m, 2H, CH2-10), 1.23-1.37 (m, 28H, CH2-11-CH224), 0.88 (t, J25,24 = 6.9 Hz, 3H, CH3-25); 13C NMR (125 MHz, CDCl3) δ 166.2 (C-7), 163.7 (C4), 160.2 (C-2), 136.7 (C-1'), 133.9 (C-6), 128.5 (C-3'), 127.7 (C-4'), 126.7 (C-2'), 112.6 (C-1), 105.7 (C-5), 101.0 (C-3), 70.5 (CH2Ph), 68.3 (C-8), 51.7 (OMe), 31.9, 29.70, 29.68, 29.66, 29.60, 29.56, 29.4, 29.1 (C-9–C-24), 14.1 (C-25); IR (film): 2915, 2849, 1728, 1609, 1576, 1504, 1468, 1378, 1277, 1209, 1090, 732 cm-1; HRMS (ESI) calcd. for [C33H50O4+H]+ 511.3787; obsd.: 511.8791. Ethyl 2-(benzyloxy)-6-methyl-4-(octadecyloxy)benzoate. By subjecting ethyl 2-hydroxy-6methyl-4-(octadecyloxy)benzoate (0.95 g, 2.12 mmol), benzyl bromide (0.38 mL, 3.18 mmol), K2CO3 (480 mg, 3.47 mmol), and TBAI (80 mg, 0.21 mmol) to the general procedure for benzylation, the title compound was isolated as an amorphous solid (622 mg, 1.15 mmol, 54%). Rf = 0.63 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 7.40 (d, J2',3' = 7.4 Hz, 2H, H-2'), 7.36 (t, J3',2' = J3',4' = 7.3 Hz, 2H, H-3'), 7.28-7.31 (m, 1H, H-4'), 6.35 (s, 1H, H-3), 6.32 (s, 1H, H-5), 5.06 (s, 2H, CH2Ph), 4.33 (q, J = 7.1 Hz, 2H, CH2-OEt), 3.91 (t, J8,9 = 6.7 Hz, 2H, CH2-8), 2.30 (s, 3H, 6Me), 1.74 (p, J9,8 = J9,10 = 7.2 Hz, 2H, CH2-9), 1.42 (m, 2H, CH2-10), 1.38-1.46 (t, J = 7.4 Hz, 3H, CH3-OEt), 1.23-1.36 (m, 28H, CH2-11-CH2-24), 0.88 (t, J25,24 = 6.9 Hz, 3H, CH3-25);

13

C


31


Page 32 of 66

NMR (125 MHz, CDCl3) δ 168.4 (C-7), 160.9 (C-4), 157.3 (C-2), 138.3 (C-6), 136.9 (C-1'), 128.6 (C-3'), 127.9 (C-4'), 127.2 (C-2'), 117.1 (C-1), 108.0 (C-5), 98.2 (C-3), 70.5 (CH2Ph), 68.2 (C-8), 61.1 (CH2-OEt), 32.1, 29.9, 29.84, 29.82, 29.81, 29.8, 29.7, 29.53, 29.52, 22.9 (C-11-C24), 29.3 (C-9), 26.1 (C-10), 20.0 (6-Me), 14.4 (CH3-OEt), 14.3 (C-25); IR (film): 2916, 2849, 1705, 1603, 1470, 1164 cm-1; HRMS (ESI) calcd. For [C35H54O4+H]+: 539.4095; obsd.: 539.4103. General procedure for ester hydrolysis. To a solution of benzoate in MeOH (20 mL) was added NaOH (5M, 5 mL) and the resulting solution was refluxed overnight. Upon reaction completion (as gauged by TLC) the excess MeOH was removed in vacuo. The resulting suspension was diluted with water, acidified with conc. HCl, extracted with EtOAc, dried with MgSO4, filtered, and concentrated in vacuo. 2-(Benzyloxy)-4-(octadecyloxy)benzoic acid (4a). By subjecting methyl 2-(benzyloxy)-4(octadecyloxy)benzoate (267 mg, 0.52 mmol) to the general procedure for the hydrolysis benzoates, the title compound was obtained as an amorphous pale orange solid (171 mg, 0.34 mmol, 65%). Rf = 0.88 (petroleum ether:EtOAc, 4:1, v/v); 1H NMR (500 MHz, CDCl3) δ 8.14 (d, J6,5 = 8.8 Hz, 1H, H-6), 7.37-7.44 (m, 5H, H-2', H-3' & H-4'), 6.64 (dd, J5,6 = 8.8 Hz, J5,3 = 2.1 Hz, 1H, H-5), 6.60 (d, J3,5 = 2.1 Hz, 1H, H-3), 5.25 (s, 2H, CH2Ph), 4.00 (t, J8,7 = 6.5 Hz, 2H, CH2-8), 1.79 (p, J9,8 = J9,10 = 6.8 Hz, 2H, CH2-9), 1.41-1.48 (m, 2H, CH2-10), 1.23-1.36 (m, 28H, CH2-11-CH2-24), 0.88 (t, J25,24 = 6.7 Hz, 3H, CH3-25); 13C NMR (125 MHz, CDCl3) δ 165.1 (C7), 164.6 (C-4), 158.7 (C-2), 135.6 (C-6), 134.2 (C-1'), 129.23 (C-4'), 129.17 (C-3'), 128.0 (C-2'), 110.5 (C-1), 107.4 (C-5), 100.2 (C-3), 72.2 (CH2Ph), 68.6 (C-8), 31.9, 29.70, 29.67, 29.65, 29.59, 29.54, 29.4, 29.3, 29.0 (C-9–C-24), 14.1 (C-25); IR (film): 2917, 2850, 1682, 1605, 1574, 1471, 1258, 1159, 1039 cm-1; HRMS (ESI) calcd. for [C32H48O4+H]+ 497.3625; obsd.: 497.3639.


32

Page 33 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2-(Benzyloxy)-4-(heptyloxy)benzoic acid (4b). By subjecting methyl 2-(benzyloxy)-4(heptyloxy)benzoate (500 mg, 0.98 mmol) to the general procedure for the hydrolysis of benzoates, the title compound was obtained as an amorphous pale yellow solid (430 mg, 0.87 mmol, 89%). Rf = 0.1 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 8.14 (dd, J6,5 = 8.7 Hz, J6,3 = 1.2 Hz, 1H, H-6), 7.45-7.40 (m, 5H, CHarom), 6.63-6.66 (m, 1H, H-5), 6.61 (s, 1H, H-3), 5.25 (CH2Ph), 4.00 (t, J8,9 = 6.7 Hz, 2H, CH2-8), 1.79 (p, J9,8 = J9,10 = 7.3 Hz, 2H, CH2-9), 1.41-1.48 (m, 2H, CH2-10), 1.40-1.25 (m, 6H, CH2-11-CH2-13), 0.90 (t, J14,13 = 6.3 Hz, 3H, CH3-14); 13C NMR (125 MHz, CDCl3) δ 165.3 (C-7), 164.8 (C-4), 158.9 (C-2), 135.7 (C-6), 134.4 (C-1'), 129.4, 129.3, 128.1 (CHarom), 110.6 (C-1), 107.6 (C-5), 100.4 (C-3), 72.3 (CH2Ph), 68.8 (C-8), 31.9, 29.1, 22.7 (C-11–C-13), 26.2 (C-9), 26.0 (C-10), 14.2 (C-14); IR (film): 2931, 2860, 1678, 1601, 1505, 1454, 1433, 1380, 1330, 1253, 1188, 1004, 816 cm-1; HRMS (ESI) m/z calcd. For [C21H26O4+H]+: 343.1904; obsd.: 343.1910. 2-(Benzyloxy)-4-butoxybenzoic acid (4c). By subjecting methyl 2-bis(benzyloxy)-4butoxybenzoate (320 mg, 1.02 mmol) to the general procedure for the hydrolysis of benzoates, the title compound was obtained as an amorphous white solid (267 mg, 0.89 mmol, 87%). Rf = 0.83 (petroleum ether:EtOAc, 4:1, v/v); 1H NMR (500 MHz, CDCl3) δ 8.14 (d, J6,5 = 8.8 Hz, 1H, H-6), 7.40-7.45 (m, 5H, CHarom), 6.65 (dd, J5,6 = 8.8 Hz, J5,3 = 2.0 Hz, 1H, H-5), 6.61 (d, J3,5 = 2.0 Hz, 1H, H-3), 5.25 (s, 2H, CH2Ph), 4.01 (t, J8,9 = 6.5 Hz, 2H, CH2-8), 1.75-1.81 (m, 2H, CH29), 1.49 (sext, J10,9 = J10,11 = 7.5 Hz, 2H, CH2-10), 0.98 (t, J11,10 = 7.4 Hz, 3H, CH3-11); 13C NMR (125 MHz, CDCl3) δ 165.3 (C-7), 164.8 (C-4), 158.8 (C-2), 135.7, 134.4, 129.4, 129.3, 128.1 (CHarom), 110.6 (C-1), 107.6 (C-5), 100.4 (C-3), 72.3 (CH2Ph), 68.4 (C-8), 31.2 (C-9), 19.3 (C10), 13.9 (C-11); IR (film): 2963, 2872, 2556, 1689, 1667, 1505, 1466, 1444, 730 cm-1; HRMS (ESI) m/z calcd. For [C18H20O4+H]+: 301.1434 obsd.: 301.1442.


33


Page 34 of 66

2-(Benzyloxy)-4-methoxybenzoic acid (4d). By subjecting methyl 2-bis(benzyloxy)-4methoxybenzoate (511 mg, 1.88 mmol) to the general procedure for the hydrolysis of benzoates, the title compound was obtained as a pale yellow solid (450 mg, 1.74 mmol, 93%). Rf = 0.22 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 8.15 (d, J6,5 = 8.8 Hz, 1H, H-6), 7.45-7.36 (m, 10H, CHarom), 6.65 (dd, J5,6 = 8.8 Hz, J5,3 = 2.3 Hz, 1H, H-5), 6.61 (d, J3,5 = 2.2 Hz, 1H, H-3), 5.25 (s, 2H, CH2Ph), 3.86 (s, 3H, OMe);13C NMR (125 MHz, CDCl3) δ 165.2 (C-7), 165.0 (C-4), 158.7 (C-2), 135.6 (C-6), 134.2 (Ci, CH2Ph), 129.2, 129.2 127.9 (CHarom), 111.8 (C-1), 106.9 (C-5), 99.9 (C-3), 72.2 (CH2Ph), 55.7 (OMe); IR (film): 2975, 2936, 2845, 1657, 1605, 1428, 1408, 1382, 1334, 1001, 850 cm-1; HRMS (ESI) m/z calcd. For [C15H14O4+H]+: 259.0965; obsd.: 259.0958. 2,4-Bis(benzyloxy)benzoic acid (4e). By subjecting methyl 2,4-bis(benzyloxy)benzoate (431 mg, 1.24 mmol) to the general procedure for the hydrolysis of benzoates, the title compound was obtained as an amorphous off-white solid (384 mg, 1.15 mmol, 93%). Rf = 0.27 (CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 8.14 (d, J6,5 = 8.7 Hz, 1H, H-6), 7.42-7.37 (m, 10H, CHarom), 6.73 (dd, J5,6 = 8.7 Hz, J5,3 = 2.0 Hz, 1H, H-5), 6.69 (d, J3,5 = 2.0 Hz, 1H, H-3), 5.23 (s, 2H, CH2Ph), 5.11 (s, 2H, CH2Ph); 13C NMR (125 MHz, CDCl3) δ 165.3 (C-7), 164.2, 158.9 (C-2, C-4), 135.7 (Ci, CH2Ph), 135.6 (Ci, CH2Ph), 129.2, 129.2, 128.8, 128.5, 128.0, 127.6 (CHarom), 111.0 (C-1), 107.8 (C-5), 100.7 (C-3), 72.2 (CH2Ph), 70.5 (CH2Ph); IR (film): 3291, 3034, 2881, 1716, 1680, 1605, 1387, 1326, 1282, 1170, 836 cm-1; HRMS (ESI) m/z calcd. for [C21H18O4+H]+: 335.1278; obsd.: 335.1283. 4-(Octadecyloxy)benzoic acid (5a). By subjecting methyl 4-(octadecyloxy)benzoate (962 mg, 2.38 mmol) to the general procedure for the hydrolysis of benzoates, the title compound was obtained as an amorphous white solid (638 mg, 1.63 mmol, 69%). Rf = 0.40 (petroleum


34

Page 35 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ether:EtOAc, 5:1, v/v); 1H NMR (500 MHz, C5D5N) δ 8.49 (d, J2,3 = 8.5 Hz, 2H, H-2), 7.17 (d, J3,2 = 8.6 Hz, 2H, H-3), 4.00 (t, J6,7 = 6.5 Hz, 2H, CH2-6), 1.77 (p, J7,6 = J7,8 = 6.8 Hz, 2H, CH27), 1.41-1.48 (m, 2H, CH2-8), 1.32-1.26 (m, 28H, CH2-9–CH2-22), 0.88 (t, J23,22 = 6.7 Hz, 3H, CH3-23);

13

C NMR (125 MHz, C5D5N) δ 169.2 (C-5), 163.6 (C-4), 132.7 (C-2), 125.2 (C-1),

115.0 (C-3), 68.8 (C-6) 32.5, 30.42, 30.40, 30.37, 30.34, 30.30, 30.27, 30.1, 30.0 23.4 (C-9-C22), 29.9 (C-7), 26.7 (C-8), 14.7 (C-23); IR (film): 2914, 2848, 1671, 1605, 1578, 1513, 1469, 1256, 1169, 846 cm-1; HRMS (ESI) calcd. for [C25H42O3-H]-: 389.3061; obsd.: 389.3062. 4-(Heptyloxy)benzoic acid (5b). By subjecting methyl 4-(heptyloxy)benzoate (353 mg, 1.41 mmol) to the general procedure for the hydrolysis of benzoates, the title compound was obtained as an amorphous white solid (280 mg, 1.19 mmol, 84%). Rf = 0.39 (petroleum ether:EtOAc, 5:1, v/v); 1H NMR (500 MHz, CDCl3) δ 8.05 (d, J2,3 = 7.6 Hz, 2H, H-2), 6.93 (d, J3,2 = 7.0 Hz, 2H, H-3), 4.03 (t, J6,7 = 6.1 Hz, 2H, CH2-6), 1.81 (p, J7,6 = J7,8 = 7.05 Hz, 2H, CH2-7), 1.47 (p, J8,7 = J8,9 = 7.3 Hz, 2H, CH2-8), 1.38–1.32 (m, 12H, CH2-9–CH2-11), 0.90 (t, J12,11 = 6.4 Hz, 3H, CH312); 13C NMR (125 Hz, CDCl3) δ 171.3 (C-5), 163.7 (C-4), 132.3 (C-2), 121.3 (C-1), 114.2 (C3) 68.3 (C-6), 31.8, 29., 29.0, 25.9, 22.6 (C-7–C-11) 14.1 (C-12); IR(film): 2930, 2849, 2434, 1669, 1605, 1578, 1512, 1465, 1304, 1253, 843 cm-1; HRMS (ESI) calcd. for [C14H20O3-H]-: 235.1340; obsd. 235.1349. 2-(Benzyloxy)-6-methyl-4-(octadecyloxy)benzoic acid (6a). By subjecting ethyl 2(benzyloxy)-6-methyl-4-(octadecyloxy)benzoate (598 mg, 1.11 mmol) to the general procedure for the hydrolysis of benzoates, the title compound was obtained as an amorphous off-white solid (494 mg, 0.97 mmol, 87%). Rf = 0.91 (petroleum ether:EtOAc, 4:1, v/v); 1H NMR (500 MHz, CDCl3) δ 7.45-7.38 (m, 5H, CHarom), 6.46 (s, 2H, H-3 & H-5), 5.19 (s, 2H, CH2Ph), 3.97 (t, J8,9 = 6.5 Hz, 2H, CH2-8), 2.60 (s, 3H, 6-Me), 1.77 (p, J9,8 = J9,10 = 7.3 Hz, 2H, CH2-9), 1.41-1.48 (m,


35


Page 36 of 66

2H, CH2-10), 1.34-1.23 (m, 28H, CH2-11-CH2-24), 0.88 (t, J25,24 = 6.5 Hz, 3H, CH3-25);

13

C

NMR (125 MHz, CDCl3) δ 166.1 (C-7), 162.0 (C-4), 159.0 (C-2), 145.7 (C-6), 134.8 (C-1') 128.98, 128.85, 127.76 (CHarom), 111.4 (C-1), 110.8 (C-5), 98.3 (C-3), 72.1 (CH2Ph), 68.3 (C-8), 31.9, 29.7, 29.66, 29.59, 29.55, 29.3, 22.7 (C-11-C-23), 29.1 (C-9), 26.0 (C-10), 23.4 (6-Me), 14.1 (C-25); IR (film): 3308, 2919, 2850, 1687, 1605, 1579, 1511, 1467, 1456, 1433, 1378, 1379, 1328, 1254, 1168, 907, 734 cm-1; HRMS (ESI) m/z calcd. For [C33H50O4-H]-: 509.3636; obsd.: 509.3625. 2,4-Bis(benzyloxy)-6-methylbenzoic

acid

(6b).

By

subjecting

ethyl

2,4-

bis(benzyloxy)benzoate (590 mg, 1.57 mmol) to the general procedure for the hydrolysis of benzoates, the title compound was obtained as an amorphous off-white solid (517 mg, 1.48 mmol, 94%). Rf = 0.24 (CH2Cl2); 1H NMR (500 MHz, CDCl3) 7.42-7.33 (m, 10H, CHarom), 6.55 (d, J3,5 = 2.2 Hz, 1H, H-3), 6.53 (d, J5,3 = 2.3 Hz, 1H, H-5), 5.15 (s, 2H, CH2Ph), 5.07 (s, 2H, CH2Ph), 2.58 (s, 3H, 6-Me); 13C NMR (125 MHz, CDCl3) δ 168.7 (C-7), 161.4 (C-4), 158.7 (C2), 143.9 (C-6), 136.2 (Ci, CH2Ph), 135.4 (Ci, CH2Ph), 129.0, 128.8, 128.6, 128.4, 127.7, 127.6 (CHarom), 113.3 (C-1), 110.5 (C-5), 98.9 (C-3), 71.8 (CH2Ph), 70.3 (CH2Ph), 22.6 (6-Me); IR (film): 3063, 3033, 2926, 1691, 1602, 1498, 1453, 1377, 1323, 1284, 1165, 736, 697 cm-1; HRMS (ESI) calcd. for [C22H20O4+H]+: 349.1434; obsd.: 349.1445. General procedure for esterification. Diol 7 (1 equiv.) and carboxylic acid (4.5 equiv.) were co-evaporated with toluene (2 × 20-40 mL/mmol) and then dissolved in dry toluene (10-20 mL/mmol). EDCI (6.5-6.6 equiv.) and DMAP (1 equiv.) were added and the reaction mixture was stirred at 60 °C overnight. Additional reagents were added where necessary and are detailed in the individual procedures. Upon reaction completion (as gauged by TLC analysis) the reaction


36

Page 37 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mixture was diluted with EtOAc, washed with water and brine, dried over MgSO4, filtered, and concentrated in vacuo. 2,2ʹ,3,3ʹ,4,4ʹ-Hexa-O-benzyl-6,6´-di-O-(2-benzyloxy-4-octadecyloxybenzoyl)-α,α´-Dtrehalose (8a). Diol 7 (55 mg, 0.062 mmol), acid 4a (136 mg, 0.274 mmol), EDCI (64 mg, 0.33 mmol), DMAP (11 mg, 0.090 mmol), and toluene (2 mL) were subjected to the conditions described in the general procedure for esterification. After 18 hours, an additional portion of 4a (21 mg, 0.042 mmol) was added before continuing with the general procedure. The resulting residue was purified by gradient silica gel flash column chromatography (petroleum ether:EtOAc,19:1–9:1, v/v) to give the title compound as a colourless oil (75 mg, 0.041 mmol, 66%). Rf = 0.56 (petroleum ether:EtOAc, 7:3, v/v); [α]17.2D = +59.6 (c = 1.0, CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 7.85 (d, J6',5' = 8.5 Hz, 2H, H-6'), 7.47 (d, J = 7.6 Hz, 4H, CHarom), 7.24– 7.36 (m, 36H, CHarom), 6.45-6.48 (m, 4H, H-3' & H-5'), 5.20 (d, J1,2 = 3.3 Hz, 2H, H-1), 5.15 (s, 4H, CH2Ph), 5.01 (d, Ja,b = 10.9 Hz, 2H, CHa 3-O-Bn), 4.88 (d, Ja,b = 11.1 Hz, 2H, CHb 3-O-Bn), 4.83 (d, Ja,b = 11.1 Hz, 2H, CHa 4-O-Bn), 4.64 (s, 4H, CH2 2-O-Bn), 4.58 (d, Ja,b = 10.7 Hz, 2H, CHb 4-O-Bn), 4.40 (dd, J6a,6b = 12.2 Hz, J6a,5 = 3.0 Hz, 2H, H-6a), 4.31-4.35 (m, 4H, H-6b & H5), 4.07 (t, J3,2 = J3,4 = 9.2 Hz, 2H, H-3), 3.92 (t, J8,9 = 6.7 Hz, 4H, CH2-8), 3.51 (dd, J2,3 = 9.6 Hz, J2,1 = 3.2 Hz, 2H, H-2), 1.75 (p, J9,8 = J9,10 = 7.5 Hz, 4H, CH2-9), 1.40–1.46 (m, 4H, CH2-10), 1.25-1.36 (m, 56H, CH2-11–CH2-24), 0.89 (t, J25,24 = 6.8 Hz, 6H, CH3-25); 13C NMR (125 MHz, CDCl3) δ 165.2 (C-7), 163.8 (C-4'), 160.4 (C-2'), 138.9 (Ci , 3-O-Bn), 138.1 (Ci , 4-O-Bn), 137.9 (Ci , 2-O-Bn), 136.8 (Ci , CH2Ph), 133.9 (C-6'), 128.7, 128.6, 128.54, 128.50, 128.3, 128.04, 127.95, 127.82, 127.81, 127.7, 127.6, 126.8 (CHarom), 112.5 (C-1'), 105.8 (C-5'), 101.0 (C-3'), 94.0 (C-1), 81.7 (C-3), 79.4 (C-2), 77.9 (C-4), 75.8 (CH2, 3-O-Bn), 75.4 (CH2, 4-O-Bn), 72.9 (CH2, 2-O-Bn), 70.4 (CH2, CH2Ph), 69.5 (C-5), 68.4 (C-8), 62.8 (C-6), 32.1, 29.83, 29.80, 29.79,


37


Page 38 of 66

29.74, 29.70, 29.51, 29.50, 29.2, 26.1, 22.8 (C-9-C-24), 14.3 (C-25); IR (film): 2922, 2852, 1723, 1606, 1454, 1244, 1069, 1028, 997, 732, 696 cm-1; HRMS (ESI) calcd. for [C118H150O17+NH4]+: 1857.1211; obsd.: 1857.1223. 2,2ʹ,3,3ʹ,4,4ʹ-Hexa-O-benzyl-6,6´-di-O-(2-benzyloxy-4-heptyloxybenzoate)-α,α´-Dtrehalose (8b). Diol 7 (114 mg, 0.129 mmol), acid 4b (199 mg, 0.581 mmol), EDCI (161 mg, 0.839 mmol), DMAP (16 mg, 0.129 mmol) and toluene (3 mL) were subjected to the conditions described in the general procedure for esterification. The resulting oil was purified by gradient silica gel flash column chromatography (petroleum ether:EtOAc, 9:1–5:1, v/v) to give the title compound as a colourless oil (138 mg, 0.103 mmol, 70%). Rf = 0.36 (petroleum ether:EtOAc, 4:1, v/v); [α]21.1D = +74.6 (c = 1.0, CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 7.80 (d, J6',5' = 8.4 Hz, 2H, H-6'), 7.24-7.48 (m, 40H, CHarom), 6.43-6.47 (m, 4H, H-3' & H-5'), 5.20 (d, J1,2 = 3.7 Hz, 2H, H-1), 5.15 (s, 4H, CH2Ph), 5.01 (d, Ja,b = 10.6 Hz, 2H, CHa 3-O-Bn), 4.88 (d, Ja,b = 11.0 Hz, 2H, CHb 3-O-Bn), 4.83 (d, Ja,b = 10.4 Hz, 2H, CHa 4-O-Bn), 4.64 (s, 4H, CH2 2-O-Bn), 4.57 (d, Ja,b = 10.5 Hz, 2H, CHb 4-O-Bn), 4.40 (dd, J6a,6b = 12.5 Hz, J6a,5 = 3.5 Hz, 2H, H-6a), 4.31-4.36 (m, 4H, H-5 & H-6b), 4.07 (t, J3,2 = J3,4 = 9.3 Hz, 2H, H-3), 3.92 (t, J8,9 = 6.7 Hz, 4H, CH2-8), 3.72 (t, J4,3 = J4,5 = 9.5 Hz, 2H, H-4), 3.51 (dd, J2,3 = 9.6 Hz, J2,1 = 3.4 Hz, 2H, H-2), 1.75 (p, J9,8 = J9,10 = 6.8 Hz, 4H, CH2-9), 1.40-1.48 (m, 4H, CH2-10), 1.29-1.39 (m, 12H, CH2-11-CH2-13), 0.90 (t, J14,13 = 6.3 Hz, 6H, CH3-14);

13

C NMR δ 165.1 (C-7), 163.7 (C-4'), 160.4 (C-2'), 138.8

(C-i, 3-O-Bn), 138.0 (C-i, 4-O-Bn), 137.8 (C-i, 2-O-Bn), 136.7 (C-i, CH2Ph), 133.8 (C-6'), 128.6, 128.44, 128.40, 128.2, 127.9, 127.85, 127.72, 127.70, 127.6, 127.5, 126.7 (CHarom), 112.4 (C-1'), 105.7 (C-5'), 100.9 (C-3'), 93.9 (C-1), 81.6 (C-3), 79.3 (C-2), 77.8 (C-4), 75.7 (CH2, 3-OBn), 75.3 (CH2, 4-O-Bn), 72.8 (CH2, 2-O-Bn), 70.3 (CH2Ph), 69.4 (C-5), 68.2 (C-8), 62.7 (C-6), 31.8, 29.05, 29.02, 25.9, 22.6 (C-9-C-13), 14.1 (C-14); IR (film): 3031, 2928, 2857, 1722, 1606,


38

Page 39 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1574, 1524, 1498, 1454, 1432, 1378, 1243, 1070, 1070, 997, 734, 696 cm-1; HRMS (ESI) calcd. for [C96H106O17+NH4]+: 1548.7774; obsd.: 1548.7782. 2,2',3,3',4,4'-Hexa-O-benzyl-6,6'-di-O-(2-benzyloxy-4-butoxybenzoyl)-α,α'-D-trehalose (8c). Diol 7 (103 mg, 0.117 mmol), acid 4c (158 mg, 0.527 mmol), EDCI (150 mg, 0.782 mmol), DMAP (14.3 mg, 0.117 mmol) and toluene (2.5 mL) were subjected to the conditions described in the general procedure for esterification. The resulting residue was purified by gradient silica gel flash column chromatography (petroleum ether:EtOAc, 9:1–17:3, v/v) to give the title compound as a clear oil (103 mg, 0.071 mmol, 61%). Rf = 0.67 (CH2Cl2:EtOAc, 19:1, v/v); [α]16D = +75 (c = 1.0, CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 7.83 (d, J6',5' = 8.4 Hz, 2H, H6'), 7.25-7.38 (m, 40H, CHarom), 6.44-6.47 (m, 4H, H-5' & H-6'), 5.23 (d, J1,2 = 3.4 Hz, 2H, H-1), 5.17 (s, 4H, CH2Ph), 5.03 (d, Ja,b = 10.8 Hz, 2H, CHa 3-O-Bn), 4.90 (d, Ja,b = 10.8 Hz, 2H, CHb 3-O-Bn), 4.85 (d, Ja,b = 10.4 Hz, 2H, CHa 4-O-Bn), 4.66 (s, 4H, CH2 2-O-Bn), 4.59 (d, Ja,b = 10.4 Hz, 2H, CHb 4-O-Bn), 4.42 (dd, J6a,6b = 12.6 Hz, J6a,5 = 3.3 Hz, 2H, H-6a), 4.31-4.36 (m, 4H, H-5 & H-6b), 4.10 (t, J3,2 = J3,4 = 9.4 Hz, 2H, H-3), 3.95 (t, J8.9 = 6.4 Hz, 4H, CH2-8), 3.74 (t, J4,3 = J4,5 = 9.5 Hz, 2H, H-4), 3.54 (dd, J2,3 = 9.6 Hz, J2,1 = 3.5 Hz, 2H, H-2), 1.75 (p, J9,8 = J9,10 = 6.9 Hz, 4H, CH2-9), 1.49 (sext, J10,9 = J10,11 = 7.4 Hz, 4H, CH2-10), 0.99 (t, J11,10 = 7.3 Hz, 6H, CH311); 13C NMR (125 MHz, CDCl3) δ 165.2 (C-7), 163.8 (C-4'), 160.4 (C-2'), 138.8 (C-i, 3-O-Bn), 138.0 (C-i, 4-O-Bn), 137.8 (C-i, 2-O-Bn), 136.7 (C-i, CH2Ph), 133.8 (C-6'), 128.6, 128.5, 128.4, 128.3, 128.0, 127.9, 127.74, 127.72, 127.6, 127.5, 126.7 (CHarom), 112.4 (C-1'), 105.8, 101.0 (C3', C-5'), 93.9 (C-1), 81.7 (C-3), 79.3 (C-2), 77.9 (C-4), 75.7 (CH2, 3-O-Bn), 75.3 (CH2, 4-O-Bn), 72.8 (CH2, 2-O-Bn), 70.3 (CH2, CH2Ph), 69.4 (C-5), 67.9 (C-8), 62.7 (C-6), 31.1 (C-9), 19.2 (C10), 13.9 (C-11); IR (film): 2932, 2872, 1722, 1606, 1498, 1454, 1433, 1070, 697 cm-1; HRMS(ESI) m/z calcd. for [C90H94O17+H]+ : 1447.6564; obsd.: 1447.6592.


39


Page 40 of 66

2,2',3,3',4,4'-Hexa-O-benzyl-6,6'-di-O-(2-benzyloxy-4-methoxybenzoyl)-α,α'-D-trehalose (8d). Diol 7 (149 mg, 0.169 mmol), acid 4d (196 mg, 0.760 mmol), EDCI (186 mg, 0.970 mmol), and DMAP (21 mg, 0.172 mmol) were subjected to the conditions described in the general procedure for esterification. After 18 hours, additional portions of 4d (20 mg, 0.077 mmol), EDCI (22 mg, 0.11 mmol), and DMAP (10 mg, 0.082 mmol) were added before continuing with the general procedure. The resulting residue was purified using silica gel flash column chromatography (petroleum ether:EtOAc, 9:1–3:1, v/v) and lipophilic sephadex (CH2Cl2:MeOH, 1:1, v/v) to give the title compound as a colourless oil (150 mg, 0.110 mmol, 65%). Rf = 0.60 (petroleum ether:EtOAc, 1:1, v/v); [α]18D = +79 (c = 1.0, CH2Cl2);

1

H NMR

(500 MHz, CDCl3) δ 7.83 (d, J6',5' = 9.2 Hz, 2H, H-6'), 7.47 (d, J = 7.7 Hz, 2H, CHarom), 7.387.25 (m, 38H, CHarom), 6.47 (m, 4H, H-5' & H-3'), 5.21 (d, J1,2 = 3.6 Hz, 2H, H-1), 5.16 (s, 4H, CH2Ph), 5.03 (d, Ja,b = 10.9 Hz, 2H, CHa 3-O-Bn), 4.89 (d, Ja,b = 10.9 Hz, 2H, CHb 3-O-Bn), 4.84 (d, Ja,b = 10.6 Hz, 2H, CHa 4-O-Bn), 4.65 (s, 4H, 2-O-Bn), 4.59 (d, Ja,b = 10.5 Hz, CHb 4-O-Bn), 4.41 (dd, J6a,6b = 12.5 Hz, J6a,5 = 3.5 Hz, 2H, H-6a), 4.36-4.32 (m, 4H, H-5 & H-6b), 4.09 (t, J3,2 = J3,4 = 9.3 Hz, 2H, H-3), 3.79 (s, 6H, OMe), 3.73 (t, J4,3 = J4,5 = 9.4 Hz, 2H, H-4), 3.53 (dd, J2,3 = 9.7 Hz, J2,1 = 3.5 Hz, 2H, H-2); 13C NMR (125 MHz, CDCl3) δ 165.2 (C-7), 164.2 (C-4'), 160.4 (C-2'), 138.9 (Ci, 3-O-Bn), 138.1 (Ci, 4-O-Bn), 137.9 (Ci, 2-O-Bn), 136.7 (Ci, CH2Ph), 134.0 (C6'), 128.7, 128.57, 128.52, 128.3, 128.1, 127.99, 127.88, 127.83, 127.7, 127.6, 126.8 (CHarom), 112.8 (C-1'), 105.2, 100.7 (C-3', C-5'), 94.1 (C-1), 81.7 (C-3), 79.4 (C-2), 77.9 (C-4), 75.8 (CH2, 3-O-Bn), 75.4 (CH2, 4-O-Bn), 72.9 (CH2, 2-O-Bn), 70.5 (CH2Ph), 69.5 (C-5), 62.9 (C-6), 55.6 (OMe); IR (film): 3031, 2934, 1722, 1608, 1575, 1498, 1443, 1430, 1380, 1327, 1248, 1147, 1028, 735 cm-1; HRMS (ESI) m/z calcd. For [C84H82O17+NH4]+: 1380.5890; obsd.: 1380.5946.


40

Page 41 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2,2',3,3',4,4'-Hexa-O-benzyl-6,6'-di-O-(2,4-bis(benzyloxy)benzoyl)-α,α'-D-trehalose

(8e).

Diol 7 (136 mg, 0.154 mmol), acid 4e (231 mg, 0.691 mmol), EDCI (195 mg, 1.02 mmol), DMAP (19 mg, 0.154 mmol), and toluene (2 mL) were subjected to the conditions described in the general procedure for esterification. The residue was purified by gradient silica gel flash column chromatography (petroleum ether to petroleum ether:EtOAc, 17:3, v/v) and lipophilic sephadex (CH2Cl2:MeOH, 1:1, v/v) to give the title compound as a colourless oil (136 mg, 0.090 mmol, 58%). Rf = 0.63 (petroleum ether:EtOAc, 24:1, v/v); [α]18.4D = +55.8 (c = 1.0, CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 7.82 (d, J6',5' = 8.3 Hz, 2H, H-6'), 7.23-7.46 (m, 50H, CHarom), 6.536.55 (m, 4H, H-3' & H-5'), 5.22 (d, J1,2 = 3.5 Hz, 2H, H-1), 5.14 (s, 4H, CH2Ph), 5.04 (s, 4H, CH2Ph), 5.04-5.02 (m, 2H, CHa 3-O-Bn), 4.89 (d, Ja,b = 10.8 Hz, 2H, CHb 3-O-Bn), 4.85 (d, Ja,b = 10.6 Hz, 2H, CHa 4-O-Bn), 4.65 (s, 4H, CH2 2-O-Bn), 4.59 (d, Ja,b = 10.6 Hz, 2H, CHb 4-O-Bn), 4.42 (dd, J6a,6b = 12.4 Hz, J6a,5 = 3.4 Hz, 2H, H-6a), 4.31-4.36 (m, 4H, H-5 & H-6b), 4.09 (t, J3,2 = J3,4 = 9.3 Hz, 2H, H-3), 3.73 (t, J4,3 = J4,5 = 9.6 Hz, 2H, H-4), 3.53 (dd, J2,3 = 9.6 Hz, J2,1 = 3.5 Hz, 2H, H-2); 13C NMR (125 MHz, CDCl3) δ 165.1 (C-7), 163.2, 160.4 (C-2, C-4), 138.8 (Ci, 3-OBn), 138.0 (Ci, 4-O-Bn), 137.9 (Ci, 2-O-Bn), 136.6 (Ci, CH2Ph), 136.2 (Ci, CH2Ph), 133.9 (C6'), 128.8, 128.7, 128.5, 128.5, 128.3, 128.3, 128.0, 127.9, 127.9, 127.8, 127.7, 127.6, 127.6, 126.8 (CHarom), 113.0 (C-1'), 106.1 (C-3'), 101.5 (C-5'), 94.0 (C-1), 81.7 (C-3), 79.3 (C-2), 77.9 (C-4), 75.7 (CH2, 3-O-Bn), 75.3 (CH2, 4-O-Bn), 72.8 (CH2, 2-O-Bn), 70.4 (CH2Ph), 70.3 (CH2Ph), 69.5 (C-5), 62.8 (C-6); IR (film): 3030, 2870, 1721, 1606, 1575, 1498, 1454, 1243, 1213, 1175, 1070, 1027, 997, 836, 734, 696 cm-1 ; HRMS(ESI) m/z calcd. For [C96H90O17 + NH4]+ : 1532.6516; obsd.: 1532.6579. 2,2ʹ,3,3ʹ,4,4ʹ-Hexa-O-benzyl-6,6´-di-O-(4-octadecyloxybenzoyl)-α,α´-D-trehalose (8f). Diol 7 (300 mg, 0.340 mmol), acid 5a (598 mg, 1.53 mmol), EDCI (456 mg, 2.38 mmol), DMAP (42


41


Page 42 of 66

mg, 0.340 mmol), and toluene (3 mL) were subjected to the conditions described in the general procedure for esterification. The resulting residue was purified by gradient silica gel flash column chromatography (petroleum ether:EtOAc, 19:1, v/v) to give the title compound as a pale yellow oil (442 mg, 0.272 mmol, 80%). Rf = 0.7 (petroleum ether:EtOAc, 9:1, v/v); [α]23ᴅ = +55 (c = 1.0, CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 7.91 (d, J2',3' = 8.3 HZ, 2H, H-2'), 7.39-7.24 (m, 30H, CHarom), 6.85 (d, J3',2' = 8.3 Hz, 2H, H-3'), 5.23 (d, J1,2 = 3.5 Hz, 2H, H-1), 5.03 (d, Ja,b = 10.7 Hz, 2H, CHa 3-O-Bn), 4.90 (d, Ja,b = 9.4 Hz, 2H, CHb 3-O-Bn), 4.88 (d, Ja,b = 9.7 Hz, 2H, CHa 4-O-Bn), 4.73 (d, Ja,b = 11.9 Hz, 2H, CHa 2-O-Bn), 4.69 (d, Ja,b = 11.9 Hz, 2H, CHb 2-OBn), 4.57 (d, Ja,b = 10.7 Hz, 2H, CHb 4-O-Bn), 4.29-4.34 (m, 4H, H-5 & H-6a), 1.46 (dd, J6a,6b = 12.4 Hz, J6b,5 = 3.2 Hz, 2H, H-6b), 4.11 (t, J3,2 = J3,4 = 9.4 Hz, 2H, H-3), 3.98 (t, J8,9 = 6.5 Hz, 4H, CH2-8), 3.68 (t, J4,3 = J4,5 = 9.6 Hz, 2H, H-4), 3.62 (dd, J2,3 = 9.5 Hz, J2,1 = 3.2 Hz, 2H, H-2), 1.79 (p, J9,8 = J9,10 = 6.9 Hz, 4H, CH2-9), 1.40-1.48 (m, 2H, CH2-10), 1.38-1.24 (m, 56H, CH211-CH2-24), 0.90 (t, J25,24 = 6.5 Hz, 3H, CH3-25);

13

C NMR (125 MHz, CDCl3) δ 166.1 (C-7),

163.2 (C-4'), 138.7 (Ci, 3-O-Bn), 138.0 (Ci, 4-O-Bn), 137.9 (Ci, 2-O-Bn), 131.8 (C-2'), 128.64, 128.63, 128.62, 128.3, 128.25, 128.1, 127.92, 127.90, 127.6 (CHarom), 122.1 (C-1'), 114.2 (C-3'), 94.1 (C-1), 81.9 (C-3), 79.7 (C-2), 77.9 (C-4), 76.1 (CH2, 3-O-Bn), 75.5 (CH2, 4-O-Bn), 73.1 (CH2, 2-O-Bn), 69.5 (C-5), 68.4 (C-8), 62.9 (C-6), 32.1, 31.7, 29.85, 29.83, 29.83, 29.76, 29.72, 29.54, 29.52, 29.3 27.1, 26.2 (C-9–C-24), 22.9 (C-25); IR (film): 2922, 2852, 1716, 1605, 1454, 1273, 1166, 1096, 1070, 996, 695 cm-1; HRMS (ESI) calcd. for [C104H138O17+NH4]+: 1645.0374; obsd.: 1645.0373. 2,2ʹ,3,3ʹ,4,4ʹ-Hexa-O-benzyl-6,6ʹ-di-O-(4-heptyloxybenzoyl)-α,αʹ-ᴅ-trehalose (8g). Diol 7 (89 mg, 0.10 mmol), acid 5b (106 mg, 0.45 mmol), EDCI (125 mg, 0.65 mmol), DMAP (12 mg, 0.10 mmol), and toluene (2 mL) were subjected to the conditions described in the general


42

Page 43 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


procedure for esterification. The resulting residue was purified using gradient silica gel flash column chromatography (petroleum ether:EtOAc, 1:0–17:3, v/v) to give the title compound as a colourless oil (109 mg, 0.083 mmol, 83%). Rf = 0.5 (petroleum ether:EtOAc, 4:1, v/v); [α]23ᴅ = +67 (c = 1.0, CH2Cl2); 1H-NMR (500 MHz, CDCl3) δ 7.93 (d, J2',3' = 7.8 Hz, 4H, H-2'), 7.40– 7.26 (m, 30H, CHarom), 6.87 (d, J3',2' = 8.1 Hz, 4H, H-3'), 5.25 (d, J1,2 = 3.0 Hz, 2H, H-1), 5.05 (d, Ja,b = 10.5 Hz, 2H, CHa 3-O-Bn), 4.91 (d, Ja,b = 9.3 Hz, 2H, CHb 3-O-Bn), 4.91 (d, Ja,b = 9.3 Hz, 2H, CHa 4-O-Bn), 4.75 (d, Ja,b = 11. 8 Hz, 2H, CHa 2-O-Bn), 4.71 (d, Ja,b = 11.7 Hz, 2H, CHb 2O-Bn), 4.58 (d, Ja,b = 10.8 Hz, 2H, CHb 4-O-Bn), 4.35–4.26 (m, 6H, CH2-6 & H-5), 4.13 (t, J3,2 = J3,4 = 9.4 Hz, 2H, H-3), 4.00 (t, J8,9 = 6.4 Hz, 4H, CH2-8), 3.70 (t, J4,3 = J4,5 = 9.5 Hz, 2H, H-4), 3.64 (dd, J2,3 = 9.5 Hz, J2,1 = 2.7 Hz, 2H, H-2), 1.80 (p, J9,8 = J9,10 = 6.9 Hz, 4H, CH2-9), 1.47 (p, J10,9 = J10,11 = 7.5 Hz, 4H, CH2-10), 1.40-1.32 (m, 12H, CH2-11-CH2-13), 0.91 (t, J14,13 = 6.4 Hz, 6H, CH3-14); 13C NMR (125 MHz, CDCl3) δ 166.0 (C-7), 163,1 (C-4') 138.5 (Ci, 3-O-Bn), 137.8 (Ci, 4-O-Bn), 137.8 (Ci, 2-O-Bn), 131.7 (C-2'), 128.5, 128.5, 128.2, 128.1, 128.0, 127.8, 127.8, 127.4 (CHarom), 122.0 (C-1'), 114.1 (C-3'), 94.0 (C-1), 81.7 (C-3), 79.5 (C-2), 77.7 (C-4), 75.9 (CH2, 3-O-Bn), 75.3 (CH2, 4-O-Bn), 73.0 (CH2, 2-O-Bn), 69.4 (C-5), 68.2 (C-8), 62.7 (C-6), 31.8, 22.6, 29.1, 25.9 (C-9–C-13), 29.0 (C-10), 14.1 (C-14); IR (film): 3064, 3031, 2927, 2856, 1715, 1605, 1510, 1454, 1252, 1166, 846, 734, 696 cm-1; HRMS (ESI) calcd. for [C82H98NO15]+: 1336.6931; obsd.: 1336.6870. 2,2ʹ,3,3ʹ,4,4ʹ-Hexa-O-benzyl-6,6´-di-O-(2-benzyloxy-6-methyl-4-octadecyloxybenzoyl)α,α´-D-trehalose (8h). Diol 7 (115 mg, 0.13 mmol), acid 6a (290 mg, 0.568 mmol), EDCI (139 mg, 0.73 mmol), DMAP (17 mg, 0.139 mmol), and toluene (3 mL) were subjected to the conditions described in the general procedure for esterification. After 18 hours, additional portions of 8h (83 mg, 0.16 mmol) and EDCI (25 mg, 0.13 mmol) were added before continuing


43


Page 44 of 66

with the general procedure. The resulting residue was purified using gradient silica gel flash column chromatography (petroleum ether:EtOAc, 19:1–9:1, v/v) to give the title compound as colourless oil (166 mg, 0.089 mmol, 68%). Rf = 0.83 (CH2Cl2); [α]22.4ᴅ = +47.5 (c = 1.0, CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 7.30-7.10 (m, 40H, CHarom), 6.25 (s, 2H, H-5'), 6.22 (s, 2H, H-3'), 5.07 (d, J1,2 = 3.2 Hz, 2H, H-1), 4.97 (s, 4H, CH2Ph), 4.94 (d, Ja,b = 10.6 Hz, 2H, CHa 3-O-Bn), 4.79 (d, Ja,b = 10.9 Hz, 2H, CHb 3-O-Bn), 4.73 (d, Ja,b = 10.5 Hz, 2H, CHa 4-O-Bn), 4.55-4.46 (m, 8H, H-6a, CHb 4-O-Bn, CH2 2-O-Bn), 4.24 (d, J6a,6b = 10.5 Hz, 4H, H-5 & H-6b), 3.98 (t, J3,2 = J3,4 = 9.2 Hz, 2H, H-3), 3.83 (t, J8,9 = 6.5 Hz, 4H, CH2-8), 3.57 (t, J4,3 = J4,5 = 9.3 Hz, 2H, H-4), 3.41 (dd, J2,3 = 9.6 Hz, J2,1 = 3.2 Hz, 2H, H-2), 2.23 (s, 6H, 6-Me), 1.70 (p, J9,8 = J9,10 = 6.8 Hz, 4H, CH2-9), 1.38-1.45 (m, 2H, CH2-10), 1.32-1.22 (m, CH2-11-CH2-24), 0.86 (t, J25,24 = 6.9 Hz, 6H, CH3-25); 13C NMR (125 MHz, CDCl3) δ 168.2 (C-7), 160.9 (C-4'), 157.2 (C2'), 139.0 (Ci, 3-O-Bn), 138.4 (C-6'), 138.2 (Ci, 4-O-Bn), 138.0 (Ci, 2-O-Bn), 136.9 (Ci, CH2Ph), 128.6, 128.5, 128.45, 128.43, 128.3, 127.9, 127.8, 127.79, 127.7, 127.6, 127.6, 126.8 (CHarom), 116.7 (C-1'), 107.9 (C-5'), 98.1 (C-3'), 93.7 (C-1), 81.5 (C-3), 79.2 (C-2), 78.0 (C-4), 75.6 (CH2, 3-O-Bn), 75.3 (CH2, 4-O-Bn), 72.6 (CH2, 2-O-Bn), 70.2 (CH2, CH2Ph), 69.4 (C-5), 68.2 (C-8), 63.2 (C-6), 32.1, 29.86, 29.81, 29.78, 29.74, 29.55, 29.52, 22.9 (C-11-C-24), 29.3 (C-9), 26.2 (C10), 20.2 (6-Me), 14.3 (C-25); IR (film): 2923, 2853, 1728, 1604, 149997, 1375, 1327, 1262, 1164, 1093, 1071, 998, 734, 696 cm-1; HRMS (ESI) calcd for [C120H154O17+H]+: 1868.1259; obsd.: 1868.1275. 2,2ʹ,3,3ʹ,4,4ʹ-Hexa-O-benzyl-6,6´-di-O-(2,4-benzyloxy-6-methylbenzoyl)-α,α´-D-trehalose (8i). Diol 7 (166 mg, 0.188 mmol), acid 6b (295 mg, 0.847 mmol), EDCI (190 mg, 0.991 mmol), DMAP (23 mg, 0.188 mmol), and toluene (2.5 mL) were subjected to the conditions described in the general procedure for esterification. After 18 hours, additional portions of 6b (70 mg, 0.20


44

Page 45 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mmol) and EDCI (36 mg, 0.188 mmol) were added. After a further 18 hours, 6b (52 mg, 0.15 mmol), EDCI (35 mg, 0.18 mmol), and DMAP (20 mg, 0.16 mmol) were added before continuing with the general procedure. The resulting residue was purified by gradient silica gel flash column chromatography (petroleum ether:EtOAc, 1:0–4:1, v/v) to give the title compound as a colourless oil (150 mg, 0.097 mmol, 52%). Rf = 0.76 (petroleum ether:EtOAc, 1:1, v/v); [α]23ᴅ = +67.8 (c = 1.0, CH2Cl2); 1H NMR (500 MHz, CDCl3) δ 7.40-7.14 (m, 50H, CHarom), 6.36 (d, J5',3' = 1.8 Hz, 2H, H-5'), 6.31 (d, J3',5' = 1.9 Hz, 2H, H-3'), 5.10 (d, J1,2 = 3.5 Hz, 2H, H1), 4.90-4.99 (m, 8H, CH2Ph, CHa 4'-O-Bn & CHa 3-O-Bn), 4.82 (d, Ja,b = 11.1 Hz, 2H, CHb 3O-Bn), 4.75 (d, Ja,b = 10.3 Hz, 2H, CHa 4-O-Bn), 4.57-4.49 (m, 8H, CHb 4-O-Bn, CH2Ph, H-6a), 4.26 (m, 4H, H-6b & H-5), 4.00 (t, J3,2 = J3,4 = 9.3 Hz, 2H, H-3), 3.59 (t, J4,3 = J4,5 = 9.4 Hz, 2H, H-4), 3.43 (dd, J2,3 = 9.6 Hz, J2,1 = 3.5 Hz, 2H, H-2), 2.25 (s, 6H, 6-Me); 13C NMR (125 MHz, CDCl3) δ 168.1 (C-7), 160.5 (C-4'), 157.2 (C-2'), 139.0 (Ci, 3-O-Bn), 138.4 (C-6'), 138.2 (Ci, 4O-Bn), 138.0 (Ci, 2-O-Bn), 136.74 (Ci, CH2Ph), 136.65 (Ci, CH2Ph), 117.2 (C-1'), 108.2 (C-5'), 98.5 (C-3'), 93.8 (C-1), 81.5 (C-3), 79.2 (C-2), 77.9 (C-4), 75.6 (CH2, 3-O-Bn), 75.4 (CH2, 4-OBn), 72.7 (CH2Ph), 69.5 (C-5), 63.3 (C-6), 20.2 (6-Me); IR (film): 3031, 2926, 2871, 1727, 1603, 1497, 1454, 1372, 1326, 1264, 1159, 1092, 1071, 997, 735, 697 cm-1; HRMS (ESI) calcd. for [C98H94O17+NH4]+: 1560.6829; obsd.: 1560.6894. General procedure for debenzylation. To a solution of benzyl-protected trehalose diester (1 equiv.) dissolved in MeOH:CH2Cl2 (5 mL, 1:1, v/v) was added Pd(OH)2/C. H2-gas was allowed to bubble through the reaction mixture overnight. Following reaction completion (as gauged by TLC) the suspension was diluted in pyridine and filtered over celite. 6,6'-Di-O-(2-hydroxy-4-octabenzyloxybenzoyl)-α,α'-D-trehalose (9a). Benzyl protected trehalose 8a (140 mg, 0.076 mmol) and Pd(OH)2/C were subjected to the conditions described in


45


Page 46 of 66

the general procedure for debenzylation. The resulting residue was purified using gradient silica gel flash column chromatography (EtOAc:MeOH, 1:0-9:1, v/v) and lipophilic sephadex (CH2Cl2:MeOH, 1:1, v/v) to give the title compound as an amorphous white solid (58 mg, 0.052 mmol, 68%). Rf = 0.37 (EtOAc); [α]21.6D = +52 (c = 0.1, pyridine); 1H NMR (500 MHz, C5D5N) δ 11.41 (s, 2H, OH), 8.06 (d, J6',5' = 8.7 Hz, 2H, H-6'), 6.71 (d, J3',5' = 1.7 Hz, 2H, H-3'), 6.47 (dd, J5',6' = 8.9 Hz, J5',3' = 2.0 Hz, 2H, H-5'), 5.91 (d, J1,2 = 3.4 Hz, 2H, H-1), 5.12-5.15 (m, 4H, H-5 & H-6a), 4.99 (dd, J6b,6a = 11.6 Hz, J6b,5 = 5.5 Hz, 2H, H-6b), 4.80 (t, J3,2 = J3,4 = 9.1 Hz, 2H, H-3), 4.37 (dd, J2,3 = 9.6 Hz, J2,1 = 3.6 Hz, 2H, H-2), 4.23 (t, J4,3 = J4,5 = 9.3 Hz, 2H, H-4), 3.91 (t, J8,9 = 6.5 Hz, 4H, CH2-8), 1.71 (p, J9,8 = J9,10 = 7.3 Hz, 4H, CH2-9), 1.38-1.43 (m, 4H, CH2-10), 1.2435 (m, 56H, CH2-11-CH2-24), 0.87 (t, J25,24 = 6.8 Hz, 6H, CH3-25);

13

C NMR (125 MHz,

C5D5N) δ 170.7 (C-7), 166.0 (C-4'), 164.6 (C-2'), 132.4 (C-6'), 108.5 (C-5'), 106.5 (C-1'), 102.2 (C-3'), 96.5 (C-1), 75.4 (C-3), 73.7 (C-2), 72.4 (C-4), 71.8 (C-5), 68.9 (C-8), 65.6 (C-6), 32.5, 30.4, 3.37, 30.36, 30.34, 30.29, 30.26, 30.22 29.98, 23.3 (C-11-C-24), 29.6 (C-9), 26.6 (C-10), 14.7 (C-25); IR (film): 3403, 2917, 2849, 1698, 1662, 1504,1395, 1252, 1151, 1095, 1075, 1017, 987, 804, 770, 672 cm-1; HRMS (ESI) calcd. For [C62H103O17+H]+: 1119.7190; obsd. 1119.7169. 6,6'-Di-O-(4-heptyloxy-2-hydroxybenzoyl)-α,α'-D-trehalose (9b). Benzyl protected trehalose 8b (138 mg, 0.090 mmol) and Pd(OH)2/C (83 mg) were subjected to the conditions described in the general procedure for debenzylation. The resulting residue was purified using gradient silica gel flash column chromatography (EtOAc:petroleum ether-EtOAc:MeOH, 4:1-9:1, v/v) to give the title compound as an amorphous white solid (61 mg, 0.075 mmol, 83%). Rf = 0.76 (EtOAc:MeOH, 4:1, v/v); [α]20D = +46.0 (c = 0.1, pyridine); 1H NMR (500 MHz, C5D5N) δ 11.44 (s, 2H, OH), 8.06 (d, J6',5' = 8.9 Hz, 2H, H-6'), 6.72 (d, J3',5' = 2.4 Hz, 2H, H-3'), 6.47 (dd, J5',6' =


46

Page 47 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


8.9 Hz, J5',3' = 2.4 Hz, 2H, H-5'), 5.93 (d, J1,2 = 3.7 Hz, 2H, H-1), 5.23-5.27 (m, 2H, H-5), 5.12 (d, J6a,6b = 11.5 Hz, 2H, H-6a), 5.01 (dd, J6b,6a = 11.7 Hz, J6b,5 = 5.6 Hz, 2H, H-6b), 4.80 (t, J3,2 = J3,4 = 9.2 Hz, 2H, H-3), 4.37 (dd, J2,3 = 9.7 Hz, J2,1 = 3.8 Hz, 2H, H-2), 4.24 (t, J4,3 = J4,5 = 9.4 Hz, 2H, H-4), 3.89 (t, J8,9 = 6.5 Hz, 4H, CH2-8), 1.67 (p, J9,8 = J9,10 = 6.8 Hz, 4H, CH2-9), 1.31-1.38 (m, 4H, CH2-10), 1.16-1.26 (m, 12H, CH2-11-CH2-13), 0.85 (t, J14,13 = 7.1 Hz, 6H, CH3-14); 13C NMR (500 MHz, C5D5N) δ 170.6 (C-7), 165.9 (C-4'), 164.6 (C-2'), 132.4 (C-6'), 108.4 (C-5'), 106.5 (C-1'), 102.2 (C-3'), 96.4 (C-1), 75.4 (C-3), 73.7 (C-2), 72.4 (C-4), 71.8 (C-5), 68.9 (C-8), 65.6 (C-6), 32.3, 29.6, 29.5, 26.5, 23.2 (C-9-C-13), 14.6 (C-14); IR (film): 3340, 2926, 2856, 1668, 1152, 991, 777 cm-1; HRMS (ESI) calcd. For [C40H58O17+H]+: 811.3747; obsd. 811.3761. 6,6'-Di-O-(2-hydroxy-4-butoxybenzoyl)-α,α'-D-trehalose (9c). Benzyl protected trehalose 8c (82 mg, 0.056 mmol) and Pd(OH)2/C (49 mg) were subjected to the conditions described in the general procedure for debenzylation. The crude material was purified by gradient silica gel flash column chromatography (petroleum ether:EtOAc–EtOAc:MeOH, 1:1-17:3, v/v) and the title compound was obtained as an amorphous white solid (35 mg, 0.048 mmol, 86%). Rf = 0.26 (EtOAc); [α]20D = +69.8 (c = 1, pyridine); 1H NMR (500 MHz, C5D5N) δ 11.44 (s, 2H, OH), 8.05 (d, J6',5' = 8.8 Hz, 2H, H-6'), 6.68 (d, J3',5' = 2.5 Hz, 2H, H-3'), 6.43 (dd, J5',6' = 8.9 Hz, J5',3' = 2.5 Hz, 2H, H-5'), 5.94 (d, J1,2 = 3.7, 2H, H-1) 5.26 (ddd, J5,4 = 10.0 Hz, J5,6a = 5.3 Hz, J5,6b = 1.8 Hz, 2H, H-5), 5.13 (dd, J6a,6b = 11.7 Hz, J6b,5 = 2.0 Hz, 2H, H-6b), 5.01 (dd, J6a,6b = 11.7 Hz, J6a,5 = 5.5 Hz, H-6a), 4.81 (t, J3,2 =J3,4 = 9.2 Hz, 2H, H-3), 4.38 (dd, J2,3 = 9.6 Hz, J2,1 = 3.8 Hz, 2H, H2), 4.24 (t, J4,3 = J4,5 = 9.6 Hz, 2H, H-4), 3.85 (t, J8,9 = 6.5 Hz, 4H, CH2-8), 1.62 (pent, J9,8 = J9,10 = 7.7 Hz, 4H, CH2-9), 1.35 (sext, J10,9 = J10,11 = 7.5 Hz, 4H, CH2-10), 0.84 (t, J11,10 = 7.4 Hz, 6H, CH3-11);

13

C NMR (125 MHz, C5D5N) δ 170.7 (C-7), 165.9 (C-4'), 164.6 (C-2'), 132.4 (C-6'),

108.4 (C-5'), 106.5 (C-1'), 102.2 (C-3'), 96.5 (C-1), 75.4 (C-3), 73.7 (C-2), 72.4 (C-4), 71.8 (C-


47


Page 48 of 66

5), 68.5 (C-8), 65.6 (C-6), 31.5 (C-9), 19.7 (C-10), 14.2 (C-11); IR (film): 3293, 2959, 1668, 1622, 1580, 1504, 1351, 1249, 1151, 1084, 991, 776 cm-1; HRMS (ESI) calcd for [C43H46O17+H]+: 727.2813; obsd.: 727.2813. 6,6'-Di-O-(2-hydroxy-4-methoxybenzoyl)-α,α'-D-trehalose (9d). Benzyl protected trehalose 8d (86 mg, 0.068 mmol) and Pd(OH)2/C (52 mg) were subjected to the general procedure for debenzylation. The resulting residue was purified by gradient silica gel flash column chromatography (EtOAc:MeOH, 1:0-9:1, v/v) and the title was obtained as an amorphous white solid (27 mg, 0.042 mmol, 62%). Rf = 0.66 (EtOAc:MeOH, 4:1, v/v); [α]20D = +103.6 (c = 1, MeOH); 1H NMR (500 MHz, C5D5N) δ 11.42 (s, 2H, OH), 8.02 (d, J6',5' = 8.9 Hz, 2H, H-6'), 6.65 (d, J3',5' = 2.5 Hz, 2H, H-3'), 6.38 (dd, J5',6' = 8.9 Hz, J5',3' = 2.5 Hz, 2H, H-5'), 5.93 (d, J1,2 = 3.7 Hz, 2H, H-1), 5.26 (ddd, J5,4 = 10.0 Hz, J5,6a = 5.4 Hz, J5,6b = 1.9 Hz, 2H, H-5), 5.12 (dd, J6a,6b = 11.6 Hz, J6a,5 = 2.0 Hz, 2H, H-6a), 5.01 (dd, J6a,6b = 11.6 Hz, J6b,5 = 5.6 Hz, 2H, H-6b), 4.81 (t, J3,2 = J3,4 = 9.2 Hz, 2H, H-3), 4.38 (dd, J2,3 = 9.6 Hz, J2,1 = 3.7 Hz, 2H, H-2), 4.24 (t, J4,3 = J4,5 = 9.5 Hz, 2H, H-4), 3.62 (s, 3H, OMe); 13C NMR (125 MHz, C5D5N) δ 170.6 (C-7), 166.3 (C-4'), 164.6 (C-2'), 132.4 (C-6'), 108.0 (C-5'), 106.6 (C-1'), 101.7 (C-3'), 96.5 (C-1), 75.4 (C-3), 73.7 (C-2), 72.4 (C-4), 71.8 (C-5), 65.7 (C-6), 55.8 (OMe); IR (film): 3258, 2919, 1664, 1622, 1504, 1441, 1351, 1249, 1149, 988, 803 cm-1; HRMS (ESI) calcd. for [C28H34O17+Na]+: 665.1688; obsd.: 665.1715. 6,6'-Di-O-(2,4-dihydroxybenzoyl)-α,α'-D-trehalose (9e). Benzyl protected trehalose 8e (58.3 mg, 0.038 mmol) and Pd(OH)2/C (35 mg) were subjected to the conditions described in the general procedure for debenzylation. The resulting residue was purified by gradient silica gel flash column chromatography (petroleum ether:EtOAc-EtOAc:MeOH, 4:1-4:1, v/v) to give the title compound as an off-white solid (21.8 mg, 0.035 mmol, 92%). Rf = 0.47 (MeOH:EtOAc, 1:4,


48

Page 49 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


v/v); [α]20D = +32.8 (c = 0.25, pyridine); 1H NMR (500 MHz, CD3OD) δ 7.73 (d, J6',5' = 7.3 Hz, 2H, H-6'), 6.34 (d, J5',6' = 8.2 Hz, 2H, H-5'), 6.29 (s, 2H, H-3'), 5.12 (d, J1,2 = 3.3 Hz, 2H, H-1), 4.55 (bd, J6a,6b = 11.7 Hz, 2H, H-6a), 4.46 (dd, J6a,6b = 11.6 Hz, J5,6b = 4.5 Hz, 2H, H-6b), 4.164.22 (m, 2H, H-5), 3.83 (t, J3,2 = J3,4 = 9.0 Hz, 2H, H-3), 3.53 (dd, J2,3 = 9.5 Hz, J2,1 = 3.1 Hz, 2H, H-2), 3.44 (t, J4,3 = J4,5 = 9.4 Hz, 2H, H-4); 13C NMR (125 MHz, CD3OD) δ 171.1 (C-7), 166.4 (C-4'), 164.9 (C-2'), 132.8 (C-6'), 109.5 (C-5'), 105.2 (C-1'), 103.6 (C-3'), 95.5 (C-1), 74.6 (C-3), 73.1 (C-2), 71.8 (C-4), 71.5 (C-5), 64.6 (C-6); IR (film): 3232, 2926, 1657, 1622, 1454, 1393, 1340, 1259, 1147, 1094, 1075, 1043, 1018, 977, 772 cm-1; HRMS (ESI) calcd for [C26H40O17+NH4]+: 632.1821; obsd.: 632.1822. 6,6'-Di-O-(4-octadecyloxybenzoyl)-α,α'-D-trehalose (9f). Benzyl protected trehalose 8f (122 mg, 0.075 mmol) and Pd(OH)2/C (73 mg) were subjected to the conditions described in the general procedure for debenzylation. The resulting residue was purified by silica gel flash column chromatography (petroleum ether:EtOAc-EtOAc:MeOH, 1:1-4:1, v/v) to give the title compound as an amorphous off-white solid (42 mg, 0.038 mmol, 51%). Rf = 0.31 (EtOAc) [α]20.0D = +67.8 (c = 0.1, pyridine); 1H NMR (500 MHz, C5D5N) δ 8.29 (d, J2',3' = 8.6 Hz, 4H, H2'), 6.96 (d, J3',2' = 8.9 Hz, 4H, H-3'), 5.98 (d, J1,2 = 3.7 Hz, 2H, H-1), 5.27-5.31 (m, 2H, H-5), 5.21 (d, J6a,5 = 11.4 Hz, 2H, H-6a), 5.06-5.09 (m, 2H, H-6b), 4.83 (t, J3,2 = J3,4 = 9.2 Hz, 2H, H3), 4.40 (dd, J2,3 = 9.6 Hz, J2,1 = 3.6 Hz, 2H, H-2), 4.29 (t, J4,3 = J4,5 = 9.2 Hz, 2H, H-4), 3.91 (t, J8,9 = 6.6 Hz, 4H, CH2-8), 1.73 (p, J9,10 = 6.8 Hz, 4H, CH2-9), 1.39-1.45 (m, 4H, CH2-10), 1.251.34 (m, 56H, CH2-11-CH2-24), 0.88 (t, J25,24 = 6.8 Hz, 6H, CH3-25);

13

C NMR (125 MHz,

C5D5N) δ 166.9 (C-7), 163.6 (C-4'), 132.4 (C-2'), 124.2 (C-1') 114.9 (C-3'), 95.8 (C-1), 74.9 (C3), 73.2 (C-2), 71.9 (C-4), 71.5 (C-5), 68.2 (C-8), 64.7 (C-6), 32.5, 30.4, 30.4, 30.34, 30.33, 30.28, 30.27, 30.23, 30.0, 29.97, 23.3 (C-11-C-24), 29.74 (C-9), 26.6 (C-10), 14.6 (C-25); IR


49


Page 50 of 66

(film): 3428, 2917, 2850, 1710, 1686, 1607, 1511, 1469, 1254, 1168, 1100, 1077, 1052, 1036, 1021, 769 cm-1; HRMS (ESI) calcd. For [C62H102O15+Na]+: 1109.7111; obsd.: 1109.7139. 6,6'-Di-O-(4-heptyloxybenzoyl)-α,α'-D-trehalose (9g). Benzyl protected trehalose 8g (87 mg, 0.066 mmol) and Pd(OH)2/C (59 mg) were subjected to the conditions described in the general procedure for debenzylation. The resulting residue was purified by gradient silica gel flash column chromatography (petroleum ether:EtOAc–EtOAc:MeOH; 1:1-4:1, v/v) to give the title compound as an amorphous white solid (37 mg, 0.048 mmol, 73%). Rf = 0.58 (EtOAc:MeOH, 4:1, v/v); [α]20.0D = +62.0 (c = 0.1, pyridine); 1H NMR (500 MHz, C5D5N) δ 8.28 (d, J2',3' = 8.8 Hz, 4H, H-2'), 6.95 (d, J3',2' = 8.9 Hz, 4H, H-3'), 5.98 (d, J1,2 = 3.8 Hz, 2H, H-1), 5.29 (ddd, J5,4 = 10.0 Hz, J5,6a = 5.4 Hz, J5,6b = 1.7 Hz, 2H, H-5), 5.19 (dd, J6b,6a = 11.7 Hz, J6b,5 = 2.0 Hz, 2H, H6b), 5.05 (dd, J6a,6b = 11.8 Hz, J6a,5 = 5.7 Hz, 2H, H-6a), 4.83 (t, J3,2 = J3,4 = 9.3 Hz, 2H, H-3), 4.40 (dd, J2,3 = 9.7 Hz, J2,1 = 3.7 Hz, 2H, H-2), 4.29 (t, J4,3 = J4,5 = 9.4 Hz, 2H, H-4), 3.89 (t, J8,9 = 6.8 Hz, 4H, CH2-8), 1.69 (p, J9,8 = J9,10 = 8.0 Hz, 4H, CH2-9), 1.36 (p, J10,9 = J10,11 = 7.6 Hz, 4H, CH2-10), 1.28 -1.18 (m, 12H, CH2-11-CH2-13), 0.85 (t, J14,13 = 6.9 Hz, 6H, CH3-14); 13C NMR (125 MHz, C5D5N) δ 166.9 (C-7), 163.6 (C-4'), 132.4 (C-2'), 123.5 (C-1'), 114.8 (C-3'), 96.3 (C1), 75.4 (C-3), 73.8 (C-2), 72.5 (C-4), 72.0 (C-5), 68.7 (C-8), 65.3 (C-6), 32.3, 29.5, 23.1 (C-11C-13) 29.6 (C-9), 26.5 (C-10), 14.6 (C-14); IR (film): 3327, 2918, 2850, 1714, 1606, 1585, 1467, 1360, 1254, 1149, 1080, 1042, 985, 770 cm-1; HRMS (ESI) calcd. for [C40H58O15+NH4]+: 796.4119; obsd.: 796.4134. 6,6'-Di-O-(4-heptyloxy-2-hydroxy-6-methylbenzoyl)-α,α'-D-trehalose

(9h).

Benzyl

protected trehalose 9h (133 mg, 0.071 mmol) and Pd(OH)2/C (80 mg) were subjected to the conditions described in the general procedure for debenzylation. The resulting residue was purified by silica gel flash column chromatography (petroleum ether:EtOAc-EtOAc:MeOH, 1:1-


50

Page 51 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


9:1, v/v) to give the title compound as a white solid (56 mg, 0.049 mmol, 69%). Rf = 0.15 (EtOAc); [α]20.8D = +39 (c = 0.5, pyridine); 1H NMR (500 MHz, C5D5N) δ 12.25 (s, 2H, OH) 6.67 (d, J3',5' = 2.4 Hz, 2H, H-3'), 6.46 (d, J5',3' = 2.2 Hz, 2H, H-5'), 5.93 (d, J1,2 = 3.7 Hz, 2H, H1), 5.24 (ddd, J5,4 = 9.6 Hz , J5,6a = 5.2 Hz , J5,6b = 1.9 Hz, 2H, H-5), 5.16 (dd, J6b,6a = 11.8 Hz, J6b,5 = 2.0 Hz, 2H, H-6b), 4.98 (dd, J6a,6b = 11.7 Hz, J6a,5 = 5.5 Hz, 2H, H-6a), 4.81 (t, J3,2 = J3,4 = 9.2 Hz, 2H, H-3), 4.33 (dd, J2,3 = 9.6 Hz, J2,1 = 3.6 Hz, 2H, H-2), 4.18 (t, J4,3 = J4,5 = 9.5 Hz, 2H, H-4), 3.95 (t, J8,9 = 6.5 Hz, 4H, CH2-8), 2.76 (s, 6H, 6-Me), 1.74 (p, J9,8 = J9,10 = 7.2 Hz, 4H, CH2-9), 1.39-1.45 (m, 4H, CH2-10), 1.24-1.34 (m, 56H, CH2-11-CH2-24), 0.88 (t, J25,24 = 7.2 Hz, 6H, CH3-25); 13C NMR (125 MHz, C5D5N) δ 172.3 (C-7), 166.0 (C-4'), 164.2 (C-2'), 144.0 (C6'), 111.8 (C-5'), 106.8 (C-1'), 100.4 (C-3'), 96.4 (C-1), 75.1 (C-3), 73.7 (C-2), 72.7 (C-4), 71.6 (C-5), 68.6 (C-8), 66.4 (C-6), 32.5, 30.36, 30.35, 30.33, 30.28, 30.26, 30.23, 30.0, 23.3 (C-11-C24), 29.7 (C-9), 26.6 (C-10), 24.9 (6-Me), 14.7 (C-25); IR (film): 3390, 2916, 2849, 1626, 1613, 1573, 1468, 1296, 1103, 985, 795, 695, 602 cm-1; HRMS (ESI) calcd. For [C64H106O17+H]+: 1147.7503; obsd.: 1147.7497. Brartemicin (9i). Benzyl protected trehalose 8i (86 mg, 0.056 mmol) and Pd(OH)2/C (50 mg) were subjected to the conditions described in the general procedure for debenzylation. The resulting residue was purified by gradient silica gel flash

column chromatography

(EtOAc:MeOH,:AcOH, 9:1:0.1-17:3:0.1, v/v/v) and lipophilic sephadex (CH2Cl2:MeOH, 1:1, v/v) to give 9i as an amorphous pale yellow solid (32 mg, 0.050 mmol, 89%). Rf = 0.66 (MeOH:EtOAc, 1:4, v/v); [α]20D = +67 (c = 0.1, MeOH); 1H NMR (500 MHz, CD3OD) δ 6.21 (s, 2H, H-5'), 6.15 (s, 2H, H-3'), 5.13 (d, J1,2 = 3.5 Hz, 2H, H-1), 4.58 (d, J6a,6b = 11.7 Hz, 2H, H-6a), 4.46 (dd, J6a,6b = 12.0 Hz, J6b,5 = 4.8 Hz, 2H, H-6b), 4.18-4.22 (m, 2H, H-5), 3.84 (t, J3,2 = J3,4 = 9.2 Hz, 2H, H-3), 3.50 (dd, J2,3 = 9.6 Hz, J2,1 = 3.6 Hz, 2H, H-2), 3.44 (t, J4,3 = J4,5 = 9.3 Hz, 2H,


51


Page 52 of 66

H-4), 2.51 (s, CH3, 6-Me); 13C NMR (125 MHz, CD3OD) δ 172.8 (C-7), 166.3 (C-2'), 163.9 (C4'), 144.9 (C-6'), 112.5 (C-5'), 105.6 (C-1'), 101.7 (C-3'), 95.6 (C-1), 74.5 (C-3), 73.1 (C-2), 72.2 (C-4), 71.3 (C-5), 65.4 (C-6), 24.9 (6-Me); IR (film): 3363, 2935, 1619, 1504, 1376, 1261, 1205, 1155, 1100, 1076, 1046, 994,798, 696 cm-1; HRMS (ESI) calcd for [C28H34O17+H]+: 643.1869; obsd.: 643.1866. Biological methods Mice. C57BL/6 wild-type, Mincle-/- and OT-II mice were bred and housed in a conventional animal facility at the Malaghan Institute of Medical Research, New Zealand, or Kyushu University, Japan. All mice used for experiments were aged between 8-12 weeks and experimental procedures were approved by the Victoria University Animal Ethics Committee or the committee of Ethics on Animal Experiments, Faculty of Medical Sciences, Kyushu University. Endotoxin testing. All synthesised glycolipids were confirmed to be endotoxin free at a sensitivity of ≤ 0.1 EU/mL by using the Pierce Limulus amebocyte lysate (LAL) chromogenic Endotoxin Quantitation kit (Thermo Scientific). Preparation of ligand-coated plates. Brartemicin analogues 9a-9i, TDM (Carbosynth, Sigma Aldrich), and TDB16 were dissolved in CHCl3:MeOH (2:1, 1 mM), diluted in isopropanol (0.05 mM) and added to 96-well plates (20 µL/well). The solvents were evaporated and the coated plates were used immediately. In vitro Mincle binding assay. The preparation of mMincle- and hMincle-Ig fusion proteins have been previously described.8 Plate-coated glycolipids 9a-i, TDB, and TDM were incubated with hMincle-Ig, mMincle-Ig, or hIgG1-Fc (Ig) [3 µg/mL in binding buffer (20 mM Tris-HCl,


52

Page 53 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


150 mM NaCl, 1 mM CaCl2, 2 mM MgCl2, pH 7.0)]. Detection of bound protein was achieved via incubation with anti-hIgG-HRP followed by the addition of a colorimetric substrate and measurement of OD at 450 nm. Background was accounted for by subtracting the hIgG1-Fc OD450 values from fusion protein OD450 values. 2B4-NFAT-GFP reporter cells. 2B4-NFAT-GFP reporter cells expressing mMincle + FcRγ, hMincle + FcRγ, or FcRγ only have been previously described.8 NFAT-GFP 2B4 reporter cells were incubated with ligand-coated plates (0.01, 0.1, or 1 nmol/well) for 18 hours. The reporter cells were harvested, stained with propidium iodide, and analysed for NFAT-GFP expression using flow cytometry (FACS Calibur). Murine bone-marrow derived macrophages. For the preparation of murine bone-marrow derived macrophages, bone marrow cells were collected from the tibias and femurs of C57BL/6 mice and cultured (250,000 cells/mL) in complete RPMI media [RPMI-1640 (Gibco) with 10% heat inactivated fetal bovine serum (Gibco), 100 unit/mL penicillin-streptomycin (Gibco) and 2 mM Glutamax (Gibco)] supplemented with 50 ng/mL GM-CSF (clone X63/GM-CSF murine cells). Cells were incubated at 37 °C (5% CO2) for 8 days (cells fed by replacing half the media on days 3 and 6). On day 8, all media was removed and the cells were washed with Dulbecco’s Phosphate-Buffered Saline (DPBS, Gibco) to remove any loosely-adherent cells. The BMDMs were harvested with StemPro Acutase (1 mL/well, 15 minutes at room temperature, Gibco) and seeded onto a pre-coated 96-well plate. The supernatant was collected and analysed for cytokine/chemokine production after 24 hours. Cytokine analysis. IL-1β, IFN-γ, IL-6, TNF-α (BD Biosciences), IL-17, and MIP-2 (R&D) levels were determined via sandwhich ELISA according to the manufacturer’s instructions.


53


Page 54 of 66

Site-directed mutagenesis. Site-directed mutagenesis was performed using a QuikChangeTM Site-Directed Mutagenesis Kit, codon-modified primers and the template plasmid, pMX-IREShCD8-hMincle.

The

primer

sets

GGACTGTGCCACCATGGCAGACTCTTCAAACCCAA -3'

used

were and

5’5’-

TTGGGTTTGAAGAGTCTGCCATGGTGGCACAGTCC - 3' for amino acid mutations at position 183. PCR amplification was performed with PfuTurbo DNA polymerase for 18 cycles of 30 s at 95 °C, 1 min at 55 °C and 7 min at 68 °C. The successful introduction of this mutation was corroborated by DNA sequencing. The mutated genes were transfected into phoenix cells using Polyethylenimine (Polysciences), and then introduced into FcRγ-only expressing NFATGFP 2B4 cells using retrovirus-mediated infection. Antibodies. Mincle expression was analysed by flow cytometry (FACS Calibur) using antihuman Mincle antibody [(13D10-H11),31 Biotin-labelling kit (DOJINDO)] and SA-PE (BioLegend). BMDC-OT-II T-cell co-coluture. A mixture of OT-II cells (1 × 105 cells/100 µL) and BMDCs (1 × 104 cells/100 µL) were stimulated with plate coated glycolipd (0.1 nmol/well) or iPrOH only (20 µL/well) and increasing concentrations of OVA (0, 0.1, or 1 µM). After 48 or 72 hours, the supernatant was collected and ELISA was employed to determine the levels of IFN-γ and IL17. Computational procedures. Molecular docking simulations were carried out using the UCSF DOCK6 suite of programs.34 Molecular graphics and analyses were performed using the UCSF Chimera package. Chimera is developed by the Resource for Biocomputing, Visualization, and Informatics at the University of California, San Francisco (supported by NIGMS P41-


54

Page 55 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


GM103311).33 The crystal structure of hMincle (PDB code: 3WH2) was used as a starting model. Delayed-type hypersensitivity. Mice were sensitised by subcutaneous injection with oil-inwater emulsions (mineral oil/Tween-80/PBS, 9:1:90, v/v/v) containing OVA only (200µg), OVA + TDB (OVA = 200 µg, TDB = 0.3 µmol), OVA + 9a (OVA = 200 µg, 9a = 0.3 µmol) or no OVA. After seven days, the mice were challenged with OVA (100 µg/footpad) and after a further seven days, the mice were sacrificed and their spleens harvested. For in vitro restimulation, splenocytes were restimulated with OVA and analysed for spenocyte number (measured at 450 nm after 3 hours, Cell Count Reagent SF, Nacalai Tesque Inc.), IFN-γ production, and IL-17 production. Footpad swelling was measured using a venier caliper prechallenge, 24 hours post-challenge, and 48 hours post-challenge. Sera were collected from each mouse on days 0, 7, and 14 and analysed for OVA-specific antibody titers by ELISA using HRP coupled goat anti-mouse IgG (GE Health-care),

IgG1, IgG2b,

IgG2c, and

IgG3

(SouthernBiotec). EC50 were defined by plotting the absorbance at 450 nm against log of serum concentration. Antibody titration curves were plotted using GraphPad Prism7 (GraphPad Software). Statistics. Two-way ANOVA was used for all statistical analyses (Prism7).


55


Page 56 of 66

ASSOCIATED CONTENT Supporting Information. Supplementary Figures 1 and 2, copies of 1H-and 13C-NMR spectra of all compounds, qNMR data for C18dMeBra (9a), and molecular formula strings for all compounds. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected]. Phone: +64 4 463 6481. *E-mail: [email protected]. Phone: +64 4 463 6529. *E-mail: [email protected]. Phone: +81 6 6879 8306. The authors declare no competing financial interest. Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.

ACKNOWLEDGMENT The Royal Society of New Zealand, Marsden Fund (VUW1401) for financial assistance; The Health Research Council NZ (Hercus Fellowship, BLS, 2013/33).

ABBREVIATIONS


56

Page 57 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


APC, antigen presenting cell; BMDM, bone marrow derived macrophages; DC, dendritic cell; DDA, dimethyldioctadecylammonium bromide; DMAP, 4-(dimethylamino)pyridine; EDCI, 1ethyl-3-(3-dimethylaminopropyl)carbodiimide; ELISA, enzyme-linked immunosorbent assay; EPN, Glu-Pro-Asn; IFN, interferon; GFP, green fluorescent protein; IL, interleukin; Mincle, Macrophage inducible C-type lectin; NFAT, nuclear factor of activated T cells; PAMP, pathogen associated molecular pattern; PRR, pattern recognition receptor; SPR, surface plasmon resonance; TBAI, tetrabutylammonium iodide; TCR, T cell receptor; TDB, trehalose dibehenate; TDM, trehalose dimycolate; TLR, Toll-like receptor; WT, wildtype.


57


Page 58 of 66

REFERENCES 1.

Plotkin, S. A. Correlates of protection induced by vaccination. Clin. Vaccine Immunol. 2010, 17, 1055-1065.

2.

Seder, R. A.; Hill, A. V. S. Vaccines against intracellular infections requiring cellular immunity. Nature 2000, 406, 793-798.

3.

Reed, S. G.; Orr, M. T.; Fox, C. B. Key roles of adjuvants in modern vaccines. Nat. Med. 2013, 19, 1597-1608.

4.

Coffman, R. L; Sher, A.; Seder, R. A. Vaccine adjuvants: Putting innate immunity to work. Immunity 2010, 33, 492-503.

5.

Titball, R. W. Vaccines against intracellular bacterial pathogens. Drug Discov. Today 2008, 13, 596-600.

6.

Kobayashi, H.; Horner, A. A.; Takabayashi, K.; Nguyen, M.-D.; Huang, E.; Cinman, N.; Raz, E. Immunostimulatory DNA pre-priming: a novel approach for prolonged Th1-biased immunity. Cell Immunol. 1999, 198, 69-75.

7.

Matsumoto, M.; Tanaka, T.; Kaisho, T.; Sanjo, H.; Copeland, N. G.; Gilbert, D. J.; Jenkins, N. A.; Akira, S. A novel LPS-inducible C-type lectin is a transcriptional target of NF-IL6 in macrophages. J. Immunol. 1999, 163, 5039-5048.

8.

Yamasaki, S.; Ishikawa, E.; Sakuma, M.; Hara, H.; Ogata, K.; Saito, T. Mincle is an ITAMcoupled activating receptor that senses damaged cells. Nat. Immunol. 2008, 9, 1179-1188.


58

Page 59 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


9.

For recent reviews on the potential of Mincle agonists as vaccine adjuvants, see: a) Matsunaga, I.; Moody, D. B. Mincle is a long sought receptor for mycobacterial cord factor. J. Exp. Med. 2009, 206, 2865-2868; b) Miyake, Y.; Ishikawa, E.; Ishikawa, T.; Yamasaki, S. Self and nonself recognition through C-type lectin receptor, Mincle. Self Nonself 2010, 1, 310-313; c) Richardson, M. B.; Williams, S. J. MCL and Mincle: C-type lectin receptors that sense damaged self and pathogen-associated molecular patters. Front. Immunol. 2014, 5, 19.

10. Yamasaki, S.; Matsumoto, M.; Takeuchi, O.; Matsuzawa, T.; Ishikawa, E.; Sakuma, M.; Tateno, H.; Uno, J.; Hirabayashi, J.; Mikami, Y.; Takeda, K.; Akira, S.; Saito, T. C-type lectin Mincle is an activating receptor for pathogenic fungus Malassezia. Proc. Natl. Acad. Sci. USA 2009, 106, 1897-1902. 11. Ishikawa, E.; Ishikawa, T.; Morita, Y. S.; Toyonaga, K.; Yamada, H.; Takeuchi, O.; Kinoshita, T.; Akira, S.; Yoshikai, Y.; Yamasaki, S. Direct recognition of the mycobacterial glycolipid trehalose dimycolate by C-type lectin Mincle. J. Expt. Med. 2009, 206, 28792888. 12. Werninghaus, K.; Babiak, A.; Groß, O.; Hölscher, C.; Dietrich, H.; Agger, E. M.; Mages, J.; Mocsai, A.; Schoenen, H.; Finger, K.; Nimmerjahn, F.; Brown, G. D.; Kirschning, C.; Heit, A.; Andersen, P.; Wagner, H.; Ruland, J.; Lang, R. Adjuvanticity of a synthetic cord factor analogue for subunit Mycobacterium tuberculosis vaccination requires FcRγ-Syk-CARD9dependent innate immune activation. J. Exp. Med. 2009, 206, 89-97. 13. Schoenen, H.; Bodendorfer, B.; Hitchens, K.; Manzanero, S.; Werninghaus, K.; Nimmerjahn, F.; Agger, E. M.; Stenger, S.; Andersen, P.; Ruland, J.; Brown, G. D.; Wells,


59


Page 60 of 66

C.; Lang, R. Cutting Edge: Mincle is essential for recognition and adjuvanticity of the mycobacterial cord factor and its synthetic analog trehalose-dibehenate. J. Immunol. 2010, 184, 2756-2760. 14. Kodar, K.; Harper, J. L.; McConnell, M. J.; Timmer, M. S. M.; Stocker, B. L. The Mincle ligand trehalose dibehenate differentially modulates M1-like and M2-like macrophage phenotype and function via Syk signaling. Immun. Inflamm. Dis. 2017, 5, 503-514. 15. Nagata, M.; Omahdi, Z.; Yamasaki, S.; Pathogen-sensing by Mincle: Function and molecular aspects. In C-Type Lectin Receptors in Immunity; Yamasaki, S., Ed.; Springer Japan: Tokyo, 2016; pp 15-34. 16. Khan, A. A.; Chee, S. H.; McLaughlin, R. J.; Harper, J. L.; Kamena, F.; Timmer, M. S. M.; Stocker, B. L. Long-chain lipids are required for the innate immune recognition of trehalose diesters by macrophages. ChemBioChem 2011, 12, 2572-2576. 17. Stocker, B. L.; Khan, A. A.; Chee, S. H.; Kamena, F.; Timmer, M. S. M. On one leg: trehalose monoesters activate macrophages in a Mincle-dependent manner. ChemBioChem 2014, 15, 382-388. 18. Kodar, K.; Eising, S.; Khan, A. A.; Steiger, S.; Harper, J. L.; Timmer, M. S. M.; Stocker, B. L. The uptake of trehalose glycolipids by macrophages is independent of Mincle. ChemBioChem 2015, 16, 683-693. 19. Decout, A.; Silva-Gomes, S.; Drocourt, D.; Barbe, S.; André, I.; Cueto, F. J.; Lioux, T.; Sancho, D.; Pérouzel, E.; Vercellone, A.; Prandi, J.; Gilleron, M.; Tiraby, G.; Nigou, J.


60

Page 61 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Rational design of adjuvants targeting the C-type lectin Mincle. Proc. Nat. Acad. Sci. USA 2017, 114, 2675-2680. 20. Richardson, M. B.; Torigoe, S.; Yamasaki, S.; Williams, S. J. Mycobacterium tuberculosis β-gentiobiosyl diacylglycerides signal through the pattern recognition receptor Mincle: total synthesis and structure activity relationships. Chem. Commun. 2015, 51, 15027-15030. 21. Van der Peet, P.L.; Nagata, M.; Shah, S.; White, J. M.; Yamasaki, S.; Williams, S. J. Lipid structure influences the ability of glucose monocorynomycolate to signal through Mincle. Org. Biomol. Chem. 2016, 14, 9267-9277. 22. Desel, C.; Werninghaus, K.; Ritter, M.; Jozefowski, K.; Wenzel, J.; Russkamp, N.; Schleicher, U.; Christensen, D.; Wirtz, S.; Kirschning, C.; Agger, E. M.; Prazeres da Costa, C.; Lang, R. The Mincle-activating adjuvant TDB induces MyD88-dependent Th1 and Th17 responses through IL-1R signaling. PLoS ONE 2013, 8, e53531. 23. Fomsgaard, A.; Karlsson, I.; Gram, G.; Schou, C.; Tang, S.; Bang, P.; Kromann, I.; Andersen, P.; Andreasen, L. V. Development and preclinical safety evaluation of a new therapeutic HIV-1 vaccine based on 18 T-cell minimal epitope peptides applying a novel cationic adjuvant CAF01 Vaccine 2011, 29, 7067-7074. 24. Gram, G. J.; Karlsson, I.; Agger, E. M.; Andersen, P.; Fomsgaard, A. A novel liposomebased adjuvant CAF01 for induction of CD8(+) cytotoxic T-lymphocytes (CTL) to HIV-1 minimal CTL peptides in HLA-A*0201 transgenic mice. PloS ONE 2009, 4, e6950. 25. Ottenhoff, T. H.; Doherty, T. M.; van Dissel, J.T.; Bang, P.; Lingnau, K.; Kromann, I.; Andersen, P. First in humans: a new molecularly defined vaccine shows excellent safety and


61


Page 62 of 66

strong induction of long-lived Mycobacterium tuberculosis-specific Th1-cell like responses. Hum. Vaccines 2010, 6, 1007-1015. 26. Kaufmann, S. H.; Hussey, G.; Lambert, P.-H. New vaccines for tuberculosis. Lancet 2010, 375, 2110-2119. 27. a) Patin, E. C.; Orr, S. J.; Schaible, U. E. Macrophage inducible C-type lectin as a multifunctional player in immunity. Front. Immunol. 2017, 8, 861; b) Foster, A. J.; Bird, J. H.; Timmer, M. S. M.; Stocker, B. L. The Ligands of C-Type Lectins. In C-Type Lectin Receptors in Immunity; Yamasaki, S., Ed.; Springer Japan: Tokyo, 2016; pp 191-215. 28. Tima, H. G.; Al Dulayymi, J. R.; Denis, O.; Lehebel, P.; Baols, K. S.; Mohammed, M. O.; L'Homme, L.; Sahb, M. M.; Potemberg, G.; Legrand, S.; Lang, R.; Beyaert, R.; Piette, J.; Baird, M. S.; Huygen, K.; Romano, M. Inflammatory properties and adjuvant potential of synthetic glycolipids homologous to mycolate esters of the cell wall of Mycobacterium tuberculosis. J. Innate Immun. 2017, 9, 162-180. 29. Jacobsen, K. M.; Keiding, U. B.; Clement, L. L.; Schaffert, E. S.; Rambaruth, N. D.; Johannsen, M.; Drickamer, K.; Poulsen, T. B. The natural product brartemicin is a high affinity ligand for the carbohydrate-recognition domain of the macrophage receptor Mincle. MedChemComm 2015, 6, 647-652. 30. Feinberg, H.; Rambaruth, N. D.; Jégouzo, S. A.; Jacobsen, K. M.; Djurhuus, R.; Poulsen, T. B.; Weis, W. I.; Taylor, M. E.; Drickamer, K. Binding sites for acylated trehalose analogs of glycolipid ligands on an extended carbohydrate recognition domain of the macrophage receptor Mincle. J. Biol. Chem. 2016, 291, 21222-21233.


62

Page 63 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


31. Furukawa, A.; Kamishikiryo, J.; Mori, D.; Toyonaga, K.; Okabe, Y.; Toji, A.; Kanda, R.; Miyake, Y.; Ose, T.; Yamasaki, S. Structural analysis for glycolipid recognition by the Ctype lectins Mincle and MCL. Proc. Natl. Acad. Sci. USA 2013, 110, 17438-17443. 32. Feinberg, H.; Jégouzo, S. A.; Rowntree, T. J.; Guan, Y.; Brash, M. A.; Taylor, M. E.; Weis, W. I.; Drickamer, K. Mechanism for recognition of an unusual mycobacterial glycolipid by the macrophage receptor Mincle. J. Biol. Chem. 2013, 288, 28457-28465. 33. Pettersen, E. F.; Goddard, T. D.; Huang, C. C.; Couch, G. S.; Greenblatt, D. M.; Meng, E. C.; Ferrin, T. E. UCSF Chimera - A visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605-1612. 34. UCSF DOCK6 software is readily available from: http://dock.compbio.ucsf.edu/ 35. Van Dissel, J. T.; Joosten, S. A.; Hoff, S. T.; Soonawala, D.; Prins, C.; Hokey, D. A.; O’Dee, D. M.; Graves, A.; Thierry-Carstensen, B.; Andreasen, L. V.; Ruhwald, M.; de Visser, A. W.; Agger, E. M.; Ottenhoff, T. H. M.; Kromann, I.; Andersen, P.; A novel liposomal adjuvant system, CAF01, promotes long-lived Mycobacterium tuberculosisspecific T-cell responses in human. Vaccine 2014, 32, 7098-7107. 36. Lee, S.; Nguyen, M. T. Recent advances of vaccine adjuvants for infectious diseases. Immune Netw. 2015, 15, 51-57. 37. Garçon, N.; Chomez, P.; Van Mechelen, M.; GlaxoSmithKline Adjuvant Systems in vaccines: concepts, achievements and perspectives. Expert Rev. Vaccines 2007, 5, 723-739.


63


Page 64 of 66

38. Bergmann-Leitner, E. S.; Leitner, W. W. Adjuvants in the driver's seat: how magnitude, type, fine specificity and longevity of immune responses are driven by distinct classes of immune potentiators. Vaccines 2014, 2, 252-296. 39. Kumar, P.; Chen, K.; Kolls, J. K. Th17 cell based vaccines in mucosal immunity. Curr. Opin. Immunol. 2013, 25, 373-380. 40. Schroder, K.; Hertzog, P. J.; Ravasi, T.; Hume, D. A. Interferon-gamma: an overview of signals mechanisms and functions. J. Leukoc. Biol. 2004, 75, 163-189. 41. Christensen, D.; Korsholm, K. S.; Andersen, P.; Agger, E. M.; Cationic liposomes as vaccine adjuvants. Expert Rev. Vaccines 2011, 10, 513-521. 42. Lindenstrøm, T.; Agger, E. M.; Korsholm, K. S.; Darrah, P. A.; Aagaard, C.; Seder, R. A.; Rosenkrands, I.; Andersen, P. Tuberculosis subunit vaccination provides long-term protective immunity characterized by multifunctional CD4 memory T cells. J. Immunol. 2009, 182, 8047-8055. 43. Lindenstrøm, T.; Woodworth, J.; Dietrich, J.; Aagaard, C.; Andersen, P.; Agger, E. M. Vaccine-induced th17 cells are maintained long-term postvaccination as a distinct and phenotypically stable memory subset. Infect. Immun. 2012, 80, 3533-3544. 44. Snapper, C.M.; Mond, J. J. Towards a comprehensive view of immunoglobulin class switching. Immunol. Today 1993, 14, 15-17. 45. Mosmann, T. R.; Coffman, R. L. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Ann. Rev. Immunol. 1989, 7, 145-173.


64

Page 65 of 66 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


46. Di Pasquale, A.; Preiss, S.; Tavares Da Silva, F.; Garçon, N. Vaccine adjuvants: from 1920 to 2015 and beyond. Vaccines 2015, 3, 320-343. 47. Carta, F.; Vullo, D.; Maresca, A.; Scozzafava, A.; Supuran, C. T. Mono-/dihydroxybenzoic acid esters and phenol pyridinium derivatives as inhibitors of the mammalian carbonic anhydrase isoforms I, II, VII, IX, XII and XIV. Bioorg. Med. Chem. 2013, 21, 1564-1569. 48. Baird, L. J.; Timmer, M. S. M.; Teesdale-Spittle, P. H.; Harvey, J. E. Total synthesis of aigialomycin D using a Ramberg-Bäcklund/RCM strategy. J. Org. Chem. 2009, 74, 22712277.


65


Page 66 of 66

Table of Contents graphic


66

Lipidated Brartemicin Analogues Are Potent Th1-Stimulating Vaccine

Recommend Documents