Environ. Sci. Technol. 2005, 39, 9791-9798
Modulation of Brain Steroidogenesis by Affecting Transcriptional Changes of Steroidogenic Acute Regulatory (StAR) Protein and Cholesterol Side Chain Cleavage (P450scc) in Juvenile Atlantic Salmon (Salmo salar) Is a Novel Aspect of Nonylphenol Toxicity AUGUSTINE ARUKWE* Department of Biology, Norwegian University of Science and Technology (NTNU), Høgskoleringen 5, 7491 Trondheim, Norway
Gene expression patterns for key brain steroidogenic (StAR, P450scc, CYP11β) and xenobiotic- and steroidmetabolizing enzymes (CYP1A1 and CYP3A) have been investigated in waterborne nonylphenol (5, 15, and 50 µg/ L) treated juvenile Atlantic salmon (Salmo salar), in addition to carrier vehicle (ethanol) exposed fish, sampled at different time intervals (0, 3, and 7 days) after exposure. Gene expression patterns were studied using the quantitative polymerase chain reaction (real-time PCR). Treatment of juvenile salmon with nonylphenol caused significant induction of steroidogenic acute regulatory (StAR) protein mRNA at day 7 postexposure in the group receiving 15 µg of nonylphenol/L. P450scc was first induced in the group treated with 5 µg of nonylphenol/L at day 7; thereafter, an apparent nonylphenol-concentration-dependent decrease in P450scc mRNA was observed. CYP11β mRNA was significantly induced at day 3 after exposure to 5 µg of nonylphenol/L; thereafter, CYP11β mRNA levels were inhibited below control levels in the 15 and 50 µg of nonylphenol/L groups at day 3. At day 7, significant induction of CYP11β mRNA was observed only in the group exposed to 15 µg of nonylphenol/L. For CYP1A1 mRNA, apparent nonylphenolconcentration-dependent decreases were observed at day 7 postexposure. CYP3A mRNA was significantly induced by all nonylphenol exposure concentrations at day 7. When exposed groups were compared, CYP3A transcript was significantly induced between 5 and 15 µg of nonylphenol/ L, and decreased between 15 and 50 µg of nonylphenol/ L. The ethanol control showed a significant reduction of CYP3A mRNA at day 3 postexposure. The present study has demonstrated variations in three key steroidogenic proteins and xenobiotic- and steroid-metabolizing CYP isoenzyme gene transcripts in the brain of nonylphenolexposed juvenile salmon. Therefore, the present study represents a novel aspect of neuroendocrine effects of nonylphenol in fish not previously demonstrated and should be studied in more detail. * Phone: +47 73 596265. Fax: +47 73 591309. E-mail: arukwe@ bio.ntnu.no. 10.1021/es0509937 CCC: $30.25 Published on Web 11/08/2005
2005 American Chemical Society
Introduction Steroid hormones play crucial roles in the proper functioning of the body by mediating a wide variety of vital physiological functions such as sexual differentiation, ion and carbohydrate homeostasis, immune system functioning, responsiveness to stress, and reproduction (1, 2). Synthesized in the gonads, adrenals, placenta, and central nervous system, steroid hormones have different physiological effects that are dependent upon a set of synthetic enzymes in each tissue (3). In the brain, it is well established that steroid hormones have multiple functional and structural effects during development and adulthood (4, 5). Regardless of the tissue of origin, all steroid hormones are synthesized from cholesterol as a common precursor (6). The delivery of cholesterol from the outer to the inner mitochondrial membrane where the first enzymatic conversion occurs is the true rate-limiting step in steroidogenesis (7, 8). Thus, a key target for the acute regulation of steroidogenesis by tropic hormones and other mediators is the rate of delivery of cholesterol to cytochrome P450 (CYP) mediated cholesterol side chain cleavage (P450scc) by the sterol carrier protein, steroidogenic acute regulatory protein (StAR) (9, 10). A large number of steroidogenic enzymes belong to the CYP group of enzymes that have multiple activities (11). Although StAR and P450scc are the main proteins involved in the early steroidogenic pathways, other proteins such as 17R-hydroxylase, 3β-hydroxysteroid dehydrogenase (3βHSD), and 21- and 11β-hydroxylases (CYP11β) (11) are also key enzymes in steroidogenesis whose biological functions are known to be modulated by environmental chemicals (12, 13). CYP11β is an important steroidogenic enzyme that catalyzes the conversion of deoxycorticosterone and 11deoxycortisol to corticosterone and cortisol, respectively, in steroidogenic tissues. In teleosts, CYP11β is known to catalyze the biosynthesis of the potent androgen 11-ketotestosterone (11-KT) by male fish, which appears to control many aspects of spermatogenesis (14). Downstream of P450scc, there are other enzymes that appear less sensitive to toxicant insult (13), as a result of their abundance with a longer half-life and their ability to retain normal steroidogenic capacity even in the absence of trophic hormone stimulation (15). Several studies have reported the impairment of adrenocortocoid responses by xenobiotics such as polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), and heavy metals in fish species (16, 17). In addition, several structurally diverse environmental chemicals such as atrazine (18, 19), Roundup herbicide (13), and pharmaceuticals such as letrozole (20, 21) and ketoconazole (22, 23) are known to inhibit or induce CYPs and other proteins involved in steroidogenesis. For example, in a study by Ohno et al. (24), exposure of H295R cells to a range of flavonoid phytochemicals on steroidogenic enzymes including P450scc, CYP11β, CYP17, CYP21, and 3β-HSD showed that six hydroxylated flavonoids inhibited CYP17 and CYP11β, and in combination with other flavonoids also inhibited CYP21 and 3β-HSD. In addition to their role in steroidogenesis, some CYP isoenzymes, including the CYP1A1 and CYP3A families, play important roles in steroid hormone metabolism. These xenobiotic- and steroid-metabolizing CYPs are known to be regulated by circulating estrogens, and recent results have shown that estrogen mimics such as nonylphenol do also modulate these CYPs in ways similar to those of natural estrogens (25, 26). Nonylphenol is a degradation product of alkylphenol polyethoxylates (APEs) that represent an important class of VOL. 39, NO. 24, 2005 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
9791
TABLE 1. Primer Pair Sequences Used for RT-PCR
a
primer sequencea
target gene
forward
reverse
amplicon size (no. of nucleotides)
StAR P450scc CYP11β CYP1A1 CYP3A
AGGATGGATGGACCACTGAG TGGAGTCCTGCTCAAGAATG AGGAGGTGGTAGTGGGGG GAGTTTGGGCAGGTGGTG ACTAGAGAGGGTCGCCAAGA
GTCTCCCATCTGCTCCATGT TTATGTACTCGGGCCACAAA CCCCAGCCATGAGTTCAG TGGTGCGGTTTGGTAGGT TACTGAACCGCTCTGGTTTG
163 141 118 76 146
Sequences are given in the 5’-3’order.
nonionic surfactants widely used in many detergent formulations and plastic products for industrial and domestic use (27, 28). Much of the work done on the effects of xenoestrogens so far has focused on in vitro and in vivo studies of vitellogenin and eggshell zona radiata protein induction in fish (29, 30). In addition, a few other studies have investigated their effects on androgen-estrogen conversion through aromatase (CYP19) (31, 32). Many xenoestrogens and natural estrogens that have endocrine disrupting effects exert their actions through modulation of steroid pathways (33, 34). However, the mechanisms of action of these xenoestrogens are still largely unknown and have not been investigated with regard to neurosteroidogenic pathways. Recently, Govoroun et al. (35) showed that exposure of male rainbow trout (Oncorhynchus mykiss) to dietary estradiol17β resulted in the inhibition of 3β-HSD, 17R-hydroxylase/ lyase, and CYP11β expressions. The possible influence of environmental estrogens on neurosterodogenesis and the neural steroid- and xenobiotic-metabolizing enzymes in fish or lower vertebrates has only been partially investigated. Therefore, the present study was undertaken to evaluate the effect of the xenoestrogen nonylphenol on key neural steroidogenic and metabolizing enzymes using molecular methods. These neurosteroidogenic effects were investigated using immature juvenile Atlantic salmon and different environmentally relevant nonylphenol concentrations and sampling at different time intervals.
Materials and Methods Chemicals. 4-Nonylphenol (NP; 85% para-isomers) was purchased from Fluka Chemika-Biochemika (Buchs, Switzerland). The impurities in 4-nonylphenol consist mainly of phenol (8-13%), tripropylene (∼1%), and 2,4-dinonylphenol (∼1%). o-Phenylenediamine dihydrochloride was purchased from Sigma Chemical (St. Louis, MO). Trizol reagent, DNase, and oligo(dT)18 primer were purchased from Gibco-Invitrogen Life Technologies (Carlsbad, CA). DNA ladder, a RevertAid First Strand cDNA Synthesis Kit (Fermentas GmbH, Germany), and deoxynucleotide triphosphates (dNTPs) were purchased from Stratagene (La Jolla, CA). Other chemicals (SYBR Green Real-Time PCR Master Mix) were purchased from Bio-Rad Laboratories (Hercules, CA). All other chemicals were of the highest commercially available grade. Fish and Treatment. The experiments and procedures described in this paper are conducted in accordance with the laws and regulations controlling experiments with live animals in Norway (where the experiment was conducted), i.e., The Animal Protection Act of Dec 20, 1974, no. 73, Chapter VI, paragraphs 20-22, and The Animal Protection Ordinance Concerning Biological Experiments in Animals of Jan 15, 1996, with permission from the National Board for Experiments with Animals. Juvenile immature Atlantic salmon (mean weight and length 10 ( 2.5 g and 9 ( 2 cm, respectively) were obtained from Lundamo hatcheries (Trondheim, Norway) and kept in 70 L aquariums at 10 ( 0.5 °C and for a 12:12 h photoperiod at the Department of Biology, Norwegian University of Science and Technology (NTNU), animal 9792
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 39, NO. 24, 2005
holding facilities in Trondheim. During the experimental period, the fish were starved. Three groups of fish were exposed to waterborne nonylphenol dissolved in ethanol (350 µL, carrier vehicle) at concentrations of 5, 15, and 50 µg/L in addition to a blank group that was sampled at day 0 (i.e., at the start of experiment). The control group was exposed to the carrier vehicle (350 µL). The nonylphenol concentrations were chosen for this study because they are environmentally relevant concentrations. Brain samples were collected at days 0 (blank to establish background levels), 3, and 7 after exposure for all exposure concentrations including the carrier-vehicle-treated control. Samples were collected from six individuals from each exposure group after the fish were anaesthetized with benzocaine (5 mg/L) and sacrificed. After sacrifice, the brain was excised and weighed. Total RNA Isolation and Quantitative (Real-Time) Polymerase Chain Reaction (RT-PCR). Brain samples obtained from individual exposures were homogenized in Trizol reagent and purified according to established procedures (36, 37). Total RNA was DNase treated, and the concentrations were measured using a NanoDrop spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE). Quantitative (realtime) PCR was used for evaluating gene expression profiles. Real-time PCR primers of 70-170 bp with an annealing temperature of 55-60 °C were designed from conserved regions of the studied genes using PCR designer software from Stratagene (http://labtools.stratagene.com/Forms/SVLogin.php). The primer pair sequences and their amplicon size are as shown in Table 1. cDNA for the real-time PCRs was generated using the RevertAid First Strand cDNA Synthesis Kit as described by the manufacturer (Fermentas). Total cDNA was prepared from 3 µg of brain DNase-treated total RNA and 500 ng of random hexamer oligonucleotide (Amersham Biosciences) using the RevertAid kit as described by the manufacturer (Fermentas). The 20 µL reaction was incubated at 42°C for 2 h and diluted 30-fold before DNA amplification. For each treatment, the expressions of individual gene targets were analyzed using the Mx3000P RealTime PCR System (Stratagene, La Jolla, CA). Prior to all real-time PCRs, all primer pairs were used in titration reactions to determine optimal primer pair concentrations, and real-time PCRs were run using reverse transcriptase (RT) reactions without enzyme. All chosen primer pair concentrations gave a single band pattern for the expected amplicon size in all reactions, and no amplification occurred in RT reactions without enzyme (Figure 1). The following primer pair concentrations were used for each 25 µL real-time PCR: 200 pmol each of the forward and reverse primers for StAR, P450scc, CYP11β, and CYP1A1, and 320 pmol each of the forward and reverse primers for CYP3A. Each 25 µL DNA amplification reaction contained 12.5 µL of 2× SYBR Green Mix (Bio-Rad), 0.75 µL of 1 mM ROX (reference dye), and 1 µL of cDNA. The real-time PCR program included an enzyme activation step at 95 °C (10 min) and 40 cycles of 95 °C (30 s), 55 °C for CYP11β and CYP1A1, 60 °C for StAR and P450scc, and 50 °C for CYP3A (1 min), and 72 °C (30 s). We included control samples lacking cDNA template or Taq
FIGURE 2. Effects of waterborne nonylphenol on brain StAR mRNA expression of juvenile Atlantic salmon: real-time PCR analysis of StAR mRNA levels with specific primer pairs. All values represent the mean (n ) 6) ( standard error of the mean (SEM). Different letters denote nonylphenol exposure groups that are significantly different (p < 0.05) compared to the carrier vehicle (ethanol) treated group, analyzed using ANOVA followed by Dunnett’s test. FIGURE 1. Real-time PCR products of the investigated genes. The PCR-amplified gene products were obtained with different primer sets specific to the respective gene of interest and prepared to span the conserved regions. The PCR products were separated by 1.2% agarose electrophoresis and detected by ethidium bromide staining. Lanes: 1, CYP1A1; 2, CYP3A; 3, P450ssc; 4, CYP11β; 5, StAR (big product); 6, StAR (this paper). DNA polymerase to determine the specificity of target cDNA amplification. Cycle threshold (Ct) values obtained were converted into the mRNA copy number using standard plots of Ct versus log copy number. The criterion for using the standard curve is based on equal amplification efficiency with unknown samples, and this is usually checked prior to extrapolation of unknown samples to the standard curve. The standard plots were generated for each target sequence using known amounts of plasmid containing the amplicon of interest (see below). Data obtained from triplicate runs for target cDNA amplification were averaged and expressed as nanograms per microliter of initial total RNA used for reverse transcriptase (cDNA) reaction. RT-PCR Cloning and Sequencing. PCR products for StAR, P450scc, CYP11β, and CYP3A (398, 141, 119, and 146 bp, respectively) were carefully excised from the agarose gel, followed by purification with a QUIAEX II Gel Extraction Kit (Quiagen Inc., Valencia, CA). A 76 bp CYP1A1 gene fragment was amplified in this study. The full-length gene sequence of the Atlantic salmon CYP1A1 has previously been cloned in our laboratory (39). Gel-extracted StAR, P450scc, CYP11β, and CYP3A PCR products were ligated and subcloned into a PCR 2.1 vector (Invitrogen Corp., Carlsbad, CA) according to the manufacturer’s protocol. Clones were selected by bluewhite screening. Positive clones were grown overnight and harvested for plasmid purification using a Quiagen kit. The incorporation and orientation of PCR products into plasmids was confirmed by restriction analysis. Positive clones containing the expected sized restriction fragments were sequenced and confirmed as the desired gene fragment. PCR inserts were sequenced in both directions with oligonucleotide sequences corresponding to M13 forward and reverse primers within the PCR 2.1 plasmid as primers for the sequencing reaction at the Biology Department sequence core facility. NCBI Blast verified the sequence results. The plasmids containing gene products were used for obtaining a standard curve for quantitative RT-PCR (see above). Statistical Analyses. Standard errors were calculated using JMP statistic software, V3.01 (SAS Institute, Cary, NC). Comparison of different concentrations of NP-treated and control groups was performed using Dunnett’s method. Statistical differences among treatment groups were tested
FIGURE 3. Effects of waterborne nonylphenol on brain P450scc mRNA expression of juvenile Atlantic salmon: real-time PCR analysis of P450scc mRNA levels with specific primer pairs. All values represent the mean (n ) 6) ( standard error of the mean (SEM). Different letters denote nonylphenol exposure groups that are significantly different (p < 0.05) compared to the carrier vehicle (ethanol) treated group, analyzed using ANOVA followed by Dunnett’s test. using analysis of variance (ANOVA) and the Tukey-Kramer method. For all the tests the level of significance was set at p < 0.05, unless otherwise stated.
Results Modulation of Steroidogenic Protein and Enzyme Gene Transcripts. The effects of nonylphenol reported in the present study are based on nominal exposure concentrations. The main steroidogenic protein (StAR) and enzyme (P450scc and CYP11β) gene expressions were studied in salmon brain using real-time PCR for quantitative transcript patterns. Quantification of the StAR mRNA showed a 181% significant induction at day 7 postexposure only in the group receiving 15 µg of nonylphenol/L (Figure 2); otherwise only minor changes in StAR mRNA were observed. In Figure 3, a quantitative analysis of the P450scc transcript pattern showed that exposure to nonylphenol did not cause significant changes in the mRNA level at day 3 postexposure (Figure 3). At day 7 postexposure, P450scc mRNA levels were significantly induced 150% and 140%, respectively, in the groups exposed to 5 and 15 µg of nonylphenol/L (Figure 3). When the nonylphenol exposure groups were compared, apparent concentration-dependent decreases in P450scc mRNA levels were observed at day 7 after exposure (Figure 3). Interestingly, the carrier vehicle (ethanol) control group caused a significant VOL. 39, NO. 24, 2005 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
9793
FIGURE 4. CYP11β mRNA levels in the brain of juvenile Atlantic salmon exposed to waterborne nonylphenol at 5, 15, and 50 µg/L and sampled at days 3 and 7 after exposure. CYP11β mRNA levels were quantified using real-time PCR with specific primer pairs. All values represent the mean (n ) 6) ( standard error of the mean (SEM). Different letters denote nonylphenol exposure groups that are significantly different (p < 0.05) compared to the carrier vehicle (ethanol) treated group, analyzed using ANOVA followed by Dunnett’s test. 150% induction of P450scc at day 3, compared to blank samples (i.e., day 0). Figure 4 shows the CYP11β mRNA levels after exposure of juvenile Atlantic salmon to waterborne nonylphenol. Significant induction of CYP11β mRNA was observed at day 3 postexposure in the group receiving 5 µg of nonylphenol/ L; thereafter, apparent nonylphenol-concentration-dependent decreases in CYP11β mRNA levels were observed (Figure 4). At day 7 postexposure, a 250% significant induction, compared to that of the ethanol-treated control, of CYP11β mRNA was observed only in the group receiving 15 µg of nonylphenol/L (Figure 4). However, the nonylphenolinduced CYP11β mRNA observed at day 3 in the group exposed to 5 µg of nonylphenol/L was significantly reduced at day 7 postexposure (Figure 4), and 50 µg of nonylphenol/L caused only minor changes in CYP11β mRNA at days 3 and 7 (Figure 4). Modulation of Xenobiotic- and Steroid-Metabolizing Enzyme Gene Transcripts. Exposure of juvenile Atlantic salmon to waterborne nonylphenol resulted in 68%, 26%, and 47%, respectively, inhibition of brain CYP1A1 mRNA levels in the groups exposed to 5, 15, and 50 µg of nonylphenol/L at day 3 postexposure (Figure 5). At day 7, nonylphenol caused 153% and 142%, respectively, induction of brain CYP1A1 mRNA levels in the groups receiving 5 and 15 µg of nonylphenol/L compared to the ethanol-treated control group (Figure 5). CYP1A1 mRNA maintained an inhibited level below that of the ethanol-treated control mRNA in the group exposed to 50 µg of nonylphenol/L at day 7 (Figure 5). In accordance with CYP1A1, exposure of juvenile Atlantic salmon to waterborne nonylphenol caused a 50%, 48%, and 50%, respectively, inhibition of brain CYP3A mRNA expressions in the groups exposed to 5, 15, and 50 µg of nonylphenol/L at day 3 postexposure (Figure 6). At day 7, a significant 250%, 300%, and 150% induction, respectively, of CYP3A mRNA was observed in the groups exposed to 5, 15, and 50 µg of nonylphenol/L, compared to the ethanoltreated group (Figure 6).
Discussion Previously, we have demonstrated using autoradiography that a substantial amount of nonylphenol accumulated in the central nervous system of juvenile salmon after 48 h of exposure to radiolabeled nonylphenol (30); despite the potential for adverse consequences, it was not shown whether this accumulation will result in biological effects. Since xenoestrogens, including nonylphenol, have the potential 9794
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 39, NO. 24, 2005
FIGURE 5. CYP1A1 mRNA levels in the brain of juvenile Atlantic salmon exposed to waterborne nonylphenol at 5, 15, and 50 µg/L and sampled at days 3 and 7 after exposure. CYP1A1 mRNA levels were quantified using real-time PCR with specific primer pairs. All values represent the mean (n ) 6) ( standard error of the mean (SEM). Different letters denote nonylphenol exposure groups that are significantly different (p < 0.05) compared to the carrier vehicle (ethanol) treated group, analyzed using ANOVA followed by Dunnett’s test.
FIGURE 6. Brain CYP3A mRNA levels in juvenile Atlantic salmon exposed to waterborne nonylphenol at 5, 15, and 50 µg/L and sampled at days 3 and 7 after exposure. CYP3A mRNA levels were quantified using quantitative RT-PCR with specific primer pairs. All values represent the mean (n ) 6) ( standard error of the mean (SEM). Different letters denote nonylphenol exposure groups that are significantly different (p < 0.05) compared to the carrier vehicle (ethanol) treated group, analyzed using ANOVA followed by Dunnett’s test. for indirect actions on steroidogenesis and xenobiotic and steroid metabolism, studies were carried out to determine the effects of nonylphenol on the expression of protein and enzymes involved in these three critical systems in the brain of Atlantic salmon. The data show that nonylphenol modulates the StAR, P450scc, CYP11β, CYP3A, and CYP1A1 gene expressions in the salmon brain and that these effects depend on the nonylphenol concentration and time of exposure, thus showing that an environmental pollutant known to mimic the action of endogenous estrogens (estradiol-17β) also causes variations in a key brain steroidogenic pathway and CYP-dependent xenobiotic- and steroid-metabolizing enzymes. This is in agreement with the knowledge that steroid hormones modify the steroidogenic pathways and responses of several CYP isoenzymes in both hepatic and extrahepatic organs of fish and mammals (40, 41). Therefore, the present study uncovers a novel aspect of nonylphenol toxicity not previously demonstrated in fish brain. Modulation of Steroidogenic Protein and Enzyme Gene Transcripts. The present study reveals that salmon brain expresses StAR and P450scc, but more importantly that the StAR and P450scc are responsive to xenoestrogen exposure. This study also showed that another key steroidogenic enzyme, CYP11β, is modulated by nonylphenol exposure, where 15 and 50 µg/L inhibited the mRNA levels at day 3,
also at day 7 in the highest nonylphenol concentration (50 µg/L). This is in accordance with the study of Yokota et al. (42) where a complete inhibition of CYP11β transcript was observed at two high 4-tert-nonylphenol concentrations (413 and 783 µg/L) using RT-PCR analysis. A vast majority of the research on endocrine disruption has focused on its effects on estrogenicity evaluated with in vitro and in vivo protein expressions (32, 33, 43-45), and structure-activity relationship have also been developed for estrogen receptor binding (46). To our knowledge, the roles of endocrine disruptors on neurosteroidogenic pathways have not been investigated, and further studies are needed to discern these effects. The transcriptional changes in the reported genes from the present study suggest that the experimental animals are experiencing impaired steroidogenesis. Although we did not measure serum levels of steroid hormones in the present study due to limited blood samples, there are aspects of the present study that can be compared with other studies where impaired steroidogenesis has been reported in fish species after treatment with estrogenic substances. For example, it was shown that exposure of male fathead minnow to methoxychlor caused significant reduction of plasma 11ketotestosterone (11-KT) concentrations (47). Elsewhere, Loomis and Thomas (48) investigated the effects of xenoestrogens on testicular androgen production using an in vitro assay with testicular tissues from Atlantic croaker (Micropogonias undulates), and reported that several of the xenoestrogenic chemicals including nonylphenol caused concentration-dependent decreases in 11-KT production. Given the important role of StAR, P450scc, and CYP11β in steroidogenic pathways, they may prove to be effective molecular and cellular targets for and useful biomarkers to evaluate endocrine system function in wildlife species. Elevated StAR transcript was only observed in the group exposed to 15 µg of nonylphenol/L. Given that there is only a 3-fold increase in the nonylphenol concentrations used in the present study, we speculate that 15 µg/L is a threshold concentration for StAR transcriptional regulation by nonylphenol. This fine physiological nonylphenol threshold is not surprising since the StAR is mainly involved in the regulation of acute steroid hormone production by stimulating cholesterol transfer through the hydrophobic tunnel structure formed within its molecules (9). Furthermore, it should be noted that the carrier vehicle (ethanol) caused a significant elevation of P450scc mRNA expression at day 3 postexposure. Given that the ethanol-treated fish is the experimental control group in this study, there is no doubt that the sensitivity of salmon brain P450scc toward waterborne nonylphenol exposure is underscored by the effect of ethanol at day 3. This is the first time we are experiencing the ethanol effect in our studies, and because there is no study known to us where ethanol has been shown to have an estrogenic effect, we are performing experiments to understand the reality of this effect, as this might have some physiological significance. Nevertheless, the mechanisms by which endocrine disruptors such as nonylphenol modulate the StAR protein should be studied in a more detailed and differently designed study. In general, a disruption of StAR expression may represent the first event in the sequence of related event cascades underlying xenoestrogen-induced toxicity and transmittable disturbances to the whole organism level. In this regard, the identification and full-length gene cloning of StAR in Atlantic cod (49) and rainbow trout (50) represent promising signs in the understanding of xenoestrogen modulation of steroidogenesis in fish and may contribute to the development of reproductive dysfunction markers in these species. It was reported recently that two pesticides, the organochlorine insecticide lindane and the organophosphate insecticide dimethoate, that lower serum testosterone levels
in animals block steroid hormone biosynthesis in Leydig cells by reducing StAR protein expression (51). These findings raise the possibility that other environmental estrogens may also inhibit steroidogenesis by targeting StAR expression and/ or other steroidogenic enzymes. Because StAR protein mediates the rate-limiting step in brain steroidogenesis as well as other organs, and when compared to other steroidogenic enzymes, StAR protein may be particularly susceptible to modulation by environmental estrogens (e.g., nonylphenol) with negative consequences for neurosteroids for a number of reasons. First, neurosteroid biosynthesis may play an important role in central nervous system (CNS) development (52, 53), and the brain contains high concentrations of P450 and other enzymes normally utilized in steroidogenesis but that can also act as bioactivate toxicants (54, 55), as also demonstrated in this study. Second, the brain is unique in its de novo neurosteroid synthesis, especially within glia (52, 56), although the relative roles of locally produced neuroactive steroids and those converted from circulating precursors remain to be defined. Modulation of Xenobiotic- and Steroid-Metabolizing Enzyme Gene Transcripts. The CYP1A1 and CYP3A isoenzymes are recognized as the predominant catalysts of xenobiotic and steroid metabolism, respectively (57). Treatment of juvenile salmon with nonylphenol resulted in decreased levels of brain CYP1A1 mRNA in all experimental concentrations at day 3. At day 7, CYP1A1 was significantly induced in all nonylphenol exposure groups, compared to that at day 3, with the groups exposed to 5 and 15 µg/L showing significant induction, compared to ethanol-treated control fish. A similar pattern of nonylphenol effects is shown with CYP3A where inhibited mRNA levels were observed in all exposure groups at day 3 and significant inductions were observed at day 7, compared to those of the ethanol-treated control and respective day 3 exposures. Although we did not measure CYP1A1 or CYP3A catalytic activity due to insufficient tissue, it may be speculated that the temporal downregulation of CYP1A1 and CYP3A mRNA levels at day 3 by nonylphenol suggests an adaptive response to high cellular levels of the estrogen-like compound. This speculation is supported by the fact that CYP1A1 and CYP3A catalytic activities have been shown to decrease with increasing cellular estrogen levels during sexual maturation in several fish species (58-60). Furthermore, in fish species that exhibit a strong sex difference, the similarities between juvenile and reproductively active males and females have led to suggestions that the sex differences are due to a suppression of CYP isoenzyme expression in reproductively active females (59). In addition, it is also possible that nonylphenol has a direct effect on the estrogen feedback system or the pituitary that regulates tissue levels of steroid hormones through increased metabolism. Generally, our data are in accordance with previous studies showing that nonylphenol (i.e., estrogen mimic) and E2 significantly suppressed hepatic CYP3A and CYP1A1 mRNA levels, EROD activity, and CYP1A1 protein in in vivo and in vitro experiments using Atlantic salmon (25, 61). In this study, CYP3A and CYP1A1 mRNA was inhibited in all nonylphenol exposure concentrations at day 3. Specifically, there are several hypotheses explaining the CYP1A1 down-regulation by E2 and its mimics. For example, steroid hormones can bind the CYP1A1 protein (62), and through this binding, E2 or the metabolites generated from E2 may inhibit the catalytic activity of CYP1A1 protein (25). Navas and Segner (61) hypothesized that the inhibitory action of E2 could be mediated, at least in part, through the hepatic estrogen receptor (ER) where the ER-E2 complex can interfere with the CYP1A1 gene directly or alternatively may interact with the aryl hydrocarbon receptor (AhR) and indirectly regulate CYP1A1 gene expression through binding the xenobiotic VOL. 39, NO. 24, 2005 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
9795
response element (XRE). In addition, E2 may control the recruitment of ER and possibly other coactivators, besides activating the detoxification pathway. In a recent study it was shown that E2 exert its effects by activating the aryl hydrocarbon receptor nuclear translocator (AhR/ARNT) heterodimer, which is able to interact with the unliganded ER, leading to induction of the estrogenic pathway (63). Furthermore, the modulation of the CYP1A1 system by nonylphenol, E2, and β-naphthoflavone (BNF) was recently shown to parallel the AhR repressor (AhRR) gene expression (64). The basic helix-loop-helix-PAS (Per-AhR/ARNTSIM homology sequence) sequences of the transcription factor usually associate with each other to form heterodimers, AhR/ARNT or AhRR/ARNT, and bind the XRE sequences in the promoter regions of the target genes to regulate their expression. It is still subject to speculation whether a given XRE sequence will function as a transcriptional activator enhancer or silencer, and this may depend on the role of a specific promoter. This needs to be tested experimentally with regard to estrogen mimics such as nonylphenol. In mammals, it has been reported that the induction of CYP3A expression is mediated via the pregnane X receptor (PXR) (65). There is remarkable chemical and structural diversity of known PXR activators. For example, PXRs have been shown to be activated by various xenobiotics (e.g., rifampicin, clotrimazole, the bisphosphonate ester SR12813, hyperforin), natural and synthetic steroids (e.g., 5β-pregnane3, 20-dione, pregnenolone 16R-carbonitrile (PCN), dexamethasone), and bile acids (e.g., lithocholic acid, 6-ketolithocholic acid) (65-68). In addition, there is mounting evidence that the PXRs evolved to serve as promiscuous xenoreceptors for detecting potentially harmful compounds of both endogenous and exogenous origin (69). On the basis of the above-named studies, we speculate that nonylphenol may regulate CYP3A gene expression through interaction with PXR and/or other receptor coactivators/repressors and that this interaction is dependent on the nonylphenol concentration. Whether the nonylphenol-induced modulation of CYP3A levels demonstrated in the present study is mediated via the PXR should be investigated in a differently designed study, such as nuclear run-on experiments, and the mechanisms involved should be studied by full-length cloning of the PXR cDNA and promoter characterization. These studies are currently in progress in our laboratory. The effects of nonylphenol on CYP3A and CYP1A1 demonstrated in the present study may have some deleterious health consequences. Although xenobiotic- and steroid-metabolizing enzymes, such as CYP1A1 and CYP3A, protect the body against adverse effects, there may be other consequences associated with activating these systems. For example, significant induction of CYP enzymes by environmental chemicals may lead to activation of protoxicants and alteration of the metabolism of drugs and endogenous substances (59, 70-72). In summary, the present study demonstrates that an environmental pollutant with known estrogenic activities also modulates the brain steroidogenic enzymes and P450 forms involved in steroid and xenobiotic metabolism in fish and that these modulations occur at environmentally relevant concentrations, thus showing that nonylphenol modulated brain CYP3A and CYP1A1 gene expressions at relevant environmental exposure concentrations, but the mechanism(s) by which nonylphenol affected these genes needs to be studied in a differently designed study. Nevertheless, the relevance of these findings in terms of endocrine, physiological, and pharmacological consequences will depend on the environmental concentration of NP and synergistic effects with other pollutants. It should be noted that 15 µg of nonylphenol/L was demonstrated in the present study to be a critical response concentration. Substantial amounts of 9796
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 39, NO. 24, 2005
alkylpenolic chemicals enter the aquatic environment, and the major routes of entrance are through wastewater discharges into rivers and the sea and from sewage sludge. Domestic sewage effluents can contain alkylphenolic compounds up to hundreds of micrograms per liter (28, 73). In the Rhine River, Marcomini and Giger (74) have reported in the sediment surface nonylphenol, nonylphenol monoethoxylate, and nonylphenol diethoxylate dry weight concentrations of 900, 800, and 700 µg/kg, respectively. In contrast, certain types of industrial effluents, such as those originating from pulp mills and textile industries, can contain milligram per liter quantities (28). In the United Kingdom, industrial effluents contain concentrations of NP that may exceed 100 µg/L (75). In most of the rivers studied, concentrations are less than 10 µg/L (76). Finally, because the acute regulation of steroidogenesis is a fundamental mechanism involved in the biosynthesis of important biological compounds, the search for the xenoestrogen molecular target in these pathways will increase our understanding of endocrine disruption, and these studies are currently going on in our laboratory.
Acknowledgments The Norwegian Research Council (NFR) supported this study financially. The technical assistance of Anne Skjetne Mortensen and Valentina Meucci during sampling and analysis is gratefully appreciated.
Literature Cited (1) Dean, D. M.; Sanders, M. M. Ten years after: reclassification of steroid-responsive genes. Mol. Endocrinol. 1996, 10, 14891495. (2) Truss, M.; Chalepakis, G.; Pina, B.; Barettino, D.; Bruggemeier, U.; Kalff, M.; Slater, E. P.; Beato, M. Transcriptional control by steroid hormones. J. Steroid Biochem. Mol. Biol. 1992, 41, 241248. (3) Barannikova, I. A.; Dyubin, V. P.; Bayunova, L. V.; Semenkova, T. B., Steroids in the control of reproductive function in fish. Neurosci. Behav. Physiol. 2002, 32, 141-148. (4) Baulieu, E. E.; Robel, P.; Schumacher, M. Neurosteroids: beginning of the story. Int. Rev. Neurobiol. 2001, 46, 1-32. (5) Schumacher, M.; Robel, P.; Baulieu, E. E. Development and regeneration of the nervous system: a role for neurosteroids. Dev. Neurosci. 1996, 18, 6-21. (6) King, S. R.; Manna, P. R.; Ishii, T.; Syapin, P. J.; Ginsberg, S. D.; Wilson, K.; Walsh, L. P.; Parker, K. L.; Stocco, D. M.; Smith, R. G.; Lamb, D. J. An essential component in steroid synthesis, the steroidogenic acute regulatory protein, is expressed in discrete regions of the brain. J. Neurosci. 2002, 22, 10613-10620. (7) Stocco, D. M. StAR protein and the regulation of steroid hormone biosynthesis. Annu. Rev. Physiol. 2001, 63, 193-213. (8) Stocco, D. M. A StAR search: implications in controlling steroidgenesis. Biol. Reprod. 1997, 56, 328-336. (9) Stocco, D. M.; Clark, B. J.; Reinhart, A. J.; Williams, S. C.; Dyson, M.; Dassi, B.; Walsh, L. P.; Manna, P. R.; Wang, X. J.; Zeleznik, A. J.; Orly, J. Elements involved in the regulation of the StAR gene. Mol. Cell. Endocrinol. 2001, 177, 55-59. (10) Stocco, D. M. Recent advances in the role of StAR. Rev. Reprod. 1998, 3, 82-85. (11) Miller, W. L. Molecular biology of steroid hormone synthesis. Endocr. Rev. 1988, 9, 295-318. (12) Sugawara, T.; Nomura, E.; Sakuragi, N.; Fujimoto, S. The effect of the aryl hydrocarbon receptor on the human steroidogenic acute regulatory gene promoter activity. J. Steroid Biochem. Mol. Biol. 2001, 78, 253-260. (13) Walsh, L. P.; McCormick, C.; Martin, C.; Stocco, D. M. Roundup inhibits steroidogenesis by disrupting steroidogenic acute regulatory (StAR) protein expression. Environ. Health Perspect. 2000, 108, 769-776. (14) Kusakabe, M.; Kobayashi, T.; Todo, T.; Mark Lokman, P.; Nagahama, Y.; Young, G. Molecular cloning and expression during spermatogenesis of a cDNA encoding testicular 11betahydroxylase (P45011beta) in rainbow trout (Oncorhynchus mykiss). Mol. Reprod. Dev. 2002, 62, 456-469. (15) Baker, P. J.; Sha, J. A.; McBride, M. W.; Peng, L.; Payne, A. H.; O’Shaughnessy, P. J. Expression of 3beta-hydroxysteroid de-
(16) (17)
(18)
(19) (20) (21) (22) (23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32) (33)
(34)
(35)
(36)
hydrogenase type I and type VI isoforms in the mouse testis during development. Eur. J. Biochem. 1999, 260, 911-917. Hontela, A. Interrenal dysfunction in fish from contaminated sites: In vivo and in vitro assessment. Environ. Toxicol. Chem. 1998, 17, 44-48. Leblond, V. S.; Hontela, A. Effects of in vitro exposures to cadmium, mercury, zinc, and 1-(2-chlorophenyl)-1-(4-chlorophenyl)-2,2-dichloroethane on steroidogenesis by dispersed interrenal cells of rainbow trout (Oncorhynchus mykiss). Toxicol. Appl. Pharmacol. 1999, 157, 16-22. Danzo, B. J. Environmental xenobiotics may disrupt normal endocrine function by interfering with the binding of physiological ligands to steroid receptors and binding proteins. Environ. Health Perspect. 1997, 105, 294-301. Hayes, T.; Haston, K.; Tsui, M.; Hoang, A.; Haeffele, C.; Vonk, A. Herbicides: feminization of male frogs in the wild. Nature 2002, 419, 895-896. Assikis, V. J.; Buzdar, A. Recent advances in aromatase inhibitor therapy for breast cancer. Semin. Oncol. 2002, 29, 120-128. Assikis, V. J.; Simons, J. W. Novel therapeutic strategies for androgen-independent prostate cancer: an update. Semin. Oncol. 2004, 31, 26-32. Miranda, C. L.; Henderson, M. C.; Buhler, D. R. Evaluation of chemicals as inhibitors of trout cytochrome P450s. Toxicol. Appl. Pharmacol. 1998, 148, 237-244. Hegelund, T.; Ottosson, K.; Radinger, M.; Tomberg, P.; Celander, M. C. Effects of the antifungal imidazole ketoconazole on CYP1A and CYP3A in rainbow trout and killifish. Environ. Toxicol. Chem. 2004, 23, 1326-1334. Ohno, S.; Shinoda, S.; Toyoshima, S.; Nakazawa, H.; Makino, T.; Nakajin, S. Effects of flavonoid phytochemicals on cortisol production and on activities of steroidogenic enzymes in human adrenocortical H295R cells. J. Steroid Biochem. Mol. Biol. 2002, 80, 355-363. Arukwe, A.; Fo¨rlin, L.; Goksøyr, A. Xenobiotic and steroid biotransformation enzymes in Atlantic salmon (Salmo salar) liver treated with an estrogenic compound, 4-nonylphenol. Environ. Toxicol. Chem. 1997, 16, 2576-2583. Hasselberg, L.; Grosvik, B. E.; Goksoyr, A.; Celander, M. C. Interactions between xenoestrogens and ketoconazole on hepatic CYP1A and CYP3A, in juvenile Atlantic cod (Gadus morhua). Comp. Hepatol. 2005, 4, 2. Ahel, M.; Giger, W.; Schaffner, C. Behaviour of alkylphenol polyethoxylate surfacants in the aquatic environment- II. Occurrence and biotransformation in rivers. Water Res. 1994, 28, 1143-1152. Ahel, M.; Giger, W.; Koch, M. Behaviour of alkylphenol polyethoxylate surfacants in the aquatic environment- I. Occurrence and transformation in sewage treatment. Water Res. 1994, 28, 1131-1142. Segner, H.; Navas, J. M.; Schafers, C.; Wenzel, A. Potencies of estrogenic compounds in in vitro screening assays and in life cycle tests with zebrafish in vivo. Ecotoxicol. Environ. Saf. 2003, 54, 315-322. Arukwe, A.; Thibaut, R.; Ingebrigtsen, K.; Celius, T.; Goksøyr, A.; Cravedi, J. In vivo and in vitro metabolism and organ distribution of nonylphenol in Atlantic salmon (Salmo salar). Aquat. Toxicol. 2000, 49, 289-304. Kishida, M.; McLellan, M.; Miranda, J. A.; Callard, G. V. Estrogen and xenoestrogens upregulate the brain aromatase isoform (P450aromB) and perturb markers of early development in zebrafish (Danio rerio). Comp. Biochem. Physiol., B: Biochem. Mol. Biol. 2001, 129, 261-268. Shilling, A. D.; Carlson, D. B.; Williams, D. E. Rainbow trout, Oncorhynchus mykiss, as a model for aromatase inhibition. J. Steroid Biochem. Mol. Biol. 1999, 70, 89-95. Jalabert, B.; Baroiller, J.; Breton, B.; Fostier, A.; Le Gac, F.; Guiguen, Y.; Monod, G. Main neuro-endocrine, endocrine and paracrine regulations of fish reproduction, and vulnerability to xenobiotics. Ecotoxicology 2000, 9, 25-40. Monod, G.; Rime, H.; Bobe, J.; Jalabert, B. Agonistic effect of imidazole and triazole fungicides on in vitro oocyte maturation in rainbow trout (Oncorhynchus mykiss). Mar. Environ. Res. 2004, 58, 143-146. Govoroun, M.; McMeel, O. M.; D’Cotta, H.; Ricordel, M. J.; Smith, T.; Fostier, A.; Guiguen, Y. Steroid enzyme gene expressions during natural and androgen-induced gonadal differentiation in the rainbow trout, Oncorhynchus mykiss. J. Exp. Zool. 2001, 290, 558-566. Chirgwin, J. M.; Przbyla, A. E.; MacDonald, R. J.; Rutter, W. J. Isolation of biological active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 1979, 18, 5294-5299.
(37) Chomczynski, P.; Sacci, N. A single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156-159. (38) Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning, a laboratory Manual; Cold Spring Harbor Laboratory Press: Plainview, NY, 1989. (39) Arukwe, A. Complementary DNA cloning, sequence analysis and differential organ expression of beta-naphthoflavoneinducible cytochrome P4501A in Atlantic salmon (Salmo salar). Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 2002, 133, 613-624. (40) Townson, D. H.; Wang, X. J.; Keyes, P. L.; Kostyo, J. L.; Stocco, D. M. Expression of the steroidogenic acute regulatory protein in the corpus luteum of the rabbit: dependence upon the luteotropic hormone, estradiol-17 beta. Biol. Reprod. 1996, 55, 868-874. (41) Zimniak, P.; Waxman, D. J. Liver cytochrome P450 metabolism of endogenous steroid hormones, bile acids and fatty acids. In Cytochrome P450: Handbook in Experimental Pharmacology; Schenkman, J. B., Greim, H., Eds.; Springer-Verlag: Berlin, Germany, 1993; Vol. 105, pp 125-144. (42) Yokota, H.; Abe, T.; Nakai, M.; Murakami, H.; Eto, C.; Yakabe, Y. Effects of 4-tert-pentylphenol on the gene expression of P450 11beta-hydroxylase in the gonad of medaka (Oryzias latipes). Aquat. Toxicol. 2005, 71, 121-132. (43) Andersen, L.; Holbech, H.; Gessbo, A.; Norrgren, L.; Petersen, G. I. Effects of exposure to 17alpha-ethinylestradiol during early development on sexual differentiation and induction of vitellogenin in zebrafish (Danio rerio). Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 2003, 134, 365-374. (44) Smeets, J. M.; van Holsteijn, I.; Giesy, J. P.; Seinen, W.; van den Berg, M. Estrogenic potencies of several environmental pollutants, as determined by vitellogenin induction in a carp hepatocyte assay. Toxicol. Sci. 1999, 50, 206-213. (45) Islinger, M.; Pawlowski, S.; Hollert, H.; Volkl, A.; Braunbeck, T. Measurement of vitellogenin-mRNA expression in primary cultures of rainbow trout hepatocytes in a non-radioactive dot blot/RNAse protection-assay. Sci. Total Environ. 1999, 233, 109122. (46) Tong, W.; Xie, Q.; Hong, H.; Shi, L.; Fang, H.; Perkins, R. Assessment of prediction confidence and domain extrapolation of two structure-activity relationship models for predicting estrogen receptor binding activity. Environ. Health Perspect. 2004, 112, 1249-1254. (47) Ankley, G. T.; Jensen, K. M.; Kahl, M. D.; Korte, J. J.; Makynen, E. A. Description and evaluation of a short-term reproduction test with the fathead minnow (Pimephales promelas). Environ. Toxicol. Chem. 2001, 20, 1276-1290. (48) Loomis, A. K.; Thomas, P. Effects of estrogens and xenoestrogens on androgen production by Atlantic croaker testes in vitro: evidence for a nongenomic action mediated by an estrogen membrane receptor. Biol. Reprod. 2000, 62, 995-1004. (49) Goetz, F. W.; Norberg, B.; McCauley, L. A.; Iliev, D. B. Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish. Comp. Biochem. Physiol., B: Biochem. Mol. Biol. 2004, 137, 351-362. (50) Kusakabe, M.; Todo, T.; McQuillan, H. J.; Goetz, F. W.; Young, G. Characterization and expression of steroidogenic acute regulatory protein and MLN64 cDNAs in trout. Endocrinology 2002, 143, 2062-2070. (51) Walsh, L. P.; Webster, D. R.; Stocco, D. M. Dimethoate inhibits steroidogenesis by disrupting transcription of the steroidogenic acute regulatory (StAR) gene. J. Endocrinol. 2000, 167, 253263. (52) Compagnone, N. A.; Mellon, S. H. Neurosteroids: biosynthesis and function of these novel neuromodulators. Front. Neuroendocrinol. 2000, 21, 1-56. (53) Mellon, S. H.; Griffin, L. D.; Compagnone, N. A. Biosynthesis and action of neurosteroids. Brain Res. Brain Res. Rev. 2001, 37, 3-12. (54) Volz, D. C.; Bencic, D. C.; Hinton, D. E.; Law, J. M.; Kullman, S. W. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces organ- specific differential gene expression in male Japanese medaka (Oryzias latipes). Toxicol. Sci. 2005, 85, 572-584. (55) Chung-Davidson, Y. W.; Rees, C. B.; Wu, H.; Yun, S. S.; Li, W. Beta-naphthoflavone induction of CYP1A in brain of juvenile lake trout (Salvelinus namaycush Walbaum). J. Exp. Biol. 2004, 207, 1533-1542. (56) Tsutsui, K.; Ukena, K.; Usui, M.; Sakamoto, H.; Takase, M. Novel brain function: biosynthesis and actions of neurosteroids in neurons. Neurosci. Res. 2000, 36, 261-273. VOL. 39, NO. 24, 2005 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
9797
(57) Stegeman, J. J. Cytochrome P450 forms in fish. In Cytochrome P450; Schenkman, J. B., Greim, H., Eds.; Springer-Verlag: Berlin, Germany, 1993; Vol. 105, pp 279-291. (58) Andersson, T.; Fo¨rlin, L. Regulation of the cytochrome P450 enzyme system in fish. Aquat. Toxicol. 1992, 24, 1-20. (59) Stegeman, J. J.; Hahn, M. E. Biochemistry and molecular biology of monooxygenases: Current perspectives on forms, functions and regulation of Cytochrome P450 in aquatic species. In Aquatic Toxicology: Molecular, Biochemical, and Cellular Perspectives; Malins, D. C., Ostrander, G. K., Eds.; Lewis Publishers Inc.: Boca Raton, FL, 1994; pp 87-204. (60) Arukwe, A.; Goksøyr, A. Changes in three hepatic cytochrome P450 subfamilies during a reproductive cycle in Turbot (Scophthalmus maximus L.). J. Exp. Zool. 1997, 277, 313-325. (61) Navas, J. M.; Segner, H. Antiestrogenicity of beta-naphthoflavone and PAHs in cultured rainbow trout hepatocytes: evidence for a role of the arylhydrocarbon receptor. Aquat. Toxicol. 2000, 51, 79-92. (62) Chan, Z.; Hollebone, B. R. A QSAR for steroidal compound interaction with cytochrome P4501A1. Environ. Toxicol. Chem. 1995, 14, 597-603. (63) Ohtake, F.; Takeyama, K.; Matsumoto, T.; Kitagawa, H.; Yamamoto, Y.; Nohara, K.; Tohyama, C.; Krust, A.; Mimura, J.; Chambon, P.; Yanagisawa, J.; Fujii-Kuriyama, Y.; Kato, S. Modulation of oestrogen receptor signalling by association with the activated dioxin receptor. Nature 2003, 423, 545-550. (64) Maradonna, F.; Polzonetti, V.; Bandiera, S. M.; Migliarini, B.; Carnevali, O. Modulation of the hepatic CYP1A1 system in the marine fish Gobius niger, exposed to xenobiotic compounds. Environ. Sci. Technol. 2004, 38, 6277-6282. (65) Lehmann, J. M.; McKee, D. D.; Watson, M. A.; Willson, T. M.; Moore, J. T.; Kliewer, S. A. The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J. Clin. Invest. 1998, 102, 1016-1023. (66) Kliewer, S. A.; Moore, J. T.; Wade, L.; Staudinger, J. L.; Watson, M. A.; Jones, S. A.; McKee, D. D.; Oliver, B. B.; Willson, T. M.; Zetterstrom, R. H.; Perlmann, T.; Lehmann, J. M. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell 1998, 92, 73-82. (67) Staudinger, J. L.; Goodwin, B.; Jones, S. A.; Hawkins-Brown, D.; MacKenzie, K. I.; LaTour, A.; Liu, Y.; Klaassen, C. D.; Brown, K. K.; Reinhard, J.; Willson, T. M.; Koller, B. H.; Kliewer, S. A. The nuclear receptor PXR is a lithocholic acid sensor that protects
9798
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 39, NO. 24, 2005
(68)
(69)
(70)
(71) (72) (73) (74)
(75) (76)
against liver toxicity. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 33693374. Moore, L. B.; Parks, D. J.; Jones, S. A.; Bledsoe, R. K.; Consler, T. G.; Stimmel, J. B.; Goodwin, B.; Liddle, C.; Blanchard, S. G.; Willson, T. M.; Collins, J. L.; Kliewer, S. A. Orphan nuclear receptors constitutive androstane receptor and pregnane X receptor share xenobiotic and steroid ligands. J. Biol. Chem. 2000, 275, 15122-15127. Moore, L. B.; Maglich, J. M.; McKee, D. D.; Wisely, B.; Willson, T. M.; Kliewer, S. A.; Lambert, M. H.; Moore, J. T. Pregnane X receptor (PXR), constitutive androstane receptor (CAR), and benzoate X receptor (BXR) define three pharmacologically distinct classes of nuclear receptors. Mol. Endocrinol. 2002, 16, 977-986. Nelson, D. R.; Koymans, L.; Kamataki, T.; Stegeman, J. J.; Feyereisen, R.; Waxman, D. J.; Waterman, M. R.; Gotoh, O.; Coon, M. J.; Estabrook, R. W.; Gunsalus, I. C.; Nebert, D. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 1996, 6, 1-42. Guengerich, F. P. Cytochrome P450: advances and prospects. FASEB J. 1992, 6, 667-668. Guengerich, F. P. Cytochrome P-450 3A4: Regulation and role in drug metabolism. Annu. Rev. Pharmacol. Toxicol. 1999, 39, 1-17. Kvestak, R.; Terzic, S.; Ahel, M. Input and distribution of alkylphenol polyethoxylates in a stratified estuary. Mar. Chem. 1994, 46, 89-100. Marcomini, A.; Giger, W. Simultaneous determination of linear alkylbezenesulfonates, alkylphenol polyethoxylates, and nonylphenol by high-performance liquid chromatography. Anal. Chem. 1987, 59, 1709-1715. Tyler, C. R.; Jobling, S.; Sumpter, J. P. Endocrine disruption in wildlife: a critical review of the evidence. Crit. Rev. Toxicol. 1998, 28, 319-361. Blackburn, M. A.; Waldock, M. J. Concentrations of alkylphenols in rivers and estuaries in England and Wales. Water Res. 1995, 29, 1623-1629.
Received for review May 27, 2005. Revised manuscript received October 4, 2005. Accepted October 6, 2005. ES0509937
