Microfluidic Electrochemical Aptameric Assay Integrated On-Chip: A

Feb 3, 2011 - Also it is similar to a dosimeter which accumulates signal upon exposure. .... alarm. 'EXPERIMENTAL SECTION. Chemicals and Materials...
0 downloads 0 Views 2MB Size
Download PDF
ARTICLE pubs.acs.org/ac

Microfluidic Electrochemical Aptameric Assay Integrated On-Chip: A Potentially Convenient Sensing Platform for the Amplified and Multiplex Analysis of Small Molecules Yan Du,†,‡ Chaogui Chen,†,‡ Ming Zhou,†,‡ Shaojun Dong,*,† and Erkang Wang*,† †

State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun, Jilin 130022, P. R. China ‡ Graduate School of the Chinese Academy of Sciences, Beijing 100039, P. R. China

bS Supporting Information ABSTRACT: Aptamers are artificial oligonucleotides that have been widely employed to design biosensors (i.e., aptasensors). In this work, we report a microfluidic electrochemical aptamerbased sensor (MECAS) by constructing Au-Ag dual-metal array three-electrode on-chip for multiplex detection of small molecules. In combination with the microfluidic channels covering on the glass chip, different targets are transported to the Au electrodes integrated on different positions of the chip. These electrodes are premodified by different kinds of aptamers, respectively, to fabricate different sensing interfaces which can selectively capture the corresponding target. It is an address-dependent sensing platform; thus, with the use of only one electrochemical probe, multitargets can be recognized and detected according to the readout on a corresponding aptamer-modified electrode. In the sensing strategy, the electrochemical probe, [Ru(NH3)6]3þ (RuHex), which can quantitatively bind to surface-confined DNA via electrostatic interaction, was used to produce chronocoulometric signal; Au nanoparticles (AuNPs) were used to improve the sensitivity of the sensor by amplifying the detection signals. Moreover, the sensing interface fabrication, sample incubation, and electrochemical detection were all performed in microfluidic channels. By using this detection chip, we achieved the multianalysis of two model small molecules, ATP, and cocaine, in mixed samples within 40 min. The detection limit of ATP was 3  10-10 M, whereas the detection limit of cocaine was 7  10-8 M. This Au-Ag dual metal electrochemical chip detector integrated MECAS was simple, sensitive, and selective. Also it is similar to a dosimeter which accumulates signal upon exposure. It held promising potential for designing electrochemical devices with high throughput, high automation, and high integration in multianalysis.

A

s a kind of functional nucleic acid, aptamers are considered as potential alternatives of antibodies or other bioreceptors1-3 and have been widely employed to develop novel biosensors, displaying high potential in both basic research and real sample assays.4-6 Among all the measurement techniques employed in aptamer-based biosensors (aptasensors), great attention has been paid to electrochemistry,7-9 which offers some advantages, such as ultrahigh sensitivity and simplicity. Until now, electrochemical aptasensing platforms have been developed rapidly by combining with various amplification methods and aptamerbased signal tracing strategies.10-12 Even though, much more effort is still required before the electrochemical aptasensors are applied in real sample analysis. For example, the way to fabricate an effective and simple multianalysis system is still a concern. Until now, several multianalysisbased electrochemical aptasensors have been reported,13-15 and these sensors often depend on labeling different kinds of electrochemical probes to achieve the simultaneous detection of multiple substances. For example, the encode biomolecular identity by quantum dots (QDs) has been used for the first parallel detection of a variety of proteins by their aptamers.13 r 2011 American Chemical Society

Such a probe-labeled procedure usually needs relatively complex and expensive presynthesis, and the electrochemical probes available to label and trace different targets are also limited. Thus, designing single probe based label-free aptasensors with high sensitivity and selectivity is still a challenge for multianalysis. As we know, with the use of sputtering, lithography, and etching technologies, a metal electrode (such as Au, Pt, and Ag) can be accurately sculptured and integrated on-chip. Also after modification of the electrode on-chip by using biological molecules, the sensor detection devices with properties of biomolecular recognition are successfully prepared16 and applied for aptasensors.17-21 Furthermore, electrochemical microchips are developing rapidly with the properties of integration, highthroughput, and automation. Thus, by utilization of the integrated microfluidic chip, the multianalysis of analytes can be easily achieved by using only one kind of label-free electrochemical Received: July 28, 2010 Accepted: January 18, 2011 Published: February 03, 2011 1523

dx.doi.org/10.1021/ac101988n | Anal. Chem. 2011, 83, 1523–1529

Analytical Chemistry

ARTICLE

Scheme 1. Schematic Representation of the Sensing Procedure for Multianalysis of ATP and Cocaine Based on the MECAS Chipa

a

(A) Step 1: the fabrication of two kinds of sensing interfaces: the ATP sensing interface and the cocaine sensing interface. (B) Step 2: the sample inlet and incubation. These three solutions were mixed with the radio of 1:1:1 (v/v/v). (a) solution of AuNPs-A1; (b) solution of AuNPs-C1; (c) mixed samples of ATP and cocaine. (C) Step 3: the electrochemical detection process. This detection chamber can accommodate two groups of three-electrode systems. The photographs of the actual sensing procedures were also showed in Figure S4 in the Supporting Information.

probe, which is more simple, convenient, and economic compared with the labeled electrochemical probe. Herein, we construct a microfluidic electrochemical aptamerbased sensor (MECAS) by using Au-Ag dual-metal array threeelectrode systems on-chip to realize multiplex detection of small molecules. With the use of microfluidic channels covered on the glass chip, different targets are transported to the Au electrodes integrated on different positions of the chip. These electrodes are premodified by different kinds of aptamers, respectively, to fabricate different sensing interfaces which can only capture the corresponding targets. In the sensing strategy, chronocoulometry (CC) measurement is employed because CC is more accurate for detecting the signal of an electrostatically trapped redox marker than other electrochemical methods.22 Au nanoparticles (AuNPs) is used as the amplified element to improve the sensitivity of the electrochemical aptasensors23 due to their large surface area, favorable electronic properties, and good biocompatibility.24 The present sensing platform is changed from the classical probe-dependent system to an address-dependent one. With the use of only one electrochemical probe, multitargets can be probably recognized and detected according to the readout on the corresponding aptamer-modified electrode. Two commonly used small molecules, ATP and cocaine, are used as model targets for the MECAS-based multianalysis. ATP is a multifunctional nucleotide that is most important as a “molecular currency” of intracellular energy transfer. Cocaine is a powerfully addictive stimulant drug that increases the level of dopamine, a brain chemical associated with pleasure and movement. Both of them are important molecules in biological system, and also the cocaine detection is important in antidrug analysis. By combining the microfluidic technique and aptamer technique, we easily and conveniently demonstrate the multiplex detection of ATP and cocaine. Also it is well proven by analyzing several mixed samples of ATP and cocaine in comparison with the results of individual detection of ATP and cocaine. The sensing interfaces failed for

the application on real-time monitoring sensors, but the possibility for the application of such aptasensors as dosimeters has been suggested. Thus, it was tried to explore the responses for a cumulative fashion.25 Anyhow, this MECAS chip based sensing platform is simple and possesses many advantages. The designed MECAS chip holds promising potential for environmental monitoring, clinical diagnosis and therapy, and a biological safety alarm.

’ EXPERIMENTAL SECTION Chemicals and Materials. The ATP aptamer fragment (SHA1, 50 TTTTTTTTTTACCTGGGGGAGTAT 30 ) and the other ATP aptamer fragment (SH-A2, 50 TTTTTTGCGGAGGAAGGT 30 ) were adapted from Fan’s Group.26 The cocaine aptamer fragment (SH-C1, 50 TTTTTTTCGTTCTTCAATGAAGTGGGACGACA 30 ) and the other cocaine aptamer fragment (SH-C2, 5 0 HS-(CH 2 )6 -TTTTTGGGAGTCAAGAACGAA 30 ) were derived from the cocaine aptamer.27 Other chemicals and buffer used were prepared by using distilled water and stored at 4 °C and listed in the Supporting Information. Instrumentation. Chronocoulometry (CC) and cyclic voltammetry (CV) measurements were performed with a model CH Instrument 832B electrochemical workstation (Shanghai Chenhua Equipments, China) in 10 mM Tris-HCl buffer (containing 100 μM RuHex, 100 mM NaCl, pH = 7.4). SPR measurements were conducted by using a home-built electrochemical SPR system.28 Atomic force microscopy (AFM) was performed on a SPI3800N microscope instrument (Seiko Instruments, Inc., Japan). Preparation of MECAS Chip and Microchannels. The desired Au-Ag dual-metal chip array electrode was fabricated according to the previous literature with little modification by using photolithography.29 Four groups of three-electrode systems on the MECAS chip were designed (Figure S1 in the 1524

dx.doi.org/10.1021/ac101988n |Anal. Chem. 2011, 83, 1523–1529

Analytical Chemistry Supporting Information). Also each group of three-electrode systems consisted of two Au working electrodes (1.8 mm in diameter), which shared one Au counter electrode and one Ag reference electrode. For example, Group 1 has two Au working electrodes named 1A and 1C (Scheme 1), respectively. The PDMS based microfluidic channel frames were prepared using standard soft-lithography techniques in ITO glasses. The details are shown in the Supporting Information. Synthesis and Modification of AuNPs. AuNPs (13 nm) were synthesized according to the literature.30 AuNPs modified by SH-A1 (AuNPs-A1) and SH-C1 (AuNPs-C1) were prepared according to the literature31-33 with modification. The final AuNPs-A1 and AuNPs-C1 obtained were dispersed in 575 μL of double-deionized water and 300 μL of DNA-buffer (25 mM TrisHCl, 300 mM NaCl, 120 μM TCEP, pH = 8.2), respectively. Pretreatment of Au Working Electrode. Au working electrodes were cleaned by using the electrochemical technique in 0.1 M H2SO4 with a high scan rate of 0.5 V s-1 and potential scanning between -0.2 to 1.4 V until a reproducible cyclic voltammogram (CV) was obtained. Figure S2 in the Supporting Information showed the 200th cyclic scans of the eight electrodes on a piece of MECAS chip for checking the cleanness. The CVs showed a remarkable repeatability of the Au working electrode. Fabrication of the Different Sensing Interfaces. As shown in Scheme 1A, step 1, the MECAS chip was covered with PDMS frame 1 containing two specific microfluidic channels (∼75 μm depth, 2.2 mm width) named microchannel a and b, respectively, which separated the two working electrodes in the same group. Each microchannel only contained two working electrodes in different groups (for example, microchannel a contained electrodes 1A and 2A). Then, 20 μL of 2 μM SH-A2 solution was pumped into the microchannel a for immersing electrodes 1A and 2A, while 20 μL of 2 μM SH-C2 solution was pumped into microchannel b for immersing electrodes 1C and 2C. The assembly was kept at room temperature for 16 h and rinsed with W-Buffer 1 (10 mM Tris-HAc, pH = 7.4) thoroughly, after which 10 μL of MCH was pumped into each microchannel and kept at room temperature for 1 h, followed by rinsing with W-Buffer 1. After that, the PDMS frame 1 was removed and the chip was dried in a nitrogen stream. Then, an MECAS chip with two different sensing interfaces was obtained. The two electrodes with different sensing interfaces were in the same group. Electrochemical Multiplex Detection of ATP and Cocaine. The MECAS chip with different sensing interfaces was covered with PDMS frame 2 containing two specific microfluidic channels (∼75 μm depth, 2.2 mm width) named microchannel c and d (Scheme 1B, step 2). However, the direction of the two microchannels was perpendicular to that of the microchannels in step 1, which could inlet the same sample to the two working electrodes in the same group (such as electrodes 1A and 1C). Also then 20 μL samples containing AuNPs-A1, AuNPs-C1, and different concentrations of ATP and cocaine were pumped into each microchannel simultaneously and incubated for 40 min. After a thorough rinse with W-Buffer 2 (20 mM Tris-HCl, 100 mM NaCl, 5 mM KCl, 5 mM MgCl2, 1% Tween-20, pH 7.4), the electrochemical measurements were carried out in PDMS frame 3 (Scheme 1C, step 3) containing a detection chamber (∼200 μm depth) named microchannel e. The detection chamber can accommodate two groups of the three-electrode systems. The overall sensing procedures based on the MECAS chip were shown in Scheme 1: step 1, the fabrication of the different sensing interfaces; step 2, different testing samples inlet and

ARTICLE

Figure 1. The angle-resolved SPR curves recorded on the SPR instrument during the different steps (A) for ATP detection, bare Au substrate (a), SH-A2 (b), blocking-MCH, and (c) 1 μM ATP and AuNPs-A1 and (B) for cocaine detection, bare Au substrate (a), SH-C2 (b), blockingMCH, and (c) 3 μM cocaine and AuNPs-C1.

incubation; step 3, the electrochemical detection process. All the three steps were processed in different microfluidic channels to achieve the address-dependent multianalysis. According to the sensing strategies in Scheme S1 in the Supporting Information, cocaine and ATP can be separately recognized at the same time.

’ RESULTS AND DISCUSSION Characterization of the Sensing Interfaces and Detection of ATP or Cocaine. SPR was used to validate the fabrication of

the sensing interface and the detection of ATP (or cocaine). Figure 1 showed the angle-resolved SPR curves for the modification of the Au substrate. Upon the modification of Au film by SHA2 (Figure 1A) or SH-C2 (Figure 1B), the SPR angle was rightshifted in comparison with the bare Au substrate. Also, upon the subsequent MCH regularization, the SPR angle was slightly right-shifted. By incubation of the modified Au substrate with ATP containing AuNPs-A1 (or cocaine containing AuNPs-C1) solution, the SH-A2 (or SH-C2) layer can partly hybridize with AuNPs-A1 (or AuNPs-C1) with the aid of ATP (or cocaine). A big change of SPR signal indicated that the detection of ATP or cocaine was successful. AFM was further performed to characterize the fabrication of the sensing interfaces. Figure S5A in the Supporting Information exhibited the image of the bare Au substrate. After SH-A2 was immobilized on the Au substrate and interacted with ATP and the subsequent AuNPs-A1, a significant change of the surface morphology, caused by AuNPs, was shown in Figure S5B in the Supporting Information. Similarly, the same phenomenon also occurred with cocaine detection (Figure S5C in the Supporting Information). All the 1525

dx.doi.org/10.1021/ac101988n |Anal. Chem. 2011, 83, 1523–1529

Analytical Chemistry results indicated that the sensing strategies for ATP and cocaine were rational.According to the previous literature,34 the surface density of SH-A1 was estimated about 4.3  1012 molecules/cm2 and that of SH-C1 was about 5  1012 molecules/cm2 (Figure S6 in the Supporting Information). Amplified Function of AuNPs. Li et al. reported an AuNPs amplified aptasensor for the chronocoulometric detection of ATP that was based on the structure switching of the duplex DNA triggered by ATP.35 However, the decreased response of RuHex as a result of the detection of ATP was certainly a disadvantage. Accordingly, we tried to make a strategy here by using two subunits of ATP-binding aptamers engineered by the Fan group.26 The two aptamer fragments (here, SH-A1 and SHA2) could reassemble into the intact aptamer tertiary structure in the presence of ATP. It was a “signal-on” strategy that a higher concentration of ATP resulted in the quantity increasing of RuHex attached on the electrode surface. SH-A1 grafted AuNPs could bring an excess mass of SH-A1 strands to electrode surface upon the detection of ATP. Therefore, the amount of RuHex absorbed on the DNAs would be increased, exhibiting a larger response. Importantly, the AuNPs may drastically accelerate electron transfer of the probe, showing amplified response of RuHex. The same principle was applied to the detection of cocaine by using its corresponding two aptamer fragments. Compared with the simply A1 sensing system (Figure S7A in the Supporting Information), the CC signal of RuHex was increased remarkably by using the AuNPs-A1 sensing system, exhibiting the amplification effect. In addition, the increased charges (ΔQ = Q - Q0) for the AuNPs-A1 sensing system (1.71  10-7 C) and for the A1 sensing system (0.33  10-7 C) indicated ∼5-fold increase of signal response. Similarly, the consistent results were obtained for cocaine detection (Figure S7B in the Supporting Information). It was believed that the introduction of AuNPs evidently improved the sensitivity of this electrochemical aptasensor. Multiplex Detection of ATP and Cocaine Using MECAS Chip. For the multiplex detection of ATP and cocaine (Scheme S1 in the Supporting Information), a series of mixed samples of ATP and cocaine (also containing AuNPs-A1 and AuNPs-C1) were pumped into the PDMS microchannels c and d (shown in Scheme 1B, step 2), and the as-prepared different sensing interfaces in the same group were incubated for 40 min. The CC measurements were carried out in the PDMS frame 3 containing the detection chamber (Scheme 1C, step 3). When ATP existed in the mixed samples, a significant CC signal increase was observed for the ATP sensing interface (the upper electrode, 1A). It proved that when ATP existed, the two strands SH-A2 and AuNPs-A1 would partly hybridize together to form a folio heterodimer which increased the amount of DNA on the electrode and resulted in the increased electrochemical signals (Scheme S1A in the Supporting Information). Similarly, when cocaine existed, a significant CC signal increase was obtained (Scheme S1B in the Supporting Information) for the cocaine sensing interface (the lower electrode, 1C). Four samples of the mixed ATP and cocaine solution were used for examining the multianalysis capability of this MECAS chip. The results were shown in Figure 2. For sample I, AuNPs-A1 and AuNPs-C1 existed without ATP and cocaine and the sensing interfaces hardly showed any change of CC signals. However, for sample II, AuNPs-A1, AuNPs-C1, and cocaine existed without ATP and only the sensing interface of cocaine showed a large CC signal change. Sample III, AuNPs-A1, AuNPs-C1, and ATP existed

ARTICLE

Figure 2. The CC signal changes corresponding to the simultaneous detection of the two small molecules ATP and cocaine using the MECAS chip: (I) no ATP, no cocaine; (II) no ATP, 0.4 μM cocaine; (III) 5 nM ATP, no cocaine; (IV) 15 nM ATP, 1.4 μM cocaine. The error bars represent the standard deviations of four measurements from three different electrodes.

without cocaine and would lead to the increase of CC signal of the ATP sensing interface. Importantly, the sample IV, containing AuNPs-A1 and AuNPs-C1 with both ATP and cocaine, resulted in remarkably increased CC signals at both the ATP sensing interface and the cocaine sensing interface. It indicated that the designed MECAS chip could realize the simultaneous determination of two small molecules. Sensitivity, Selectivity, Reusability, and Stability of the Detection Platform. The quantitative analysis of ATP or cocaine was performed without interference from each other. The prepared Au/SH-A2/MCH sensing interface was treated with a different amount of ATP in the presence of AuNPs-A1. The SH-A2/ATP/AuNPs-A1 complex was formed on the ATP sensing interface, which led to the increase of CC signals in different degrees. As shown in Figure 3A, the increased CC signals were directly related to the concentration of ATP. The increased charge (Q-Q0) was used to evaluate the CC response to ATP (Figure 3B). There was a linear relationship between Q-Q0 and logarithmic ATP concentration from 0.5 to 1066 nM (R2 = 0.9984). Also, the detection limit of ATP is 0.3 nM by using the signal (S) to noise ratio (N) S/N = 3. Additionally, for the quantitative analysis of cocaine, the quantity of DNA on the electrode increased with cocaine concentration and the CC responses of the sensing interface were enhanced as the concentration of the cocaine was elevated (Figure 4A). As shown in Figure 4B, there is a linear relationship between Q-Q0 and the logarithmic cocaine concentration from 0.1 to 26.3 μM (R2 = 0.9987); a detection limit as low as 0.07 μM was obtained by using S/N = 3, which can be compared favorably with most existing electrochemical aptasensors for cocaine detection.21,36,37 Also, the comparison of electrochemical aptasensors for ATP and cocaine by various methods was shown in Table S1 in the Supporting Information. It should be noticed that this MECAS measured cumulative signals of targets. We injected samples sequentially onto sensing interfaces that already had sample on them and the signal was the increment over the previous. Also, the calibration curves are generated by the sensing interface, which was treated with different amounts of ATP from the lowest to the highest concentration. However, because of the remarkable repeatability of the Au working electrode on-chip, the sensing interfaces still showed the repeatability. Thus, it did not matter to use different electrodes on-chip to do the calibration curves. 1526

dx.doi.org/10.1021/ac101988n |Anal. Chem. 2011, 83, 1523–1529

Analytical Chemistry

Figure 3. (A) The CC response of the ATP sensing interface for different concentrations of ATP. CC responses to ATP, (a) the ATP sensing interface, (b) 0 M, (c) 0.5 nM, (d) 1 nM, (e) 6 nM, (f) 30 nM, (g) 80 nM, (h) 330 nM, (i) 1.08 μM, and (j) 1.58 μM. The detections were carried out on a specific electrode. (B) The relative response of the ATP sensing interface to different concentrations of ATP (from 0.5 nM to 1.58 μM). Inset: a linear range from 0.5 nM to 1.08 μM. The error bars represent the standard deviations of three measurements from three different electrodes.

It was well-known that the ATP, ADP, AMP, and adenosine shared the same aptamer.38 Thus, we can only consider the selectivity if there were no ADP, AMP, or adenosine in the sample. However, ATP, CTP, UTP, and GTP belong to the nucleoside family and were used for control experiments to test the selectivity of the ATP sensing platform (Figure 5). After 40 min of incubation in the mixed solution (8.3 μM CTP, 8.3 μM UTP, and 8.3 μM GTP), the ATP sensing interface showed a slight change of CC signal. However, 80 nM ATP gave an evident CC response. Two analgesic drugs (pethidine and methadone) and the complete hydrolyzate of cocaine (ecgonine) were used to test the selectivity of the cocaine sensing platform. There was no remarkable CC response for the mixed sample (0.83 mM pethidine, 0.83 mM methadone, and 0.83 mM ecgonine). It was observed that 6.3 μM cocaine led to an evident change of CC response. It indicated that the proposed strategies had good selectivity in ATP detection and also in cocaine detection, which were able to distinguish targets in complex samples from their analogues. Reusability was another essential aspect of the biosensors. In this work, the regeneration can be realized simply by treating the

ARTICLE

Figure 4. (A) The CC response of the cocaine sensing interface for different concentrations of cocaine. CC response to cocaine, (a) the cocaine sensing interface, (b) 0 M, (c) 0.1 μM, (d) 0.2 μM, (e) 0.3 μM, (f) 1.3 μM, (g) 6.3 μM, (h) 16.3 μM, (i) 26.3 μM, and (j) 36.3 μM. (B) The relative response of the cocaine sensing interface to different concentrations of cocaine (from 0.1 to 36.3 μM). Inset: a linear range from 0.1 to 26.3 μM. The error bars represent the standard deviations of three measurements from three different electrodes.

Figure 5. The selectivity of the sensing interfaces of ATP and cocaine: CTP (C), UTP (U), GTP (G), pethidine (P), methadone (M), ecgonine (E).

used sensing surfaces with hot water (80 °C) for 3-5 min followed by rinsing with hot water. The ATP sensing interface (Figure S9A in the Supporting Information) and the cocaine 1527

dx.doi.org/10.1021/ac101988n |Anal. Chem. 2011, 83, 1523–1529

Analytical Chemistry

ARTICLE

Table 1. Recovery of ATP and Cocaine in Different Mixed Samplesa added ATP sample (nM)

recoveryb (%)

found

cocaine

cocaine

(μM)

ATP (nM)

(μM)

ATP

1

0

0

0.13 ( 0.18

0.05 ( 0.05

2

0

0.4

0.13 ( 0.16

0.36 ( 0.06

3

5

0

4.7 ( 0.16

0.06 ( 0.07

94.0

4 5

15 40

17.3 ( 0.17 1.43 ( 0.06 40.0 ( 0.21 6.12 ( 0.07

115.3 100.0

1.4 6.4

6

80

16.4

7

330

26.4

69.8 ( 0.19 301.9 ( 0.2

cocaine

90.0 102.1 95.6

17.3 ( 0.07

87.3

105.5

29.8 ( 0.06

91.5

112.9

a

The recovery is obtained according to the ratio between the amount of target predicted from the linear calibration curves and that actually added. The standard deviations of measurements were calculated from four independent experiments. b Recovery means the ratio of [found (CATP)/added (CATP)] or [found (Ccocaine)/added (Ccocaine)].

sensing interface (Figure S9B in the Supporting Information) could be used three times without sacrificing detection efficiency. When the sensing surfaces were regenerated for more than three times, the detection of ATP or cocaine was not as sensitive as before. This might be a result of losing the activity of DNA by repeating the use of the sensing surfaces with SH-DNA. It is still a challenge for most existing DNA sensors. To investigate the stability of the MECAS, the sensing interfaces were stored in pure water at 4 °C over 12 days and recovered to room temperature slowly. The CC signal of the conserved sensing interfaces only decreased 8.1% ((0.05) for the ATP sensing interface and 8.8% ((0.04) for the cocaine sensing interface compared with the relative sensing interfaces before cooling treatment. The little decrease may be ascribed to the partial degradation of the DNA. Obviously, the MECAS was fairly robust in normal storage conditions and achieved a sufficient stability for detection. Application of MECAS Chip for Detection of ATP and Cocaine in Different Mixed Samples and Real Samples. The feasibility of the integrated MECAS chip for applications of multiplex detection of ATP and cocaine was investigated by analyzing several mixed samples of ATP and cocaine in comparison with the results of the individual detection of ATP and cocaine. According to the linear calibration curves obtained from our previous experiments: Q - Q0 = 0.9225 þ 1.013 log CATP and Q - Q0 = 1.854 þ 1.443 log Ccocaine, an acceptable recovery data was obtained by four independent groups of three-electrode systems on-chip (Table 1). The integrated MECAS chip to detect ATP and cocaine was not affected in these mixed samples. It obviously indicated that the ATP sensing interface and the cocaine sensing interface did not interact with each other for the multiplex detection assays. In addition, the results showed a remarkable repeatability of different groups of three-electrode systems integrated on-chip. It was worth evaluating the MECAS in real samples (here, human serum and human plasma). The multidetection of ATP and cocaine in 10% human plasma (Figure S10A in the Supporting Information) and in 10% human serum (Figure S10B in the Supporting Information) could be successfully achieved with high selectivity by using our designed MECAS; however, the response was not as sensitive as in buffer solution (Figure 2).

This phenomenon may be caused by the complexity of the biological assay.10

’ CONCLUSIONS In summary, a MECAS by using Au-Ag dual-metal array three-electrode systems on-chip has been first developed through CC measurement and achieves label-free multianalysis of two model small molecules: ATP and cocaine. The fabrication of Au-Ag dual-metal array three-electrode systems is simple and controllable, which facilitates the future design of the integrated electrode according to the different requirements. Meanwhile, the sensing interface fabrication, sample incubation, and electrochemical detection on-chip are all performed in microfluidic channels. The microchannels used for fabricating the sensing platforms are quite convenient. The multiplex detection is based on the ATP and cocaine, respectively, sensing platforms integrated on the MECAS chip by using only one electrochemical probe. Furthermore, as an amplified element, AuNPs are used to produce an amplified electrochemical signal and improve the sensitivity of the sensor. By using the designed electrochemical chip detector, we achieve the simultaneous detection of ATP and cocaine in mixed samples with high sensitivity and high selectivity. It should be noticed that the present platform is not a device for measuring ATP and cocaine in a flow through system. We just use microfluidic channels and the electrochemical chip design to achieve the purpose of multidetection of targets in one sample. By combining the microfluidic technique and aptamer technique, we easily and conveniently demonstrated the concept on-chip. The MECAS on-chip proposed holds promising potential for designing electrochemical devices with high throughput, high automation, and high integration in multianalysis and simultaneous detection. ’ ASSOCIATED CONTENT

bS

Supporting Information. Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org.

’ AUTHOR INFORMATION Corresponding Author

*Fax: (þ86) 431-85689711. Phone: (þ86) 431-85262003. E-mail: [email protected] (E.W.); [email protected] (S.D.).

’ ACKNOWLEDGMENT This work was supported by the National Natural Science Foundation of China (Grant Numbers 20890020, 20820102037, 20935003, and 21055116) and 973 Project Numbers 2009CB930100, 2010CB933600, and 2011CB911002. ’ REFERENCES (1) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818–822. (2) Robertson, D. L.; Joyce, G. F. Nature 1990, 344, 467–468. (3) Tuerk, C.; Gold, L. Science 1990, 249, 505–510. (4) Jayasena, S. D. Clin. Chem. 1999, 45, 1628–1650. (5) Famulok, M.; Mayer, G.; Blind, M. Acc. Chem. Res. 2000, 33, 591–599. (6) Tombelli, S.; Minunni, A.; Mascini, A. Biosens. Bioelectron. 2005, 20, 2424–2434. (7) Xiao, Y.; Lubin, A. A.; Heeger, A. J.; Plaxco, K. W. Angew. Chem., Int. Ed. 2005, 44, 5456–5459. 1528

dx.doi.org/10.1021/ac101988n |Anal. Chem. 2011, 83, 1523–1529

Analytical Chemistry

ARTICLE

(8) Willner, I.; Zayats, M. Angew. Chem., Int. Ed. 2007, 46, 6408– 6418. (9) Zuo, X. L.; Song, S. P.; Zhang, J.; Pan, D.; Wang, L. H.; Fan, C. H. J. Am. Chem. Soc. 2007, 129, 1042–1043. (10) Du, Y.; Li, B. L.; Wei, H.; Wang, Y. L.; Wang, E. K. Anal. Chem. 2008, 80, 5110–5117. (11) Elbaz, J.; Shlyahovsky, B.; Li, D.; Willner, I. ChemBioChem 2008, 9, 232–239. (12) Zayats, M.; Huang, Y.; Gill, R.; Ma, C. A.; Willner, I. J. Am. Chem. Soc. 2006, 128, 13666–13667. (13) Hansen, J. A.; Wang, J.; Kawde, A. N.; Xiang, Y.; Gothelf, K. V.; Collins, G. J. Am. Chem. Soc. 2006, 128, 2228–2229. (14) Hayashi, E.; Takada, T.; Nakamura, M.; Yamana, K. Chem. Lett. 2010, 39, 454–455. (15) Li, X. M.; Liu, J. M.; Zhang, S. S. Chem. Commun. 2010, 46, 595–597. (16) Xu, D. K.; Chen, H. Y. Prog. Chem. 2009, 21, 2379–2387. (17) Swensen, J. S.; Xiao, Y.; Ferguson, B. S.; Lubin, A. A.; Lai, R. Y.; Heeger, A. J.; Plaxco, K. W.; Soh, H. T. J. Am. Chem. Soc. 2009, 131, 4262–4266. (18) Wang, H. X.; Liu, Y.; Liu, C. C.; Huang, J. Y.; Yang, P. Y.; Liu, B. H. Electrochem. Commun. 2010, 12, 258–261. (19) Kim, Y. S.; Niazi, J. H.; Gu, M. B. Anal. Chim. Acta 2009, 634, 250–254. (20) Xu, D. K.; Xu, D. W.; Yu, X. B.; Liu, Z. H.; He, W.; Ma, Z. Q. Anal. Chem. 2005, 77, 5107–5113. (21) Du, Y.; Chen, C. G.; Yin, J. Y.; Li, B. L.; Zhou, M.; Dong, S. J.; Wang, E. K. Anal. Chem. 2010, 82, 1556–1563. (22) Zhang, J.; Song, S. P.; Zhang, L. Y.; Wang, L. H.; Wu, H. P.; Pan, D.; Fan, C. H. J. Am. Chem. Soc. 2006, 128, 8575–8580. (23) Du, Y.; Li, B. L.; Wang, E. K. Bioanal. Rev. 2010, 1, 187–208. (24) Sadik, O. A.; Aluoch, A. O.; Zhou, A. L. Biosens. Bioelectron. 2009, 24, 2749–2765. (25) Nieuwenhuizen, M. S.; Harteveld, J. L. N. Sens. Actuators, B 1997, 40, 167–173. (26) Li, F.; Zhang, J.; Cao, X. N.; Wang, L. H.; Li, D.; Song, S. P.; Ye, B. C.; Fan, C. H. Analyst 2009, 134, 1355–1360. (27) Stojanovic, M. N.; de Prada, P.; Landry, D. W. J. Am. Chem. Soc. 2000, 122, 11547–11548. (28) Kang, X. F.; Jin, Y. D.; Cheng, G. J.; Dong, S. J. Langmuir 2002, 18, 1713–1718. (29) Chen, C. G.; Zhang, J. C.; Du, Y.; Yang, X. R.; Wang, E. K. Analyst 2010, 135, 1010–1014. (30) Grabar, K. C.; Freeman, R. G.; Hommer, M. B.; Natan, M. J. Anal. Chem. 1995, 67, 735–743. (31) Liu, J.; Lu, Y. Nat. Protoc. 2006, 1, 246–252. (32) Pavlov, V.; Shlyahovsky, B.; Willner, I. J. Am. Chem. Soc. 2005, 127, 6522–6523. (33) Storhoff, J. J.; Elghanian, R.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L. J. Am. Chem. Soc. 1998, 120, 1959–1964. (34) Steel, A. B.; Herne, T. M.; Tarlov, M. J. Anal. Chem. 1998, 70, 4670–4677. (35) Li, W.; Nie, Z.; Xu, X. H.; Shen, Q. P.; Deng, C. Y.; Chen, J. H.; Yao, S. Z. Talanta 2009, 78, 954–958. (36) Baker, B. R.; Lai, R. Y.; Wood, M. S.; Doctor, E. H.; Heeger, A. J.; Plaxco, K. W. J. Am. Chem. Soc. 2006, 128, 3138–3139. (37) Freeman, R.; Sharon, E.; Tel-Vered, R.; Willner, I. J. Am. Chem. Soc. 2009, 131, 5028–5029. (38) Huizenga, D. E.; Szostak, J. W. Biochemistry 1995, 34, 656–665.

1529

dx.doi.org/10.1021/ac101988n |Anal. Chem. 2011, 83, 1523–1529