Metallo-Cubosomes: Zinc-Functionalized Cubic Nanoparticles for

Subscriber access provided by Iowa State University | Library

Article

Metallo-Cubosomes: Zinc-Functionalized Cubic Nanoparticles for Therapeutic Nucleotide Delivery Behnoosh Tajik-Ahmadabad, Lucas Chollet, Jacinta White, Frances Separovic, and Anastasios Polyzos Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.8b00890 • Publication Date (Web): 16 Jan 2019 Downloaded from http://pubs.acs.org on January 20, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

Metallo-Cubosomes: Zinc-Functionalized Cubic Nanoparticles for Therapeutic Nucleotide Delivery Behnoosh Tajik-Ahmadabada,b, Lucas Cholletb, Jacinta Whitea, Frances Separovica* and Anastasios Polyzosa,b* a

School of Chemistry, Bio21 Institute, University of Melbourne, Melbourne VIC 3010, Australia

b

CSIRO Manufacturing, Bayview Avenue, Clayton, VIC 3168, Australia

KEYWORDS cubosomes; nanoparticles; siRNA delivery; self-assembly

ABSTRACT: Development of an effective and potent RNA delivery system remains a challenge for the clinical application of RNA therapeutics. Herein, we describe the development of an RNA delivery platform derived from self-assembled bicontinuous cubic lyotropic liquid crystalline phases, functionalised with zinc co-ordinated lipids. These metallo-cubosomes were prepared from a series of novel lipidic zinc(II)-bis(dipicolylamine) (Zn2BDPA)) complexes admixed with glycerol monooleate (GMO). The zinc metallo-cubosomes showed the high affinity to siRNA through interaction between Zn2BDPA and the phosphate groups of RNA molecules. Using a combination of dynamic light scattering (DLS), small angle X-ray scattering (SAXS) and cryogenic transmission electron microscopy (cryo-TEM), we demonstrated that a variety of Zn2BDPA lipid derivatives can be loaded into GMO cubosomes and the introduction of Zn2BDPA lipids effected

ACS Paragon Plus Environment

1

Molecular Pharmaceutics 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 30

an internal cubic phase transition of the resulting metallo-cubosomes. The findings of this study lay the foundations for the development of a new class of non-cationic lipid-based encapsulation systems, metallo-cubosomes for RNA therapeutic delivery.

Introduction Nucleic acid therapy has emerged as a novel treatment for viral infections, genetic disorders and cancers1-2. The efficacious delivery of therapeutic nucleic acids to the target tissue, however, represents a major challenge. This mandates the development of sophisticated delivery vehicles, that simultaneously protect the encapsulated nucleic acids from degradation and provide controlled release. In recent years, interest in lipidic inverse biocontinuous cubic phase nanoparticles (QII), known as “cubosomes”, within the context of bioactive delivery, has increased significantly 3-6. Structurally, QII phases consist of a highly twisted single continuous lipid bilayer, curved into 3-D network of water-amphiphile water channels possessing an interfacial area of 400 m2g-1

6

. Three

experimentally observed cubic phases, the diamond cubic phase (QII D with space group Pn3m), the primitive cubic phase (QII P with space group Im3m) and the gyroid (QII G with space group Ia3d) are illustrated in Figure 1. The resulting phase is dependent on the critical packing parameter (CCP) of the amphiphiles in the bilayer, which is dependent on the local environment such as pressure, temperature and solution conditions including ionic strength, and pH7. The flexible cubic phase nanostructures, high surface area and relative structural stability allow for the engineering of highly specific bioactive carriers8-10. The tuneable structural parameters, dual polar-apolar


2

Page 3 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nature and ability to accommodate hydrophilic, hydrophobic and amphiphilic materials further enhance the candidacy of these materials as nucleic acid delivery agents11-12 .

Figure 1. The 3D schematic representations of the inverse bicontinous cubic phases: Q II G with space group Ia3d (left), QII D with space group Pn3m (centre), QII P , and with space group Im3m (right)13. Small interfering RNA (siRNA) has an effective gene silencing influence and has emerged as a therapeutical strategy for genetic disorders

14-15

. However, the delivery of oligonucleotides to

target cells remains a challenge as RNA molecules cannot cross cellular membranes to reach their site of action in the cytoplasm due to their overall anionic electrostatic charge

16-17

. The key to

address this problem is the development of delivery systems that actively promote cellular internalisation and endosomal escape of RNAs. A number of RNA delivery agents based on cationic lipids, polymers and peptides have been developed, amongst which polycations have shown the most promise18-20.

Polycations form complexes with negatively charged RNA

molecules through electrostatic interactions between the polycation amine groups and RNA phosphate groups. High relative concentrations of polycations are required to increase RNA stability as RNA loosely binds to cationic molecules owing to its low molecular weight and low


3


Page 4 of 30

density21. However, highly positive net charges of the complexes induce undesirable side effects including cellular toxicity which limits their therapeutic utility. An alternative approach relies on appropriately designed transitional metal complexes which can selectively associate with the phosphodiester groups on each nucleotide. Zinc(II)bis(dipicolylamine) (Zn2BDPA)) complexes (Figure 2) are reported to be highly selective for phosphate-containing biomolecules due to specific binding between the Zn(II) ions of coordinated Zn2BDPA complexes and the anionic phosphate groups22. Zn2BDPA has been utilised as fluorescent chemosensors for detecting phosphate containing molecules23-25 and also as probes for detecting apoptotic and necrotic cells which is applied through specific interactions between coordinated Zn (II) ions of DPA and the anionic phosphate groups of the RNA and phosphatidylserine on the surface of cells, respectively26-27. Recently, Zn2BDPA analogues have been used for delivery of siRNA to cells, exploiting their affinity for phosphodiester groups on the siRNA backbone

22,28-29

. Liu22 and Choi30 reported the high affinity of Zn2BDPA complexes

covalently conjugated to hyaluronic acid-based nanoparticles, for delivery of siRNA into the tumour cells. Although the Zn2BDPA complexed with NPs serves as ideal nanoparticle for delivery of phosphate-based molecules, they require conjugation of Zn2BDPA analogues to NPs which can be synthetically challenging. Herein, we describe the development of an oligonucleotide delivery system which utilizes Zn2BDPA containing lipids (Fig. 2) as a receptor to siRNA and GMO-based cubosomes. A series of Zn2BDPA lipid derivatives with different fatty acids were synthesized and these were formulated into GMO- based cubosomes and assessed for their potential as carriers for siRNA delivery.


4

Page 5 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Zn2+ N

N N

N

OH N

Zn2+ N

NH

R O

Figure 2. Schematic of lipidic Zn2BDPA co-ordination complexes used in this study. (R group in the figure represents fatty acids). Physicochemical studies were performed to determine the optimal relationship between the metallo-cubosomes and SiRNA loading capacity. This was achieved through the use of dynamic light scattering (DLS), small angle X-ray scattering (SAXS) and cryogenic transmission electron microscopy (cryo-TEM).

Experimental Materials 2,2’-dipicolylamine, tyramine, di-tert-butyldicarbonate, trifluoracetic acid, fatty acids and Pluronic F108 were purchased from Sigma Aldrich. Monoolein (GMO) was purchased from Nu-Check Prep (Elysian, USA). Synthesis of Zn2BDPA lipids derivatives The synthesis of BDPA lipid derivatives was achieved by the N,N′-carbonyldiimidazole (CDI) mediated acylation of the BDPA derivative (1) with a series of fatty acids (Fig. 3). The BDPA-lipids were obtained in moderate overall yields (See Supporting Information). The zinc


5


Page 6 of 30

complexes (Zn2BDPA) were furnished by the treatment of the acylated derivatives zinc nitrate hexahydrate in methanol24.

N N

N

N N

OH

N O

N N

NH2

R

Zn2+

N

N

OH

N

N N

N

OH

N

OH N

N

CDI, DMAP, CH2Cl2,18h, r.t.

NH

R O

Zn2+ N

Zn(NO3)2.6H2O MeOH, 18h, r.t.

NH

R O

1

Figure 3. Synthesis of Zn2BDPA lipid derivatives (The structure of the various fatty acids (R) is shown in Table 1).

Preparation of Zn2BDPA-functionalized cubic nanoparticles (NPs): metallo-cubosomes The Zn-BDPA metallo-cubosomes were prepared by co-solubilizing GMO in a 1.5 ml Eppendorf tube with a set amount of Zn-BDPA lipids. The mixtures were heated until they were homogenous and 500 µl of solution containing Pluronic F108 (10% w/w of GMO) in water was added prior to dispersion. Probe sonication was used to prepare the metallo-cubosomes by ultrasonicating the mixture for 4 minutes with amplitude set to 2 and using a 50% duty cycle (Branson ultrasonifier 250). The final concentration was 1-15 wt% Zn-BDPA of total lipid material. Dispersions were stored at 25°C for 48 h prior to further experimentation to enable equilibration of lipid, Pluronic F108 and water. Pendant-drop method To investigate the self-assembly behaviour of Zn-BDPA coordinated lipids in aqueous solutions, surface tension of Zn-BDPA solutions was measured at 25°C until stability was reached using a profile analysis tensiometer PAT-131-34. The solution drops were formed at the tip of a steel


6

Page 7 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


capillary and a CCD camera was used to record the droplet images. The drop profile coordinates were extracted and the surface tension was calculated by a best fit algorithm of the Gauss-Laplace equation to the experimental shape coordinates. Dynamic light scattering (DLS) measurements The particle diameter distribution and polydispersity of the dispersions were characterized using a Malvern Zeta-sizer (Malvern Instruments, Malvern, U.K). Prior to analysis, samples were diluted 10x with MilliQ water (10 µl:100 µl) and filtered to minimize the interference that occurs in highly turbid solutions. All measurements were performed three times and at room temperature. Small angle X-ray scattering (SAXS) SAXS measurements were recorded at 25°C on a Bruker MicroCalix SAXS/WAXS system, using 50 W Cu Kα radiation at a wavelength of 1.54 Å, and a Pilatus 100k 2D detector, with a q range of 0.004 to 0.56 A−1. Data reduction (calibration and integration) was performed using AXcess, a custom-written SAXS analysis program written by Dr Andrew Heron from Imperial College, London. TEM The EM grids were made using a Leica EM GP cryo-plunge freezing unit. The unit has a controllable temperature and humidity chamber. The 300 mesh copper grids coated with perforated carbon film (Lacey carbon film: ProSciTech, Townsville, Australia) were glow discharged in nitrogen to render the surface hydrophilic. 4 μl aliquots of the sample were pipetted onto each grid prior to plunging with the humidity chamber set to 96% and the temperature at 37°C. After 5 s adsorption time, the grid was blotted using Whatman 1 filter paper, a post-blot delay of 3 s was used and then the grid plunged into ethane cooled by liquid nitrogen. Frozen grids were stored in


7


Page 8 of 30

liquid nitrogen until viewed. A Gatan 626 cryoholder (Gatan, Pleasanton, USA) and Tecnai 12 Transmission Electron Microscope (FEI, Eindhoven, The Netherlands) was used to examine the samples at an operating voltage of 120 kV. Low dose procedures were followed at all times, using an electron dose of 8-10 electrons/Å2 for all imaging. Images were recorded at a range of magnifications using a FEI Eagle 4k  4k CCD camera. Synthetic siRNA oligonucleotides The anti-GFP siRNA was obtained from Qiagen (USA). The anti-GFP siRNA sequence is sense 5’-GCAAGCUGACCCUGAAGUUCAU

[dT][dT]-3’

and

antisense

5’-

GAACUUCAGGGUCAGCUUGCCG [dT][dT]-3’ and is referred to as si22. The human specific anti-Coatomer protein complex, subunit alpha (siCOPA) siRNA pool was purchased from Sigma Aldrich (USA). The four siRNA sequences are given below: 1: 5’-ACUCAGAUCUGGUGUAAUA[dT][dT]-3’ 2: 5’-GCAAUAUGCUACACUAUGU[dT][dT]-3’ 3: 5’-GAUCAGACCAUCCGAGUGU[dT][dT]-3’ 4: 5’- GAGUUGAUCCUCAGCAAUU[dT][dT]-3’ Preparation of Zn2BDPA/siRNA complexes The siRNA complexes with Zn2BDPA metallo-cubosomes were prepared with various charge ratios, zinc: phosphate (Z:P) ratios of cubosome to siRNA. The siRNA (1.2 µg/µL) in water was added to Zn2BDPA metallo-cubosomes (15wt% Zn-DPA), with the total lipid concentration adjusted to desired Z:P ratio. Solutions were immediately vortexed subsequent to the addition of


8

Page 9 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


siRNA to allow for homogenous mixing. Complexation was allowed to continue for 1 h at room temperature.

Agarose gel electrophoresis Samples at Z:P = 10 for metallo-cubosome relative to siRNA (50 pmol) were electrophoresed on a 2% agarose gel in Tris/Borate/EDTA buffer at 100 V for 40 min. siRNA was visualized by gel red (Jomar Bioscience) on a UV transilluminator with camera, the image was recorded by the GeneSnap program (Syngene, USA). Cell lines Chinese Hamster Ovary cells (CHO: ATCC CCL-061) were grown in MEMα modification, and human alveolar basal epithelial cells (A549; ATCC CCL-185) were grown in Dulbecco's Modified Eagle Medium. Both base media were supplemented with 10% fetal bovine serum, 2 mM glutamine, 10 mM Hepes, 1.5 g/L sodium bicarbonate, 0.01% penicillin and 0.01% streptomycin. Cells were grown at 37ºC with 5% CO2 and sub-cultured twice weekly. Gene silencing and cell viability assays The gene silencing and cell viability assays were conducted as previously reported35. CHO-GFP and A549 cells were seeded at 2  104 cells per well, respectively, in 96-well tissue culture plates and grown overnight at 37°C with 5% CO2. As a controls sample, various siRNAs were transfected into cells using Lipofectamine 2000 (Invitrogen, USA) as per manufacturer’s instructions. Briefly, the appropriate concentration of the relevant siRNA was mixed with 0.5 µl of Lipofectamine 2000 both diluted in 50 µl Opti-MEM (Invitrogen, USA) and incubated at room temperature for 20 min.


9


Page 10 of 30

The siRNA:lipofectamine mix (10 µl) was added to cells and incubated for 4 h. Cell media was replaced and incubated for 72 h. The metallo-cubosome/siRNA complexes were prepared cell media and added in a volume of 10 µl to 3 wells of cells per sample and incubated for 5 h. Cell media was replaced and cells incubated for a further 72 h. All experiments performed as biological replicates. Cell viability was measured using the Alamar Blue reagent (Invitrogen, USA) according to manufacturer’s instructions. Briefly, media was removed, cells were washed once with PBS and replaced with 100 µl of standard media containing 10% Alamar Blue reagent; cells were then incubated for 4 h at 37ºC with 5% CO2. The assay was read on an EL808 Absorbance microplate reader (BioTek, USA) at 540 nm (background correction at 620 nm). Obtained data were analyzed in Microsoft Excel. Results are presented as a percentage of untreated cells and the presented data are representative of three separate experiments in triplicate ± SEM36.

GFP and COPA silencing Following incubation with siRNA metallo-cubosome complexes, CHO-GFP cells were washed twice with PBS, and read on a Fluoroskan Ascent FL (Thermo Scientific, USA) and enhanced green fluorescent protein (EGFP) silencing was analysed as a percentage of the siCOPA metallocubosome treated cells mean EGFP (excitation 488 nm, emission 516 nm) fluorescence. A549 cells were washed twice with PBS, and human specific COPA toxicity was measured using the Alamar Blue reagent (Invitrogen, USA) as above with results presented as a percentage of si22 metallo-cubosome treated cells and the presented data are representative of three separate experiments in triplicate ± SEM37.


10

Page 11 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Results and Discussion Characterization studies of the Zn2BDPA metallo-cubosomes The metallo-cubosomes designed for siRNA delivery were composed of three major components (Fig. 4): (i) GMO (the cubic phase scaffold), (ii) Zn2BDPA lipids, and (iii) the triblock copolymer stabilising agent, pluronic F108. Following synthesis of the Zn2BDPA lipids, compounds numbers L1, L4, L6 and L8 (Table 1), were formulated into GMO to afford the corresponding metallocubosomes for further study.

Figure 4. A schematic (from left to right) which represents the Zn2BDPA lipid, the internal cubic structure of metallo-cubosome (Im3m space group), and a cryo-TEM image demonstrating representative cubic phase. Self-assembly behaviour of Zn2BDPA lipids The aggregation behaviour of the Zn2BDPA lipids in aqueous solution was determined by surface tensiometry. The critical aggregation concentration (CAC) was determined by surface tension measurements using a drop profile analysis tensiometer38. The equilibrium surface tension as a function of synthesised Zn2BDPA lipid concentrations is shown in Figure 5. The surface tension


11


Page 12 of 30

decreased from that of pure water with increasing concentration of Zn2BDPA functionalised lipid and remained constant between 35-45 mN/m (Table 1) and is indicative of aggregate formation.

Figure 5. The surface tension isotherms of Zn2BDPA co-ordinated lipids in water as a function of Zn2BDPA lipid concentration. Each data point represents the average of triplicate measurements and the standard deviation was less than size of the symbol. (N represents the identifying number of the Zn2BDPA lipid, L1-L10). A comparison of the Zn2BDPA lipid structure (Table 1) reveals that the presence of acyl chain branching (L7) drastically lowered the surface tension of water to approximately 43 mN/m at the concentration of 0.4 mM due to favoured hydrophobic interactions (Fig. 5). The addition of a double bound, Z (L2) or E (L3), has no effect of the CAC which was roughly 0.75 mM for L1, L2, L3 and L5 which had 17 carbons chain length. The CAC increased as the length of the lipid tail decreased. This indicates that the self-assembly behaviour of the Zn-BDPA analogues was


12

Page 13 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


dominated by the hydrophobic effect, as the CAC decreased with increase in the size of the tail and addition of the branch.

Table 1. The estimated critical aggregation concentration (CAC) of the Zn2BDPA lipids. Compound Zn2BDPA derivative (R)

CAC (mM)

# (N) (Lipid)

1 (L1)

0.72

2 (L2)

0.66

3 (L3)

0.76

4 (L4)

2.24

5 (L5)

0.87

6 (L6)

1.26

7 (L7)

0.37

8 (L8)

2.40

9 (L9)

10.07

10 (L10)

11.71

Structural studies of Zn2BDPA metallo-cubosomes Following assessment of self-assembly behaviour of Zn2BDPA lipids, four of the Zn2BDPA lipids (L1, L4, L6 and L8), with the length of acyl chain range from 13-17 carbon units and the CAC values less than 2.5 mM, were encapsulated into cubosomes. The effect of Zn2BDPA lipid


13


Page 14 of 30

incorporation (encapsulated within cubosomes) on the internal architecture of the cubosomes was studied by changing the concentration of the Zn2BDPA lipids (0-7.5%). The maximum Zn2BDPA lipid loading was defined as the maximum lipid concentration for which the internal cubic phase structure was retained. Dynamic light scattering was used to obtain the size and polydispersity of the nanoparticles followed by SAXS and cryo-TEM to evaluate the internal structure and lyotropic liquid crystalline phase of the dispersions. The incorporation and increased concentration of Zn2BDPA lipids effected a reduction in the optical density with an optical transition from a milky appearance, typical of cubosomes 39, to a more translucent appearance, typical of non-cubic or lamellar particles (Fig. 6A). The average size of GMO cubosomes without Zn2BDPA was typically 257 nm and polydispersity of 0.26. DLS analysis of the obtained dispersions revealed that incorporation of the Zn2BDPA lipids did not significantly change the size of the particles up to 2.5 wt% lipid content, and as the concentration of the lipids increased, the size of the nanoparticles decreased, except for L8 where the size did not change for the entire concentration range (Fig. 6). For all four Zn2BDPA lipids, the polydispersity increased up to 5wt% Zn2BDPA lipid incorporation. By inserting into the GMO bilayer, the Zn2BDPA lipids reduce the negative curvature of the GMO bilayer, which at high concentration of Zn2BDPA lipids, resulted in the formation of non-cubic structures as indicated by the translucent appearance of the samples. The change in the bilayer curvature is likely due to the change of the critical packing parameter (CPP) of the amphiphile bilayer40-41. Based on the CPP, the preferred curvature for vesicle and lamellar phase is between 0.5 and 1, while the inverse cubic, hexagonal and micellar cubic phases have CPP > 1. Therefore, the large headgroup of Zn2BDPA lipids effect a decrease in the CPP of the GMO bilayer from > 1 to between 0.5 and 1.


14

Page 15 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Influence of Zn2BDPA lipids on GMO-based dispersions. (A) Visual observation of GMO-based dispersions with increasing concentration of Zn2BDPA lipids. As the concentration of Zn2BDPA increased, the dispersions became more translucent and then almost transparent when the concentration was > 7.5 wt%. This image is for L1 encapsulated into GMO and the same trend was observed for all Zn2BDPA lipids incorporated into GMO. (B-E) DLS results for GMO dispersions containing increasing concentration of lipids L1, L4, L6 and L8 respectively. Histograms and points demonstrate size and PDI, respectively. To determine the effect of Zn2BDPA lipid encapsulation on the internal architecture of cubosomes, SAXS experiments were carried out for L1, L4, L6 and L8 encapsulated into GMO. Synchrotron SAXS pattern (Fig. 7) indicate that GMO based cubosomes exhibit QIID (Pn3m) symmetry, with a lattice parameter of 96.62 Å in the absence of Zn2BDPA lipids. The addition of Zn2BDPA lipids resulted in the transition of the internal structure of metallo-cubosomes from QIID to QIIP (Im3m)


15


Page 16 of 30

with relative ratios of √2, √4, √6 and an increase in lattice parameter. From 1 to 2.5 wt% Zn-BDPA lipid content, the metallo-cubosomes adopt QIIP symmetry, transitioning to coexisting QIIP and QIID at 5wt%. The appearance of Im3m phase as a result of Zn2BDPA lipid incorporation into GMO, signifies an enlargement and rearrangement of the cubic structure and associated water uptake. A similar inter-cubic phase transition from QIID to QIIP has been observed in the phytantriol-water system with the addition of an ionic lipid, dipalmitoylphosphatidylserine (DPPS)31. Increasing the Zn2BDPA lipid content further to 7.5wt%, results in the loss of Bragg peaks in SAXS pattern, which suggests further phase transition and reduction in cubic phase content.

The increase in lattice parameter by addition of Zn2BDPA lipids indicated an enlargement of the cubic phase, which is required to accommodate the bulky Zn2BDPA moiety. The positively charged Zn2BDPA contributes to an increase in the effective size of the lipid headgroup and confers a reduction in the bilayer negative curvature as swelling of the cubic phase nanostructure 40

. Also, the Bragg peaks move to the left (Fig. 7) as the concentration of Zn2BDPA lipids

increased, which is attributed to the swelling and slight hydration of the cubic phase nanostructure and, hence, a shift towards a lower CPP.

The behaviour of GMO cubosomes following

incorporation of Zn-lipids was similar for all the studied Zn2BDPA lipids (Fig. S1).


16

Page 17 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. Synchrotron SAXS scatterplot of GMO-based dispersions with increasing concentrations of Zn-DPA lipids: (A) L6, (B) 2D SAXS patter of L6 and (B) L4 encapsulated into GMO cubosomes. Top right: magnification of GMO-1.5/1wt% L6, and GMO dispersions displaying primitive and diamond phase peaks, respectively. Blue and red dots correspond to QII D (Pn3m) (with √2, √3, √4, √6, √8 and √9 Bragg reflections) and QIIP (Im3m) (with √2, √4, √6, √6 and √8 Bragg reflections) symmetry, respectively.


17


Page 18 of 30

The synchrotron SAXS data confirms that the change observed in Figure 7, is a result of the disruption of the cubic phase when the Zn2BDPA lipid content was above 7.5 wt%. Also, cubic phase nanostructural transitions from Pn3m to Im3m and eventual cubic phase disappearance was observed which depended on the Zn2BDPA content of the Zn2BDPA /GMO metallo-cubosomes. To directly visualise the internal nanostructure of the metallo-cubosomes, we used TEM to distinguish non-ordered structures such as vesicles, which are not readily detected by SAXS measurements. The L4 was selected based on SAXS results and the L4-GMO nanoparticles were submitted to Cryo-TEM imaging to obtain information on the structural characteristics of cubosomes formulated with Zn 2BDPA lipid. In samples of GMO without Zn2BDPA lipid (Fig. 8A), nanoparticles with an internal periodicity of electron density typical of cubic phase were observed. Images of dispersions containing 1.5 wt% Zn2BDPA (Fig. 8B) showed metallocubosomes with some nanostructure change which occurred as a result of lipid incorporation and appeared to possess a double bilayer coating (blue arrow). At 2.5 wt% Zn2BDPA, the TEM image showed metallo-cubosomes similar in appearance to those with 1.5 wt% lipid but with a noticeable increase in the swollen bilayer domain surrounding the metallo-cubosomes and which coexist with the great proportion of vesicle structures (yellow arrow). Hence the corresponding vesicular structures are ordered and SAXS scattering was not detected. At 7.5 wt% Zn2BDPA concentration (Fig. 8D) the greater proportion was vesicle structures, both uni- and multilamellar (red arrows), that coexist with metallo-cubosomes and the vesicle content was more pronounced.


18

Page 19 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. TEM images of aqueous dispersion systems containing: (A) pure GMO, (B) 1.5wt% Zn2BDPA (L4)/GMO/F108 showing cubosomes, (C) 2.5wt% Zn2BDPA (L4)/GMO/F108 with both cubosomes and vesicles (yellow arrow), and (D) 7.5wt% Zn2BDPA (L4)/GMO/F108 showing uni- and multilamellar vesicles (red arrows) in coexistence with a small amount of metallo-cubosomes. Although the dispersions containing 7.5wt% Zn2BDPA lipids did not exhibit Bragg peaks in the SAXS pattern, Cryo-TEM showed that these dispersions are biphasic in nature and experience both cubic and bilayer vesicle phase structures and dominated by the latter. The increased presence of vesicles at 7.5wt% Zn2BDPA indicates that the cubic structure is destabilized with increasing Zn2BDPA content and correlated with the decrease in the particle size and polydispersity measured by DLS (Fig. 6). Dispersions containing a mixture of vesicle and cubosomes have been previously observed in systems containing cubosomes incorporated with polar lipids42-44. Taken together the


19


Page 20 of 30

DLS, SAXS and Cryo-TEM data, show that addition of Zn2BDPA result in nanostructural changes within the cubic phase particle population, which correlate with an increase in the appearance of vesicles in the system. Biological studies The binding strength of siRNA with Zn2BDPA L1 and L4 with stearic and phytanyl tails, respectively, complexed with GMO at 2.5wt% and 15wt% Zn2BDPA, was evaluated using gel electrophoresis stained with a nucleic acid specific dye (Fig. 9). The Zn2BDPA lipids complexed with GMO were able to bind siRNA at both concentrations of Zn2BDPA lipids. The 2.5wt% Zn2BDPA lipid with the stearic fatty acid tail (L1) showed complete siRNA binding. Based on SAXS studies (Fig. 7), the complex formed metallo-cubosomes and showed increased binding of siRNA compared to the 15wt% Zn2BDPA /GMO particles which formed lamellar (non-cubic) structure. The cubic phase structure of Zn2BDPA /GMO metallo-cubosomes may facilitate Zn ion presentation for binding to phosphate groups of siRNA.


20

Page 21 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 9. Gel electrophoresis of siRNA/GMO complexes with 2.5wt% and 15wt% Zn2BDPA lipids L1 and L4. Zn2BDPA /GMO complexes with siRNA formed at Z/P ratio of 10. Given the observed binding between the Zn2BDPA /GMO complexes with siRNA, the viability of two different cell lines was evaluated using metallo-cubosomes derived from L1 and L4 formulated in GMO. The cytotoxicity of the formulations was compared to a commercially available cationic lipid-based transfection reagent Lipofectamine 2000 (L2000). Although the different formulations were more cytotoxic than L2000, both cell lines retained approximately 80% viability, which could be a result of toxicity from free Zn ions or GMO itself 45. Significant toxicity was not observed for the 2.5wt% L4/GMO complexes, which form cubosomes (Fig. 10).


21


Page 22 of 30

Figure 10. Cell viability results and gene silencing for CHO-GFP and A549 cells incubated with Zn2BDPA/GMO-siRNA complexes with the concentration of Zn2BDPA (L4) at 2.5wt% and 15wt%. Gene-silencing experiments were performed to evaluate the efficiency of Zn2BDPA /GMO metallo-cubosomes in silencing of the reporter gene for enhanced green fluorescent and A549 proteins. Compared to L2000, the Zn2BDPA analogues showed less gene silencing (Fig. 10) in both cell lines.


22

Page 23 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Summary and Conclusion In this study, we have developed a novel lipid derived oligonucleotide delivery system by utilizing an artificial RNA receptor, Zn2BDPA, and the cubic phase-forming lipid, GMO. We have demonstrated that our synthesized Zn2BDPA analogs can be successfully loaded into cubosomes and without significant perturbation of the internal cubic phase structure (up to 7.5wt% Zn2BDPA). Interestingly, physicochemical studies of the metallo-cubosome particles revealed that the addition of increased quantities of a Zn2BDPA lipid to the cubosome dispersions result in a transition from diamond to primitive cubic phase. The biological evaluation of the metallo-cubosomes suggested good binding affinity between siRNA and Zn-BDPA derived cubosomes. Studies are currently ongoing in our laboratory to identify novel Zn2BDPA lipids with high RNA binding affinity, low toxicity and high gene silencing activity.

ASSOCIATED CONTENT Supporting Information The following files are available free of charge (Supp Inform.PDF): Synthesis of DPA analogues and Zn2BDPA derivatives.

AUTHOR INFORMATION Corresponding Author


23


Page 24 of 30

*E-mail [email protected] Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.

ACKNOWLEDGMENTS B.T.-A. acknowledges award of a University of Melbourne-CSIRO PhD scholarship. The authors wish to thank the Centre for Molecular and Nanoscale Physics, School of Applied Sciences, RMIT University, particularly Matt Taylor and Reece Nixon-Luke for their assistance with SAXS experiments. We also acknowledge the Biological Electron Microscopy Facility at CSIRO Manufacturing.

REFERENCES 1.

Dykxhoorn, D. M.; Palliser, D.; Lieberman, The Silent Treatment: siRNAs as Small Molecule Drugs J. Gene Ther. 2006, 13, 541-552.

2.

Gallas, A.; Alexander, C.; Davies, M. C.; Puri, S.; Allen, S. Chemistry and Formulations for siRNA Therapeutics Chem. Soc. Rev. 2013, 42, 7983.

3.

Shah, J. C.; Sadhale, Y.; Chilukuri, D. M. Cubic Phase Gels as Drug Delivery Systems Adv. Drug Deliv. Rev. 2001, 47, 229-250.

4.

McLoughlin, D.; Impéror-Clerc, M.; Langevin, D. A New Cubic Phase Containing DNA and a Surfactant ChemPhyChem. 2004, 5, 1619-1623.


24

Page 25 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5.

Esposito, E.; Cortesi, R.; Drechsler, M.; Paccamiccio, L.; Mariani, P.; Contado, C.; Stellin, E.; Menegatti, E.; Bonina, F.; Puglia, C. Cubosome Dispersions as Delivery Systems for Percutaneous Administration of Indomethacin Pharm. Res. 2005, 22, 21632173.

6.

Fong, W.-K.; Hanley, T. L.; Thierry, B.; Kirby, N.; Waddington, L. J.; Boyd, B. J. Controlling the Nanostructure of Gold Nanorod-Lyotropic Liquid-Crystalline Hybrid Materials Using Near-Infrared Laser Irradiation Langmuir 2012, 28, 14450– 14460

7.

Lawrence, M. J. Surfactant Systems: Their use in Drug Delivery Chem. Soc. Rev. 1994, 23, 417-424.

8.

Zhiwen, Y.; Xinsheng, P.; Yinhe, T.; Meiwan, C.; Xingqi, Z.; Min, F.; Yuehong, X.; Chuanbin, W. Optimization of the Preparation Process for an Oral Phytantriol-Based Amphotericin B Cubosomes, J. Nanomater. 2011, 495.

9.

Guo, C.; Wang, J.; Cao, F.; Lee, R. J.; Zhai, G. Lyotropic Liquid Crystal Systems in Drug Delivery Drug Discov. Today. 2010, 15, 1032-1040.

10.

Nguyen, T.-H.; Hanley, T.; Porter, C. J. H.; Boyd, B. J. Nanostructured Liquid Crystalline Particles Provide Long Duration Sustained-Release Effect for a Poorly Water Soluble Drug after Oral Administration J. Control. Release. 2011, 153, 180-186.

11.

Kim, H.; Leal, C., Cuboplexes: Topologically Active siRNA Delivery ACS Nano 2015, 9, 10214-10226.

12.

Kim, H.; Sung, J.; Alfeche, A.; Leal, C. Microfluidics Synthesis of Gene Silencing Cubosomes ACS Nano 2018, 12, 9196–9205.


25


13.

Page 26 of 30

Meikle, T. G.; Zabara, A.; Waddington, L. J.; Separovic, F.; Drummond, C. J.; Conn, C. E., Incorporation of antimicrobial peptides in nanostructured lipid membrane mimetic bilayer cubosomes. Colloids and Surfaces B: Biointerfaces 2017, 152, 143-151.

14.

Elbashir, S. M.; Harborth, J.; Lendeckel, W.; Yalcin, A.; Weber, K.; Tuschl, T. Duplexes of 21-Nucleotide RNAs Mediate RNA Interference in Cultured Mammalian Cells Nature 2001, 411, 494-498.

15.

de Fougerolles, A.; Vornlocher, H.-P.; Maraganore, J.; Lieberman, J. Interfering with Disease: A Progress Report on siRNA-Based Therapeutics Nature Rev. Drug Discovery 2007, 6, 443-453.

16.

Tan, S. J.; Kiatwuthinon, P.; Roh, Y. H.; Kahn, J. S.; Luo, D. Engineering Nanocarriers for siRNA Delivery Small 2011, 7, 841-856.

17.

Whitehead, K. A.; Langer, R.; Anderson, D. G. Knocking Down Barriers: Advances in siRNA Delivery Nature Rev. Drug Discov. 2009, 129-138.

18.

Tajik-Ahmadabad, B.; Mechler, A.; Muir, B. W.; McLean, K.; Hinton, T. M.; Separovic, F.; Polyzos, A. A QCM-D and SAXS Study of the Interaction of Functionalised Lyotropic Liquid Crystalline Lipid Nanoparticles with siRNA ChemBioChem. 2017, 18, 921-930.

19.

Kumar, P.; Ban, H.-S.; Kim, S.-S.; Wu, H.; Pearson, T.; Greiner, D. L.; Laouar, A.; Yao, J.; Haridas, V.; Habiro, K.; Yang, Y.-G.; Jeong, J.-H.; Lee, K.-Y.; Kim, Y.-H.; Kim, S. W.; Peipp, M.; Fey, G. H.; Manjunath, N.; Shultz, L. D.; Lee, S.-K.; Shankar, P. T CellSpecific siRNA Delivery Suppresses HIV-1 Infection in Humanized Mice Cell 2008, 134, 577-586.


26

Page 27 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


20.

Endoh, T.; Ohtsuki, T. Cellular siRNA Delivery using Cell-Penetrating Peptides Modified for Endosomal Escape Adv. Drug Deliv. Rev. 2009, 61, 704-709.

21.

Tseng, Y.-C.; Mozumdar, S.; Huang, L. Lipid-Based Systemic Delivery of siRNA Adv. Drug Deliv. Rev. 2009, 61, 721-731.

22.

Liu, G.; Choi, K. Y.; Bhirde, A.; Swierczewska, M.; Yin, J.; Lee, S. W.; Park, J. H.; Hong, J. I.; Xie, J.; Niu, G.; Kiesewetter, D. O.; Lee, S.; Chen, X. Sticky Nanoparticles: A Platform for siRNA Delivery by a Bis(Zinc(II) Dipicolylamine)-Functionalized, SelfAssembled Nanoconjugate Angew. Chem. Int. Ed. 2012, 51, 445-449.

23.

Yingxin, M.; Hao, L.; Shan, P.; Leyu, W. Highly Selective and Sensitive Fluorescent Paper Sensor for Nitroaromatic Explosive Detection Anal. Chem. 2012, 84, 8415-8421.

24.

Rhee, H.; Lee, S.; Shin, I.; Choi, S.; Park, H.; Han, K.; Park, T. and Hong, J. Detection of Kinase Activity Using Versatile Fluorescence Quencher Probes. Angew. Chem. Int. Ed. 2010, 49, 4919-4923.

25.

Kwon, T. H.; Kim, H. J.; Hong, J. I. Phosphorescent Thymidine Triphosphate Sensor Based on a Donor–Acceptor Ensemble System using Intermolecular Energy Transfer, Chem. Eur. J. 2008, 14, 9613-9619.

26.

Kwong, J. M. K.; Hoang, C.; Dukes, R. T.; Yee, R. W.; Gray, B. D.; Pak, K. Y.; Caprioli, Bis(Zinc-Dipicolylamine), Zn-DPA, a New Marker for Apoptosis, J. Invest. Ophthalmol. Vis. Sci. 2014, 55, 4913-4921.

27.

Smith, B. A.; Akers, W. J.; Leevy, W. M.; Lampkins, A. J.; Xiao, S.; Wolter, W.; Suckow, M. A.; Achilefu, S.; Smith, B. D. Optical Imaging of Mammary and Prostate Tumors in Living Animals using a Synthetic Near Infrared Zinc(II)-Dipicolylamine Probe for Anionic Cell Surfaces J. Am. Chem. Soc. 2010, 132, 67-69.


27


28.

Page 28 of 30

Choi, K. Y.; Silvestre, O. F.; Huang, X.; Hida, N.; Liu, G.; Ho, D. N.; Lee, S.; Lee, S. W.; Hong, J. I.; Chen, X. A Nanoparticle Formula for Delivering siRNA or miRNAs to Tumor Cells in Cell Culture and In Vivo, Nature Protoc. 2014, 9, 1900-1915.

29.

Liu, S.; Jia†, H.; Yang, H.; Pan, J.; Liang, H.; Zeng, L.; Zhou, H.; Chen, J.; Guo, T. Zinc Coordination Substitute Amine: A Noncationic Platform for Efficient and Safe Gene Delivery, ACS Macro Lett., 2018, 7, 868–874

30.

Choi, K. Y.; Silvestre, O. F.; Huang, X.; Min, K. H.; Howard, G. P.; Hida, N.; Jin, A. J.; Carvajal, N.; Lee, S. W.; Hong, J.-I.; Chen, X. Versatile RNA Interference Nanoplatform for Systemic Delivery of RNAs ACS Nano, 2014, 8, 4559-4570.

31.

Shen, H.-H.; Crowston, J. G.; Huber, F.; Saubern, S.; McLean, K. M.; Hartley, P. G. The Influence of Dipalmitoyl Phosphatidylserine on Phase Behaviour of and Cellular Response to Lyotropic Liquid Crystalline Dispersions, Biomaterials, 2010, 31, 94739481.

32.

Conn, C. E.; Drummond, C. J. Nanostructured Bicontinuous Cubic Lipid Self-Assembly Materials as Matrices for Protein Encapsulation, Soft Matter, 2013, 9, 3449-3464.

33.

Phan, S.; Fong, W.-K.; Kirby, N.; Hanley, T.; Boyd, B. J. Evaluating the Link between Self-Assembled Mesophase Structure and Drug Release, Int. J. Pharm. 2011, 421, 176182.

34.

Gunde, R.; Kumar, A.; Lehnert-Batar, S.; Mäder, R.; Windhab, E. J. Measurement of the Surface and Interfacial Tension from Maximum Volume of a Pendant Drop, J. Colloid Interface Sci. 2001, 244, 113-122.

35.

Dearnley, M.; Reynolds, N. P.; Cass, P.; Wei, X.; Shi, S.; Mohammed, A. A; Le, T.; Gunatillake, P.; Tizard, M. L.; Thang, S. H.; Hinton, T. M. Comparing Gene Silencing and


28

Page 29 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Physiochemical Properties in siRNA Bound Cationic Star-Polymer Complexes, Biomacromolecules 2016 17, 3532-3546. 36

Bye, N.; Hutt, O. E.; Hinton, T. M.; Acharya, D. P.; Waddington, L. J.; Moffat, B. A.; Wright, D. K.; Wang, H. X.; Mulet, X.; Muir, B. W. Nitroxide-Loaded Hexosomes Provide MRI Contrast in Vivo, Langmuir 2014 30, 8898-8906.

37.

Hinton, T. M.; Guerrero-Sanchez, C.; Graham, J.; Le, T. P. T.; Muir, B. W.; Shi, S.; Tizard, M. L.; Gunatillake, P.; McLean, K.; Thang, S. H. The Effect of RAFT-Derived Cationic block Copolymer Structure on Gene Silencing Efficiency, Biomaterials, 2012, 33, 7631-7642.

38.

Tajik-Ahmadabad, B.; Polyzos, A.; Separovic, F.; Shabanpoor, F.; Amphiphilic Lipopeptide Significantly Enhances Uptake of Charge-Neutral Splice Switching Morpholino Ooligonucleotide in Spinal Muscular Atrophy Patient-Derived Fibroblasts, Int. J. Pharmaceutics, 2017, 532, 21-28.

39.

Barauskas, J.; Johnsson, M.; Joabsson, F.; Tiberg, F. Cubic Phase Nanoparticles (Cubosome): Principles for Controlling Size, Structure, and Stability, Langmuir, 2005, 21, 2569-2577.

40.

Israelachvili, J. N.; Mitchell, D. J.; Ninham, B. W. Theory of Self-Assembly of Hydrocarbon Amphiphiles into Micelles and Bilayers, J. Chem. Soc. Faraday Trans. 2, 1976, 72, 1525-1568.

41.

Hartnett, T. E.; Ladewig, K.; O’Connor, A. J.; PHartley, P. G.; McLean, K. M.; Size and Phase Control of Cubic Lyotropic Liquid Crystal Nanoparticles, The Journal of Physical Chemistry B 2014 118, 7430-7439.


29


42.

Page 30 of 30

Engblom, J.; Miezis, Y.; Nylander, T.; Razumas, V.; Larsson, K., On the Swelling of Monoolein Liquid-Crystalline Aqueous Phases in the Presence of Distearoylphosphatidylglycerol, Surf. Colloid. Sci. 2001, 9-15.

43.

Dong, Y.-D.; Larson, I.; Hanley, T.; Boyd, B. J. Bulk and Dispersed Aqueous Phase Behavior of Phytantriol: Effect of Vitamin E Acetate and F127 Polymer on Liquid Crystal Nanostructure, Langmuir, 2006, 22, 9512-9518.

44.

Gustafsson, J.; Nylander, T.; Almgren, M.; Ljusberg-Wahren, H. Phase Behavior and Aggregate Structure in Aqueous Mixtures of Sodium Cholate and Glycerol Monooleate, J. Colloid Interface Sci. 1999, 211, 326-335.

45.

Zhen, G.; Hinton, T. M.; Muir, B. W.; Shi, S.; Tizard, M.; McLean, K. M.; Hartley, P. G.; Gunatillake, P. Glycerol Monooleate-Based Nanocarriers for siRNA Delivery In Vitro, Mol. Pharm. 2012, 9, 2450-2457.

Table of Contents/Abstract Graphic


30

Metallo-Cubosomes: Zinc-Functionalized Cubic Nanoparticles for

Recommend Documents