Multiplexed CRISPR-Cpf1-Mediated Genome Editing in Clostridium

Jun 4, 2018 - The availability of an efficient genome editing tool for C. difficile is essential ... Furthermore, we were able to delete an extremely ...
0 downloads 0 Views 5MB Size
Download PDF
Research Article Cite This: ACS Synth. Biol. XXXX, XXX, XXX−XXX

pubs.acs.org/synthbio

Multiplexed CRISPR-Cpf1-Mediated Genome Editing in Clostridium diff icile toward the Understanding of Pathogenesis of C. dif ficile Infection Wei Hong,†,‡,§,# Jie Zhang,†,# Guzhen Cui,∥ Luxin Wang,⊥ and Yi Wang*,† †

Department of Biosystems Engineering, and ⊥Department of Animal Sciences, Auburn University, Auburn, Alabama 36849, United States ‡ Key Laboratory of Endemic and Ethnic Diseases of the Ministry of Education, §Key Laboratory of Medical Molecular Biology, and ∥ Key Laboratory of Medical Microbiology and Parasitology, Guizhou Medical University, Ministry of Education, Guiyang, Guizhou Province, China S Supporting Information *

ABSTRACT: Clostridium dif f icile is often the primary cause of nosocomial diarrhea, leading to thousands of deaths annually worldwide. The availability of an efficient genome editing tool for C. dif f icile is essential to understanding its pathogenic mechanism and physiological behavior. Although CRISPR-Cas9 has been extensively employed for genome engineering in various organisms, large gene deletion and multiplex genome editing is still challenging in microorganisms with underdeveloped genetic engineering tools. Here, we describe a streamlined CRISPR-Cpf1-based toolkit to achieve precise deletions of f ur, tetM, and ermB1/2 in C. dif f icile with high efficiencies. All of these genes are relevant to important phenotypes (including iron uptake, antibiotics resistance, and toxin production) as related to the pathogenesis of C. dif f icile infection (CDI). Furthermore, we were able to delete an extremely large locus of 49.2-kb comprising a phage genome (phiCD630-2) and realized multiplex genome editing in a single conjugation with high efficiencies (simultaneous deletion of cwp66 and tcdA). Our work highlighted the first application of CRISPR-Cpf1 for multiplexed genome editing and extremely large gene deletion in C. dif ficile, which are both crucial for understanding the pathogenic mechanism of C. dif f icile and developing strategies to fight against CDI. In addition, for the DNA cloning, we developed a one-step-assembly protocol along with a Python-based algorithm for automatic primer design, shortening the time for plasmid construction to half that of conventional procedures. The approaches we developed herein are easily and broadly applicable to other microorganisms. Our results provide valuable guidance for establishing CRISPR-Cpf1 as a versatile genome engineering tool in prokaryotic cells. KEYWORDS: CRISPR-Cpf1, CRISPR-Cas9, Clostridium dif f icile, multiplex genome editing, large fragment deletion, one-step-assembly (OSA)

addtion, an allelic exchange-based method has been developed based on a ΔpyrEΔermB mutant, and used to generate in-frame deletions of spo0A, cwp84, mtlD, tcdC and the PaLoc gene locus/loci.9−11 However, these traditional methods have various limitations that prevent them from broader applications. For example, the gene disruption by insertion of mobile elements could lead to polar effects10 and conditional mutants, which might reverse back to the wild-type (WT) genotype.7,8,12 Genome manipulation based on count-selection markers (such as pyrF) is usually highly laborious and restricted by the availability of selection markers.13,14 Additional work is needed to restore the auxotrophic feature of the “mother” strain to the native genotypic status.11 Furthermore, it is almost impossible

Clostridium dif f icile, recently reclassified as Clostridioides dif f icile,1 is a Gram-positive, anaerobic, endospore-forming bacterium which belongs to the phylum of Firmicutes. It is notorious as a human pathogen that can often cause the antibiotic-associated diarrhea.2,3 Recently, this life-threatening emerging pathogen has become the leading cause of nosocomial diarrhea, with numerous outbreaks reported worldwide.4−6 The clinical symptoms of C. dif ficile infection (CDI) range from mild diarrhea to pseudomembranous colitis and potentially death. To understand the pathogenic mechanism of CDI through the creation of designated genetic mutants and further develop strategies for CDI control and treatment, the development of efficient and easily implementable genetic engineering tools is highly desired. Previously, a Group II intron-based genetic engineering system, also known as ClosTron, has been most commonly used in C. dif f icile.7,8 In © XXXX American Chemical Society

Received: February 25, 2018

A

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology

Figure 1. Schematic overview of CRISPR-Cpf1-RNP-mediated genome editing in C. dif f icile. (a) To edit the C. dif f icile genome, the plasmid containing iLacP::Cpf1, sRNAP::crRNA, and Up-arm::Down-arm cassettes is conjugated into C. dif f icile 630 cells. (b) The active Cpf1-crRNA RNP complex is formed after induction with lactose. (c) The mature RNP complex recognizes the specific DNA target and induces double-strandbreakage (DSB) on the DNA in a staggered manner. The edited cells undergo homologous recombination (HR) between gene-targeting plasmid (Up-arm::Down-arm region) and the cell genome to survive, thus desirable mutation is introduced into C. dif f icile. However, the DSB caused by CRISPR-Cpf1 is lethal to the unedited cells which are killed during this process. The Protospacer Adjacent Motif (PAM) sequence is indicated in magenta letters (“TTTN”, N = A/T/G/C). The double lines indicate the C. dif f icile genome. The staggered-cutting sites for the Cpf1/crRNA RNP complex are indicated by magenta scissors. (d) The nucleotide composition and secondary structure of the precursor crRNA (pre-crRNA).

to achieve both highly efficient and “clean” genome editing using any of these traditional methods. Recently, the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins have been explored as a powerful genome editing tool in various organisms, including bacteria,15 yeast,16 plants,17 and mammals.18 CRISPR-Cas systems can be classified into two classes and six types based on the features of the Cas protein and the CRISPR-Cas loci.19 Among them, the type II CRISPR-Cas9 system derived from Streptococcus pyogenes has been extensively employed to achieve various genome editing purposes,20 as well as transcriptional regulation.21 In this system, the CRISPR RNA (crRNA) and the trans-activating crRNA (tracrRNA) hybridizes and then combines with the Cas9 protein to form a ribonucleoprotein (RNP) complex, which recognizes the target site of the DNA based on the protospacer adjacent motif (PAM) sequence and induces bluntended double strand breakage (DSB). Thus, desirable genome editing can be achieved through either the nonhomologous end joining (NHEJ) or the homology directed repair (HDR) mechanisms.22 To circumvent the complexity of expressing both crRNA and tracrRNA to form the RNP complex, a simplified system was developed, in which crRNA and tracrRNA were reprogrammed to a single chimeric guide RNA (gRNA) that is smaller in size and thus could be easily

assembled and expressed for targeted genome editing purposes.18 Although numerous successes for genome editing using CRISPR-Cas9 have been achieved in various organisms, the development of customized CRISPR-Cas9 system that is functional in a new host strain is not trivial, especially for those without efficient NHEJ and homologous recombination mechanisms available.23 In many cases, the high toxicity of CRISPR-Cas9 led to very low efficiency of conjugation or even unsuccessful conjugation, impeding the acquisition of desirable mutants. On the other hand, technically, multiplex genome editing could be achieved using the CRISPR-Cas9 system with the expression of multiple gRNAs; however, a relatively large and complex construct (or the simultaneous delivery of multiple plasmids) is needed, making it complicated and difficult for the plasmid construction and conjugation.24−28 Very recently, McAllister et al. had generated a selD mutant of C. dif f icile using a CRISPR-Cas9-assisted genome engineering approach.29 However, versatile genome editing including deletion of large gene fragments and simultaneous multiplex genome engineering has not been demonstrated and could be still challenging. Previously, our lab has developed customized CRISPR-Cas9-based genome editing tools that work efficiently in several nonpathogenic solventogenic clostridial species.20,30,31 Further, we attempted to implement such tools for genome engineering in C. dif f icile. Although limited success B

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology

Figure 2. The configuration and construction of pWH34, pWH41S, and pWH41. (a) Universal chassis plasmid pWH34 was constructed to facilitate the construction of a series of gene-targeting plasmids. pWH34 is an assembly of the following fragments: (i) NdeI-linearized pMTL82151 plasmid as backbone (pBP1 replicon, CatP marker, ColE1+tra Gram-negative replicon and MCS); (ii) Cpf1 coding sequence driven by a lactose inducible promoter (iLacP::Cpf1); (iii) thiolase terminator from C. beijerinckii; and (iv) an 40-bp synthetic DNA fragment containing two oppositely oriented BtgZI sites. (b) The pWH41S plasmid is a derivative of pWH34, containing a sRNAP-driven precursor crRNA (sRNAP::crRNA) that has been inserted between the two BtgZI sites. (c) The pWH41 plasmid is a derivative of pWH34, targeting the 390-bp ferric uptake regulator ( fur) gene (CD630_08260) of C. dif f icile 630. (d) A schematic representation of the one-step-assembly (OSA) approach. Briefly, the f ur specific sRNAP::crRNA-f ur, the two ∼500-bp f ur-Up-arm and f ur-Down-arm (flanking the f ur gene) were assembled with the BtgZI-linearized pWH34 in one step to generate pWH41. This can be achieved within two days, which is considerably faster than the conventional two-step approach for constructing the CRISPR-Cas9 plasmids (assembling gRNA and homology arms in two steps, which needs at least four days, Figure S1). (e) The Cpf1 nuclease processes the precursor crRNA (pre-crRNA) into a mature crRNA and then form a Cpf1-crRNA RNP complex, which introduces DSB in the host genome.

has been achieved,28 there are still issues making the performance of the tool unsatisfying. Particularly, in many cases the conjugation efficiency of the CRISPR-Cas9 plasmid is extremely low (e.g., multiple conjugation trials are often necessary in order to obtain desirable transconjugants). This inefficiency is likely due to the high toxicity of the Cas9 endonuclease activity.32 In addition, attempts to delete large gene fragments (>4.5 kb) were consistently unsuccessful. Similar to CRISPR-Cas9, CRISPR-Cpf1 is an endonucleasebased immune system that has been recently explored for genome engineering purposes.33 Compared to CRISPR-Cas9 however, the CRISPR-Cpf1 system has several distinctive features: (i) The Cpf1 nuclease is guided by a single crRNA to target the DNA locus, and no tracrRNA is needed (Figure 1b− d); (ii) The Cpf1 protein recognizes a T-rich PAM sequence (5′-TTTN-3′) located at the 5′-end of the target DNA sequence (Figure 1c); (iii) Cleavage by the CRISPR-Cpf1

RNP complex is staggered, creating a 5-nt 5′ overhang that is 18−23 bp away from the PAM site (Figure 1c).34 In addition, it has been reported that Cpf1 likely has lower toxicity,32 and lower off-target effects than Cas9 for genome editing.35 Recently, the CRISPR-Cpf1 system has been engineered as a robust genome-editing tool which has been applied to various eukaryotic and prokaryotic organisms, including rice,36 soybean,37 mouse,38 zebrafish,39 human cell,35 Escherichia coli, Yersinia pestis, Mycobacterium smegmatic,40 and Corynebacterium glutamicum.32 However, compare to the case in eukaryotic systems, the full potential of the CRISPR-Cpf1 system for genome editing in prokaryotic cells has not been well established for large gene deletion and multiplex genome editing. On the basis of the distinct features of CRISPR-Cpf1 when compared to CRISPR-Cas9 as discussed above, we rationally conjectured that CRISPR-Cpf1 would be a more suitable and easily programmable tool for efficient genome C

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology

Figure 3. Conjugation efficiencies and the effects of different combinations of Cpf1, rRNA, and arms on C. dif f icile growth. (a) Conjugation efficiencies of Cpf1-expressing plasmids, with or without combined expression of the f ur-targeting pre-crRNA. (b) The effects of different combinations of Cpf1, rRNA, and arms on C. dif f icile growth. The strains were pMTL82151, C. dif f icile 630 harboring pMTL82151 as negative control; pWH34, C. dif f icile 630 harboring pWH34 (contains iLacP::AsCpf1); pWH41S, C. dif f icile 630 harboring pWH41S (contains iLacP::AsCpf1 and sRNAP::crRNA-f ur); pWH41, C. dif f icile 630 harboring pWH41 (contains iLacP::AsCpf1, sRNAP::crRNA-fur, and two ∼500-bp homology arms flanking f ur); pWH79, C. dif f icile 630 harboring pWH79 (contains iLacP::AsCpf1, sRNAP::crRNA-cwp66::crRNA-tcdA, two ∼500bp homology arms flanking cwp66 and two ∼500-bp homology arms flanking tcdA). Experiments were carried out in duplicates. The error bar represents mean ± standard deviation. Conjugation efficiencies and CFU of experimental strains were compared to the control group using a twotailed unpaired t test (n = 2 per group). The significance levels of different groups for comparison are indicated as follows: ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; n.s., not significant.

engineering in microbial hosts such as C. dif f icile which have naturally low DNA conjugation efficiencies. Therefore, in the present work, we developed a streamlined CRISPR-Cpf1-based toolkit for genome engineering in C. dif f icile and demonstrate the application of CRISPR-Cpf1 in a microorganism that is generally recalcitrant to be genetically engineered. We applied the developed CRISPR-Cpf1 system to achieve the deletion of single genes of various sizes (including the deletion of an extremely large gene locus of ∼49.2 kb), and also multiplex genome editing through a single conjugation, all with high efficiencies. Furthermore, for the DNA cloning work, we established a one-step plasmid construction method (onestep-assembly, OSA), in which a new CRISPR-Cpf1 plasmid for genome editing can be obtained within two days by assembling all the component fragments into the chassis plasmid in a single step. Moreover, a Python-based algorithm was developed to have the required primers designed within seconds in a highly semiautomatic fashion. Altogether, these make the implementation of the CRISPR-Cpf1 system developed in this study highly streamlined and efficient and easily applicable to diverse microorganisms.

the corresponding crRNA. We constructed pWH34, pWH41S, and pWH41 (Figure 2a−c) and conjugated them into C. dif f icile 630. The conjugation efficiency of pWH41S and pWH41 (both targeting on f ur; pWH41 contains the homology arms for f ur deletion, while pWH41S does not contain these homology arms) was 0.77 × 102 and 0.69 × 102 CFU/mLdonor (CFU: colony forming unit), respectively, both of which were ∼6 times lower than that of the control plasmid pMTL82151 (4.60 × 102 CFU/mL-donor). Whereas, the conjugation efficiency of pWH34, containing only iLacP::Cpf1 (but not the gene-targeting crRNA), was comparable to pMTL82151 (3.76 × 102 CFU/mL-donor, Figure 3a). These results suggested that (i) Cpf1 can be successfully expressed with the iLacP promoter (with the leakage of iLacP promoter, a weak expression of Cpf1 was obtained);41 (ii) the combined functionality of Cpf1 and crRNA led to significantly decreased conjugation efficiency. To further test the functionality of Cpf1 with the induction of iLacP using lactose, we spread the serially diluted C. dif f icile cultures (containing pMTL82151, pWH34, pWH41S, and pWH41, respectively; OD600 = 0.6−0.8) on both BHIS and BHISL-Tm plates. After 36 h of incubation, CFUs on BHIS and BHISL plates were comparable for both pMTL82151-harboring (2.08 × 108 vs 1.90 × 108) and pWH34-harboring (1.59 × 108 vs 1.48 × 108) transconjugants. Whereas, CFUs of pWH41Sand pWH41-harboring transconjugants on BHISL-Tm plates decreased ∼46 and ∼4 times, respectively, compared to CFUs on BHIS plates (Figure 3b). These results indicated that the expression of Cpf1 was increased after induction with lactose,

■

RESULTS AND DISCUSSION Expression and Functionality of Cpf1 in C. dif f icile. In the previous report, we successfully adapted the lactose inducible promoter (iLacP) and small RNA promoter (sRNAP) to drive the expression of Cas9 and gRNA, respectively.20 Thus, in this study, we set out to use iLacP and sRNAP, respectively, to drive the expression of Cpf1 and D

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology

Figure 4. Screening of mutants during CRISPR-Cpf1 based genome editing in C. dif f icile. (a) Schematic representation of the deletion of six genes from C. dif f icile 630 chromosome. The chromosome is indicated by the double line, and the ORF of the target gene is represented by an open arrow or open box (for phiCD630-2), whose direction indicates whether the ORF is located on the positive (5′ to 3′) or negative (3′ to 5′) DNA strand. Other genes surrounding the target gene are indicated by black arrows. The protospacers which have been chosen as targets are roughly indicated by magenta scissors. The binding sites and orientations of primers are indicated by horizontal half arrows. Generally, the binding sites are located outside the upstream or downstream of the homologous recombination region of the target gene for the detection primers (external primers). For the detection of phiCD630-2 deletion, an additional internal primer (green arrow) annealing to the sense strand of CD630_29521 locus was also designed. Along with the primer on the left, a ∼ 1.2-kb PCR product will be generated if phiCD630-2 is intact. The expected size (kb) of the PCR product obtained with the external primers for the WT and the edited gene (Mutant) is illustrated to the right. (b) Confirmation of the gene deletion using colony PCR. Lane M, the 1-kb DNA marker from NEB with numbers on the left representing the band size in kb; Lane 1, PCR amplification with the WT genomic DNA (gDNA) using external primers; Lane 2, PCR amplification with the Mutant gDNA using external primers; Lane 3, for the detection of phiCD630-2 deletion, amplification with the WT gDNA using the external primer on the left and the internal primer (green arrow in Figure 4a); Lane 4, for the detection of phiCD630-2 deletion, amplification with the Mutant gDNA using the external primer on the left and the internal primer (green arrow in Figure 4a).

and thus introduced more DSB to the C. dif f icile genome. The DSB was lethal to the host cells, especially when homology arms were unavailable (the CFU of pWH41S-harboring transconjugants decreased by ∼46 times after the induction of Cpf1 expression). Whereas, the expression of Cpf1 alone (even with induction) was only slightly toxic to the host cells

(pWH34-harboring transconjugants had a comparable CFU to pMTL82151-harboring transconjugants on BHISL-Tm plates). In eukaryotic systems, the highly efficient NHEJ mechanism can help repair the DSB induced by the nuclease (such as Cas9 or Cpf1). Thus, the cells can survive, sometimes with mutations created at the DSB site. However, most prokaryotic cells lack the NHEJ mechanism, or the NHEJ is not efficient enough for E

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology Table 1. Summary of the Genome Editing in C. dif f icile Using the CRISPR-Cpf1 System gene-targeting plasmids

targeted gene

pMTL82151 pWH41 pWH55 pWH74 pWH75

f ur cwp66 tetM ermB1/2

pJZ173

cwp66 tcdA phiCD630-2

pJZ174

phiCD630-2

pWH79

a

target locus/loci

PAM

protospacer (5′−3)

gene length (bp)

CD630_08260 CD630_27890 CD630_05080 CD630_20070 CD630_20080 CD630_20100 CD630_27890 CD630_06630 CD630_28890-to CD630_29520 CD630_28890 to CD630_29520

TTTA TTTA TTTG TTTT

GCTCAGCTAACGGAACATGGCTT GCAGTGGGTGTATTAGCAGCTAA CGGGATTCGGTTAGAATATCGGA GAAAGCCGTGCGTCTGACATCTA

390 1833 1920 3145

TTTA TTTA TTTT

GCAGTGGGTGTATTAGCAGCTAA AGTACCTCAGTTAAGGTTCAACT TACATCAAGCTCAAAGTCACTCC

1833 8133 49177

0.26 ± 0.05 1.82 ± 0.10

100 25 37.5

TTTT TTTT

TACATCAAGCTCAAAGTCACTCC GTAACCTATGGGAATTGTACCAC

49177

0.40 ± 0.05

58.3

conjugation efficiency (102 × CFU/mL-donor)a

gene editing efficiency (%)

4.6 ± 0.01 0.69 ± 0.05 2.11 ± 0.10 1.60 ± 0.20 1.86 ± 0.15

100 100 77.5 25

Values are average ± standard deviation based on at least two independent replicates.

resistance protein, which could confer the tetracycline resistance in C. dif f icile. There are two ermB genes in C. dif f icile, ermB1 (CD630_20070), and ermB2 (CD630_20100). According to the previous report,45 ermB2 is the determinant for erythromycin resistance in C. dif f icile. However, the ermB2 inactivation mutant strain could recover the erythromycin resistance at a frequency of 2.7 × 10−8.45 In addition, the coding sequence of ermB1 and ermB2 are exactly the same. Therefore, both ermB1 and ermB2 might contribute to erythromycin resistance in C. dif f icile. In the interest of constructing an erythromycin-sensitive mutant with a “clean” genetic background, we decided to delete the whole ermB1/2 gene cluster (including the 897-bp CD630_20080, which is annotated as a putative hydrolase gene) from C. dif f icile 630 (Figure 4a). Plasmids pWH74 and pWH75 were conjugated to C. dif f icile 630, with efficiencies of 1.60 × 102 CFU/mL-donor and 1.86 × 102 CFU/mL-donor, respectively (Table 1). Following cultivation and lactose induction, cPCR was carried out as described above. Sixteen out of 16 (100%) and four out of 16 (25%) colonies were confirmed as positive mutants for tetM and ermB1/2, respectively (Figure 4,b). Comparatively, the genome editing efficiency decreased with the increase of the size of the gene fragment to be deleted (Table 1). However, the efficiency (for example, in the case of ermB1/2 deletion) is still sufficient to ensure reliable genome editing for such cases. Application of CRISPR-Cpf1 for the Deletion of Extremely Large Gene Fragment. In the previous study, we employed the CRISPR-Cas9 system to obtain gene deletions up to ∼4500 bp at efficiencies of 20%−100% in Clostridium species, including C. dif f icile.17,20,28,31 However, several attempts for the deletion of even larger gene fragments using CRISPR-Cas9 were unsuccessful. Particularly, on the basis of our experiences, to create a clean deletion up to 8000 bp in Clostridium using CRISPR-Cas9 would be extremely difficult.28 The possible reasons include: (i) the Cas9 protein is highly toxic to the host strain (likely more toxic than Cpf1);32 (ii) Cas9-harboring plasmid is usually large (∼14.7 kb for Cas9 construct while ∼12.2 kb for Cpf1 counterpart) and thus has a relatively low conjugation efficiency.32 Recently, up to 7.5-kb and 30-kb gene fragments have been deleted in Streptomyces and Corynebacterium glutamicum, using the CRISPR-Cpf1 system32 and a modified CRISPR-Cas system,42 respectively. Here, we demonstrate successful deletion of the 49.2-kb

the DSB repairing. Thus, the prokaryotic cells will die because of the DSB on the chromosome.20,32 Such lethality of CRISPRCas9 and CRISPR-Cpf1 systems to bacterial strains has been previously reported by various researchers.15,32,42,43 As a prokaryote, C. dif f icile does not have the endogenous capability to repair DSB, and thus the DSB induced by CRISPR-Cpf1 will lead to cell death. Accordingly, transformation of the functional CRISPR-Cpf1 system (within pWH41S, pWH41, and pWH79) into C. dif ficile affected the survival of the host cells, causing transformation efficiency to drop sharply. Taken together, we concluded that the CRISPR-Cpf1 system was highly functional in C. dif ficile; meanwhile, the mild toxicity (as compared to CRISPR-Cas9) might be advantageous for achieving high conjugation efficiency and genome editing success rate (as we demonstrated below). Achieve Genome Editing in C. dif f icile through Inducible Expression of Cpf1. The f ur gene (Figure 4a, Table 1) was selected as our first target to delete. This is for two reasons: (i) f ur is not essential to C. dif f icile, as it has been previously disrupted with the ClosTron technology;44 (ii) the coding sequence of f ur is short (only 390 bp), which is expected to be easy to manipulate. The transconjugants of pWH41 were picked, inoculated into 1 mL of BHIS-Tm medium, and incubated anaerobically at 37 °C overnight. Then the culture was spread onto BHISL-Tm plates. Sixteen colonies were randomly picked for cPCR to screen for mutants. All the colonies (16/16) were confirmed as the positive mutant with f ur successfully deleted (Figures 4b and 5a). Therefore, C. dif f icile genome editing was successfully achieved with the inducible expression of Cpf1 and constitutive expression of the corresponding crRNA (Figure 5a). The f ur-targeting CRISPRCpf1 selected out of the pool of transconjugants in favor of the mutant against the unedited background cells.20 A mutation rate of 100% was achieved. Finally, the plasmid was cured, with a plasmid curing efficiency of 40%. Application of CRISPR-Cpf1 for the Deletion of Larger Gene Fragments. We successfully achieved the deletion of f ur gene, which is only 390 bp, with a very high efficiency. Next, we attempted to delete larger gene fragments, to further explore the robustness of the CRISPR-Cpf1 system. The tetM (CD630_05080) gene and the ermB1-ermB2 (ermB1/2) gene cluster (CD630_20070, CD630_20100), which are encoded by 1920-bp and 3145-bp nucleotides, respectively, were selected as the targets (Figure 4a). The tetM gene encodes a tetracycline F

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology

Figure 5. Single and Multiplex genome editing in C. dif ficile 630 using the CRISPR-Cpf1 system. (a) Schematic representation of the workflow for f ur deletion. The Δf ur mutant was obtained in two steps. First, transconjugants containing pWH41 were propagated in BHIS-Tm liquid medium. Second, after OD600 of the culture reached 0.8, cells were serial diluted and 100 μL of aliquot was plated on BHISL-Tm plate, to induce the Cpf1 expression. The Cpf1-crRNA RNP complex recognized the targeting site within f ur and induced DSB in the unedited cells, thus selecting the mutant cells with f ur deleted (achieved by double crossover event prior to the selection). A pair of half arrows represent the primers used for the PCR for the detection of gene deletion. (b) Schematic representation of the workflow for cwp66 and tcdA double deletion. The screening procedure for the double deletion mutant was similar to that for the single deletion (Figure 5a), except that a series of transferring of the culture in the BHISL-Tm liquid medium needs to be carried out before the plating. Pairs of half arrows represent the primers used for the PCR for the detection of gene deletion. The detection of gene deletion occurred at the 1st and 15th transfers, for cwp66 and tcdA, respectively. (c) Sixteen colonies were picked and screened for mutations. The open rectangle, light green rectangle, and dark green rectangle represent the WT strain, the single deletion mutant of Δcwp66 or ΔtcdA, and the Δcwp66ΔtcdA double deletion mutant, respectively.

phiCD630-2 locus in C. dif f icile using our newly optimized CRISPR-Cpf1 system. The C. dif f icile 630 genome harbors two phage loci with high similarity (CD630_09040−09790 and CD630_28890−29520). The encoding sequence of phiCD630-1 (CD630_09040− 09790) and phiCD630-2 (CD630_28890−29520) is 55581 bp and 49177 bp, respectively.46 The identity between the two

sequences is 87%, with nearly 32 kb being identical. Initially, we attempted to delete both phiCD630-1 and phiCD630-2. However, despite multiple attempts, the homology arms for phiCD630-1 deletion failed to be amplified. Fortunately, we were able to construct the plasmids with three different designs for deletion of phiCD630-2 (pJZ173 and pJZ174 harboring CRISPR-Cpf1, and pJZ180 harboring CRISPR-Cas9; two G

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology

Figure 6. Minimum Inhibitory Concentrations (MICs) of various antibiotics to C. dif f icile strains. (a) The WT strain was resistant to erythromycin, clarithromycin, and tetracycline. (b) The ΔtetM mutant was susceptible to tetracycline (MIC: 3.2 μg/mL). (c) The ΔermB1/2 was susceptible to erythromycin (MIC: 0.8 μg/mL) and clarithromycin (0.4 μg/mL). (d) The ΔermB1/2ΔtetM mutant was susceptible to erythromycin (MIC: 0.8 μg/ mL), clarithromycin (MIC: 0.2 μg/mL), and tetracycline (MIC: 3.2 μg/mL). Broth dilution tests were carried out to determine the MICs of various antibiotics to the mutants. The seed culture (at OD600 of ∼0.6 to 0.8) was inoculated to different media at a 2.5% inoculum ratio. BHIS-Erm, BHISTet, and BHIS-Cla represents the BHIS liquid medium supplemented with erythromycin, tetracycline, and clarithromycin, respectively.

opens the question for us that whether the deletion of an “extremely” large gene fragment in C. dif f icile (and broadly in Clostridium species) is achievable. In this study, the phiCD630-2 gene of ∼49.2 kb in C. dif f icile was successfully deleted using the CRISPR-Cpf1 system, whereas the corresponding construct with CRISPR-Cas9 cannot be conjugated. The possible reasons for such difference are: (i) Cpf1 is likely less toxic than Cas9 to the host cells;32 (ii) the coding sequence for Cpf1 is shorter than that for Cas9,33 and thus the overall CRISPR-Cpf1 plasmid is generally smaller than CRISPR-Cas9 plasmid, and the conjugation is therefore easier. The capability to edit large gene locus/loci is the premise for advanced genome editing, which will further help us understand the underlying pathogenic mechanism of C. dif f icile and develop strategies to fight against CDI. Application of CRISPR-Cpf1 for Multiplex Genome Editing in a Single Step. The functionality of CRISPR-Cas9 necessitates both crRNA and tracrRNA (or the chimera gRNA) to guide the CRISPR-Cas9 RNP complex to target the specific gene sequence.48 Thus, it requires relatively larger and more complex constructs or the delivery of multiple plasmids at the same time.49 By contrast, the functionality of CRISPR-Cpf1 requires only one short crRNA (43 nt per crRNA), and no tracrRNA is needed (Figure 1).50 With this advantage, CRISPR-Cpf1 can be easily adopted for multiplex gene editing by incorporating multiple crRNAs insulated by the “repeat” sequences, as demonstrated recently in mammalian cells, plants,

spacers were included in pJZ174 aiming to enhance DSB and thus improve gene editing efficiency) (Figure 4a). Conjugation efficiencies of 1.82 × 102 and 0.40 × 102 CFU/mL-donor were achieved for pJZ173 and pJZ174, respectively, while pJZ180 failed to be conjugated in spite of numerous attempts. Following similar procedures as described above, cPCR results demonstrated that genome editing efficiencies of 37.5% (9/24) and 58.3% (14/24) were obtained for the conjugation with pJZ173 and pJZ174, respectively. These results suggested that with two spacers, pJZ174 can help achieve higher genome editing efficiency, albeit at a lower initial conjugation efficiency. These results suggest that CRISPR-Cpf1 is indeed more applicable and powerful than CRISPR-Cas9, especially for large gene deletions. To our best knowledge, this is the largest gene fragment that has ever been deleted in C. dif f icile (and Clostridium species). In previous research, we achieved versatile genome editing using CRISPR-Cas9 in various Clostridium species, including C. beijerinckii,20 C. saccharoperbutylacetonicum,30 and C. dif f icile;28 with the CRISPR-Cas9 system, the largest gene fragment we have deleted in Clostridium was shorter than 4,500 bp.17,20,31,47 However, many attempts for the deletion of larger gene fragments/loci (tcdA, phiCD630-2) in C. dif f icile with the CRISPR-Cas9 system failed.28 Recently, large gene fragments of up to 30 kb and 7.5 kb have been deleted in Streptomyces and Corynebacterium glutamicum, by using an engineered CRISPRCas system42 and a CRISPR-Cpf1 system,32 respectively. This H

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology

ΔermBΔtetM mutant could serve as a valuable chassis strain for comprehensive gene manipulation (with multiple applicable antibiotics markers). Another advantage of the CRISPR-Cpf1 system by using the small crRNA for targeting is that the whole crRNA sequence can be easily included in a PCR primer, making changes to the target sequence easy to achieve. Along with the developed OPF program for primer design and the OSA protocol, a CRISPRCpf1 plasmid for manipulation of a specific gene can be easily constructed within 2 days (Figure 2d and Supporting Information, Figure S1). Comparatively, for the construction of the CRISPR-Cas9 plasmid using the “conventional” protocol in our lab, the gRNA and homology arms need to be assembled in two separate steps, which takes twice as long and is more error prone.28 In addition, the OPF can help select the most appropriate target sites/sequences based on the GC content and other criteria and design the corresponding primers in seconds. Taken together, our developed protocol for genome engineering with the CRISPR-Cpf1 system is highly streamlined and broadly applicable. Characterization of the Antibiotic Susceptibility in the Relevant Mutants. Antibiotics susceptibility testing was carried out to characterize the relevant mutants generated above. As expected, the ΔermB1/2 mutant could not form any colonies on BHIS-Erm plates, although the WT strain can grow on both BHIS-Erm and BHIS-Tet plates (Figure S3). The ΔtetM mutant was unable to grow on the BHIS-TetR plate, which suggested that gene CD630_05080 confers tetracycline resistance in C. dif f icile 630. Furthermore, the ΔermB1/2ΔtetM double deletion mutant could neither grow on BHIS-TetR nor BHIS-Erm plates, confirming its sensitivity to both antibiotics (Figure S3). Broth dilution tests were carried out to determine the MICs of the antibiotics for the relevant mutants. The WT C. dif f icile 630 strain was resistant to erythromycin, tetracycline, and clarithromycin (Figure 6a). However, the ΔtetM and ΔermB1/ 2 mutants were highly susceptible to tetracycline (MIC: 3.2 μg/ mL) and erythromycin (MIC: 0.8 μg/mL), respectively (Figure Figure 6b,c). As erythromycin and clarithromycin are both macrolide antibiotics and the resistance to these two antibiotics is conferred by the same gene,57 the ΔermB1/2 mutant was also evaluated and confirmed for its susceptibility to clarithromycin at an MIC of 0.4 μg/mL (Figure 6c). As expected, the ΔermB1/2ΔtetM mutant was susceptible to erythromycin (MIC: 0.8 μg/mL), clarithromycin (MIC: 0.2 μg/mL), and tetracycline (MIC: 3.2 μg/mL) (Figure 6d). As a notorious human pathogen, C. dif f icile is naturally resistant to various antibiotics, including for example erythromycin and tetracycline. The widely used erythromycin-sensitive derivative of C. dif f icile 630 (630Δerm) was obtained through spontaneous mutagenesis; the genome of the mutant contains 71 differences from C. dif f icile 630.45,58 To construct an erythromycin-sensitive mutant with “clean” genetic background, we deleted the whole ermB1/2 gene cluster; the ΔermB1/2 mutant would be a better chassis strain with more defined genetic background than C. dif f icile 630Δerm for future genetic manipulation. On the other hand, the previous effort to isolate a spontaneous C. dif ficile mutant sensitive to tetracycline failed.45 The CD630_05080 gene (tetM) is annotated to encode a tetracycline resistance protein, which we hypothesized as the tetracycline-resistance determinant in C. dif f icile. Using the CRISPR-Cpf1 system, we constructed a clean ΔtetM mutant for the first time. As

and bacteria.32,36,37 In addition, as described above, the twospacer-harboring pJZ174 had a higher efficiency for phiCD6302 deletion than the one-spacer-harboring pJZ173, implying that multiple spacers can work properly in C. dif f icile. Therefore, we further explored the potential of CRISPR-Cpf1 for multiplex gene editing through a single conjugation, by deleting cwp66 and tcdA simultaneously (Figure 4a,b). The cwp66 gene has been shown to encode an adhesion protein in C. dif f icile.51 A cwp66 knockdown mutant has been generated previously with antisense RNA technology.52 The tcdA gene along with the tcdB gene are major toxin genes in C. dif f icile. A tcdA negative mutant has been generated previously using ClosTron technology. 53 In this study, the plasmid pWH79 was constructed and transformed (Figure 5b) with a conjugation efficiency of 0.16 × 102 CFU/mL-donor, which is ∼98 times lower than the pMTL82151 plasmid (Figure 3b). Through the cultivation and screening as described above, cPCR results demonstrated that 25% (4/16) of colonies had the Δcwp66ΔtcdA double deletion, whereas all the test colonies (16/16) had the cwp66 gene deleted (Figures 4b, 5b, and 5c). To date, the CRISPR-Cas9 system has been broadly employed for genome editing in various eukaryotic and prokaryotic hosts,18,54 the functionality of CRISPR-Cas9 requires both crRNA and tracrRNA (or a chimera gRNA) to guide the CRISPR-Cas9 RNP complex to target a specific gene.48 In contrast, one single crRNA is sufficient to guide CRISPR-Cpf1 RNP to a gene target (Figure 1).50 By taking advantage of this feature, we achieved multiplex-gene editing in C. dif f icile using one single CRISPR-Cpf1 construct by consolidating two sets of gene-targeting elements in one vector. One potential application of this system is for the simultaneous manipulation of genes that are difficult to mutate individually. For example, recently it has been reported that, in C. acetobutylicum, the hydrogenase gene can only be deleted along with the deletion of the thiolase gene at the same time.55 Another consideration with the multiplex-gene-targeting plasmid is that the conjugation efficiency is generally lower than the single-gene-targeting plasmid. Thus, it might be necessary to further optimize and improve the conjugation efficiency, using some special protocols as appropriate.56 On the other hand, we successfully deleted the ∼49.2 kb phiCD630-2 using CRISPR-Cpf1 with decent plasmid conjugation efficiencies and genome editing success rates. Application by CRISPR-Cpf1 for Multigene Editing in Consecutive Steps. All the mutants generated with CRISPRCpf1 are clean (without antibiotic markers integrated), and the plasmid can be easily cured. Therefore, additional genome editing can be implemented based on the generated mutant. C. dif f icile 630 can naturally resist erythromycin and tetracycline because it encodes ermB1/2 and tetM, respectively) encoding the corresponding antibiotics resistance proteins. Here, we successfully constructed a clean mutant that is sensitive to both erythromycin and tetracycline using CRISPR-Cpf1 in consecutive steps. The plasmid pWH74 (which is designed for tetM deletion) was conjugated into the plasmid-cured ΔermB1/2 mutant as obtained above, with a conjugation efficiency of 1.72 × 102 CFU/mL-donor (Figure 4a,b). Following the cultivation and screening, an efficiency of 75% was achieved for the tetM deletion. Further, the plasmid was cured through subculturing and replica plating, and a plasmid curing efficiency of 70% was obtained. This mutant was confirmed to be susceptible to both erythromycin and tetracycline (as demonstrated in the following section; Figure 6d). Therefore, the newly generated I

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology expected, the ΔtetM mutant was susceptible to tetracycline and thus proved that CD630_05080 is the determinant of tetracycline resistance. Furthermore, by creating the tetM deletion in the ΔermB1/2 mutant, we successfully constructed the ΔermB1/2ΔtetM mutant, which is highly sensitive to both erythromycin (and clarithromycin) and tetracycline. By deleting the various antibiotics resistance genes, we generated platform strains with multiple applicable antibiotic markers for further comprehensive genetic manipulation. Moreover, the tcdA gene is one of the primary toxin genes in C. dif f icile. For the first time, we generated a clean tcdA deletion mutant using the CRISPR-Cpf1 system. The ΔtcdA strain could potentially serve as a candidate for vaccine development to fight against CDI.

listed. On the basis of the selected protospacer (depending on the User’s decision), Primers 1, 2, 3, and 4 will be generated. Primer pairs of 0/YW3105 (the universal primer), 1/2, and 3/4 will be used to generate iLacP::crRNA, upstream arm, and downstream arm, respectively. These three fragments can then be assembled with the BtgZI-linearized pWH34 to generate the corresponding plasmid targeting on the specific gene through OSA. Conjugation of C. dif ficile and Mutant Screening. Plasmids were conjugated into C. dif f icile as described previously.9 Briefly, 1 mL of the plasmid-harboring E. coli CA434 strain was centrifuged at 2841g for 3 min and then washed once with sterilized LB medium. The cell pellet was transferred into the anaerobic chamber and mixed within 150 μL of an overnight culture of C. dif f icile grown in BHIS broth (with an OD600 of ∼0.8). The mixture was spotted onto the BHIS agar plate (1.5%) with 20 μL per spot. The plate was then cultivated anaerobically at 37 °C for 10 h. Afterward, 1 mL of BHIS medium was added onto the plate surface to harvest cells. A 100 μL aliquot of the harvested cells was spread onto the BHIS-TDC agar plate, which contained thiamphenicol (15 μg/mL), D-cycloserine (250 μg/mL) and cefoxitin (8 μg/mL). Once visible (after 36 h, the conjugation efficiency was calculated by CFU of transconjugants per milliliter of donor cell), the colony was picked and inoculated into BHIS medium containing thiamphenicol (15 μg/mL) (BHIS-Tm). After cultivation for 12 h, the cell culture was serially diluted and 100 μL of each dilution was plated onto the BHISL-Tm plate, containing 15 μg/mL thiamphenicol and 40 mM lactose. After incubating for 36 h at 37 °C, colonies were picked randomly and screened for desirable mutants using colony PCR (cPCR). Specific gene-flanking diagnostic primers were used to verify desirable mutations. The genome editing efficiency was calculated by dividing the total screened colonies by the number of mutants. Except for erm1/2, all the mutations were further confirmed with Sanger sequencing (Figure S4). Plasmid Curing. To cure the plasmid, the plasmidharboring mutant was inoculated into BHIS medium and subcultured (for about 10 times within 5 days). Then the culture was streaked on a BHIS agar plate. Colonies were carefully picked and dotted on both BHIS-Tm and BHIS agar plates (replica plating). The colonies susceptible to Tm were picked and propagated in 1 mL of BHIS medium. The desirable mutation within the clean mutant (plasmid of which was cured) was further confirmed through PCR. The plasmid curing efficiency was calculated by dividing the number of tested colonies by the number of Tm-sensitive colonies. Antibiotics Susceptibility Assay. C. dif ficile 630 and mutant strains (including ΔermB1/2, ΔtetM, and ΔermB1/ 2ΔtetM) were streaked on BHIS agar plates with or without the supplementation of antibiotics (BHIS-TetR, containing 15 μg/ mL tetracycline; BHIS-Erm, containing 50 μg/mL erythromycin). The plates were incubated anaerobically at 37 °C for 24 h. The antibiotics susceptibility of the strain was indicated by the absence of colonies on the plate containing specific antibiotics. Minimum inhibitory concentrations (MICs) of erythromycin, tetracycline, and clarithromycin to the above strains were determined as described previously.61 Briefly, C. dif f icile cultures were incubated in a standard 96-well plate, with each well containing 150 μL of BHI with a 5% v/v inoculum. For each antibiotic, the starting concentration was 12.8 μg/mL, with 2-fold dilutions applied in series (that is, 12.8, 6.4, 3.2, 1.6, 0.8, 0.4, 0.2, and 0.1 μg/mL, respectively). The plate was

■

METHODS Bacterial Strains and Growth Conditions. All the E. coli and C. dif f icile strains used in this study are listed in Table S1. The NEB express E. coli strain (New England BioLabs) was used as the general host for plasmid construction and gene cloning. E. coli CA434 was used as the donor strain for the conjugation of C. dif ficile.59 The transformation of all the E. coli strains was conducted through electroporation using a Gene Pulser XcellTm system (Bio-Rad). E. coli strains were grown in Luria-Bertani (LB) medium supplement with ampicillin (100 μg/mL), chloramphenicol (6 μg/mL), or kanamycin (50 μg/ mL) when necessary. C. dif f icile strains were cultivated in BHIS medium (Brain Heart Infusion, supplemented with 5 g/L yeast extract and 1 g/L L-cycloserine) at 37 °C, in an anaerobic chamber (Coy Laboratory Products). BHIS medium was supplemented with the following antibiotics/inducer when appropriate: thiamphenicol (15 μg/mL), D-cycloserine (250 μg/mL), cefoxitin (8 μg/mL), lactose (40 mM). Plasmids Construction. All the plasmids used in this study are listed in Table S1. All the DNA primers used in this study are listed in Table S2. For the cloning purpose, PCR was performed using either Phusion High-Fidelity DNA Polymerase (NEB) or Phanta Max Super-Fidelity DNA Polymerase (Vazyme Biotech Co., Ltd., Nanjing, China). DNA assembly was carried out using NEBuilder HiFi DNA Assembly Master Mix (NEB) following the manufacturer’s protocol.60 Details of plasmids construction are given in the Supporting Information. A Python-Based Algorithm to Design Primers for One-Step-Assembly (OSA). A Python-based algorithm, denoted OSA Primer Finder (OPF; ‘OPF.py’ file in the Supporting Information), was developed to search potential protospacers in any given gene sequences and design corresponding primers for constructing the plasmid through OSA. OPF is run with Python (version 2.6; https://www. python.org/). Detailed procedures for using OPF to design primers are illustrated in Figure S2. Briefly, before launching the program, the following information should be obtained: (i) the sequence of the target gene and (ii) the upstream and downstream homology arms to be used. Then, the OPF program can be launched, and the gene sequence can be input into the appropriate blank as indicated by the program. All potential protospacers in either the sense or antisense strand (based on the User’s selection) of the target gene will be identified and listed. The Primer 0 corresponding to each protospacer will be generated and depicted underneath the protospacer. The position (site; sense/antisense), reverse complementary sequence (RVS), GC content (GC%), and Tm value (Tm) for each protospacer will also be determined and J

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology incubated anaerobically at 37 °C overnight. The OD600 of the cell culture was measured using a TECAN Infinite M1000 PRO Microplate reader (Tecan Group Ltd. Männedorf, Switzerland). Statistical Analysis. The data were analyzed in Prism (GraphPad Software, La Jolla, CA, USA) using a two-tailed unpaired t test with 95% confidence intervals. Significance levels are indicated by asterisks in the relevant figures.

pYW51, Dr. Mike Young (Aberystwyth University, UK) for providing E. coli CA434, and Dr. Nigel Minton (University of Nottingham, UK) for providing pMTL82151. We thank Dr. Troy Brady for his proofreading and editing of the language of this manuscript.

■

■

ABBREVIATIONS CRISPR, clustered regularly interspaced short palindromic repeats; Cas, CRISPR-associated; cPCR, colony PCR; DSBs, double-strand breakages; Erm, erythromycin; Tet, tetracycline; Tm, thiamphenicol; gDNA, genomic DNA; gRNA, single chimeric guide RNA; ORF, open reading frame; PAM, protospacer adjacent motif; sRNA, small RNA; pre-crRNA, precursor crRNA; OSA, One-Step-Assembly; OPF, OSA primer finder; crRNA, CRISPR RNA; tracrRNA, transactivation crRNA; RNP, ribonucleoprotein; NHEJ, nonhomologous end joining; HDR, homology directed repair; HR, homologous recombination; CDI, C. dif ficile infection; WT, wild type; sRNAP, small RNA promoter; CFU, colony forming unit; BHIS, brain heart infusion; BHIS-Tm, BHIS medium supplemented with 15 μg/mL thiamphenicol; BHIS-Tet, BHIS medium supplemented with 15 μg/mL tetracycline; BHIS-Erm, BHIS medium supplemented with 50 μg/mL erythromycin; BHISL-Tm, BHIS-Tm medium containing 40 mM lactose; BHIS-TDC, BHIS medium containing 15 μg/mL thiamphenicol, 250 μg/mL D-cycloserine and 8 μg/mL cefoxitin; LB, Luria-Bertaini; RVS, reverse complementary sequence; MICs, minimum inhibitory concentrations; OD, optical density; f ur, encodes ferric-uptake regulator; tetM, encodes tetracycline resistance protein; ermB1/2, encodes erythromycin resistance protein 1 and 2; phiCD630−1/-2, encodes phage loci 1 and 2; tcdA, encodes toxin A; PaLoc, encodes pathogenicity locus; cwp66, encodes cell wall protein 66; spo0A, encodes master regulator of sporulation gene; cwp84, encodes cell wall protein 84; mtlD, encodes mannitol-1-phosphate dehydrogenase; tcdC, encodes a negative regulator of toxin production of C. dif f icile; pyrE, encodes orotate phosphoribosyltransferase; selD, encodes selenophosphate synthetase

CONCLUSIONS In this study, we developed a customized CRISPR-Cpf1 system and demonstrated its application for highly efficient genome editing in C. dif f icile. Particularly, we demonstrated that: (i) precise deletion of genes of various sizes can be achieved at very high efficiencies; (ii) deletion of extremely large gene loci, multiplex-gene editing in either a single conjugation or a constitutive manner can be easily realized; (iii) the OSA approach along with the developed OPF program for primer design makes the operation of CRISPR-Cpf1 streamlined and achievable in a very short time frame. Overall, we proved that the CRISPR-Cpf1 system can remarkably facilitate gene manipulation in C. dif f icile, thus expediting the elucidation of pathogenesis of CDI and the further development of CDI therapies. Meanwhile, the protocol developed herein can be broadly applicable for genome engineering in microorganisms with underdeveloped genetic engineering tools.

■

ASSOCIATED CONTENT

* Supporting Information S

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssynbio.8b00087. Detail plasmid construction methods (PDF) Tables of plasmids, strains, and primers used in this work (PDF) Additional figures as described in the text (PDF) Python script of OPF (ZIP)

■

AUTHOR INFORMATION

Corresponding Author

■

*E-mail: [email protected]. ORCID

Wei Hong: 0000-0002-3317-9401 Yi Wang: 0000-0002-0192-3195

REFERENCES

(1) Lawson, P. A., Citron, D. M., Tyrrell, K. L., and Finegold, S. M. (2016) Reclassification of Clostridium Dif f icile as Clostridioides Dif f icile (Hall and O’Toole 1935) Prévot 1938. Anaerobe 40, 95−99. (2) He, M., Miyajima, F., Roberts, P., Ellison, L., Pickard, D. J., Martin, M. J., Connor, T. R., Harris, S. R., Fairley, D., Bamford, K. B., et al. (2013) Emergence and Global Spread of Epidemic HealthcareAssociated Clostridium Dif f icile. Nat. Genet. 45, 109−113. (3) Hawkey, P. M., Marriott, C., Liu, W. E., Jian, Z. J., Gao, Q., Ling, T. K. W., Chow, V., So, E., Chan, R., Hardy, K., et al. (2013) Molecular Epidemiology of Clostridium Dif ficile Infection in a Major Chinese Hospital: An Underrecognized Problem in Asia? J. Clin. Microbiol. 51, 3308−3313. (4) Warny, M., Pepin, J., Fang, A., Killgore, G., Thompson, A., Brazier, J., Frost, E., and McDonald, L. C. (2005) Toxin Production by an Emerging Strain of Clostridium Dif f icile Associated with Outbreaks of Severe Disease in North America and Europe. Lancet 366, 1079− 1084. (5) Borren, N. Z., Ghadermarzi, S., Hutfless, S., and Ananthakrishnan, A. N. (2017) The Emergence of Clostridium Dif f icile Infection in Asia: A Systematic Review and Meta-Analysis of Incidence and Impact. PLoS One 12, 1−16. (6) Burke, K. E., and Lamont, J. T. (2014) Clostridium Dif f icile Infection: A Worldwide Disease. Gut Liver 8, 1−6.

Author Contributions #

W.H. and J.Z. contributed equally to this work. Y.W., W.H., and J.Z. devised the research; W.H. and J.Z. performed the experiments; Y.W., W.H., and L.W. wrote the paper; W.H. and G.C. wrote the Python script. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China [Grant Nos. 31601012, 31560318, 31500078, and 31760318], and the United States Department of Agriculture (USDA) National Institute of Food and Agriculture (NIFA) Hatch project (ALA014-1017025). Dr. Wei Hong is a recipient of scholarship for visiting scholars offered by the China Scholarship Council (CSC). We thank Dr. Shonna McBride (Emory University) for providing C. dif f icile 630 strain, Dr. Hans Blaschek (University of Illinois at Urbana−Champaign) for providing pYW34-ptaE3 and K

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology (7) Heap, J. T., Pennington, O. J., Cartman, S. T., Carter, G. P., and Minton, N. P. (2007) The ClosTron: A Universal Gene Knock-out System for the Genus Clostridium. J. Microbiol. Methods 70, 452−464. (8) Heap, J. T., Kuehne, S. A., Ehsaan, M., Cartman, S. T., Cooksley, C. M., Scott, J. C., and Minton, N. P. (2010) The ClosTron: Mutagenesis in Clostridium Refined and Streamlined. J. Microbiol. Methods 80, 49−55. (9) Cartman, S. T., Kelly, M. L., Heeg, D., Heap, J. T., and Minton, N. P. (2012) Precise Manipulation of the Clostridium Dif f icile Chromosome Reveals a Lack of Association between the tcdC Genotype and Toxin Production. Appl. Environ. Microbiol. 78, 4683− 4690. (10) Bilverstone, T. W., Kinsmore, N. L., Minton, N. P., and Kuehne, S. A. (2017) Development of Clostridium Dif f icile R20291ΔPaLoc Model Strains and in Vitro Methodologies Reveals CdtR Is Required for the Production of CDT to Cytotoxic Levels. Anaerobe 44, 51−54. (11) Ng, Y. K., Ehsaan, M., Philip, S., Collery, M. M., Janoir, C., Collignon, A., Cartman, S. T., and Minton, N. P. (2013) Expanding the Repertoire of Gene Tools for Precise Manipulation of the Clostridium Dif f icile Genome: Allelic Exchange Using pyrE Alleles. PLoS One 8, e56051. (12) Mohr, G., Hong, W., Zhang, J., Cui, G.-z., Yang, Y., Cui, Q., Liu, Y.-j., and Lambowitz, A. M. (2013) A Targetron System for Gene Targeting in Thermophiles and Its Application in Clostridium Thermocellum. PLoS One 8, 1−15. (13) Cui, G. Z., Zhang, J., Hong, W., Xu, C., Feng, Y., Cui, Q., and Liu, Y. J. (2014) Improvement of ClosTron for Successive Gene Disruption in Clostridium Cellulolyticum Using a pyrF-Based Screening System. Appl. Microbiol. Biotechnol. 98, 313−323. (14) Minton, N. P., Ehsaan, M., Humphreys, C. M., Little, G. T., Baker, J., Henstra, A. M., Liew, F., Kelly, M. L., Sheng, L., Schwarz, K., et al. (2016) A Roadmap for Gene System Development in Clostridium. Anaerobe 41, 104−112. (15) Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., and Yang, S. (2015) Multigene Editing in the Escherichia Coli Genome via the CRISPR-Cas9 System. Appl. Environ. Microbiol. 81, 2506−2514. (16) Dicarlo, J. E., Norville, J. E., Mali, P., Rios, X., Aach, J., and Church, G. M. (2013) Genome Engineering in Saccharomyces Cerevisiae Using CRISPR-Cas Systems. Nucleic Acids Res. 41, 4336− 4343. (17) Gao, W., Long, L., Tian, X., Xu, F., Liu, J., Singh, P. K., Botella, J. R., and Song, C. (2017) Genome Editing in Cotton with the CRISPR/ Cas9 System. Front. Plant Sci. 8, 1−16. (18) Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., and Church, G. M. (2013) RNA-Guided Human Genome Engineering via Cas9. Science (Washington, DC, U. S.) 339, 823−826. (19) Makarova, K. S., Haft, D. H., Barrangou, R., Brouns, S. J., Charpentier, E., Horvath, P., Moineau, S., Mojica, F. J., Wolf, Y. I., Yakunin, A. F., et al. (2011) Evolution and Classification of the CRISPR-Cas Systems. Nat. Rev. Microbiol. 9, 467−477. (20) Wang, Y., Zhang, Z. T., Seo, S. O., Lynn, P., Lu, T., Jin, Y. S., and Blaschek, H. P. (2016) Bacterial Genome Editing with CRISPRCas9: Deletion, Integration, Single Nucleotide Modification, and Desirable “clean” Mutant Selection in Clostridium Beijerinckii as an Example. ACS Synth. Biol. 5, 721−732. (21) Larson, M. H., Gilbert, L. A., Wang, X., Lim, W. A., Weissman, J. S., and Qi, L. S. (2013) CRISPR Interference (CRISPRi) for Sequence-Specific Control of Gene Expression. Nat. Protoc. 8, 2180−2196. (22) Guha, T. K., Wai, A., and Hausner, G. (2017) Programmable Genome Editing Tools and Their Regulation for Efficient Genome Engineering. Comput. Struct. Biotechnol. J. 15, 146−160. (23) Shuman, S., and Glickman, M. S. (2007) Bacterial DNA Repair by Non-Homologous End Joining. Nat. Rev. Microbiol. 5, 852−861. (24) Tsai, S. Q., Wyvekens, N., Khayter, C., Foden, J. A., Thapar, V., Reyon, D., Goodwin, M. J., Aryee, M. J., and Joung, J. K. (2014) Dimeric CRISPR RNA-Guided FokI Nucleases for Highly Specific Genome Editing. Nat. Biotechnol. 32, 569−576.

(25) Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., and Yamamoto, T. (2015) Multiplex Genome Engineering in Human Cells Using All-in-One CRISPR/Cas9 Vector System. Sci. Rep. 4, 4−9. (26) Kabadi, A. M., Ousterout, D. G., Hilton, I. B., and Gersbach, C. A. (2014) Multiplex CRISPR/Cas9-Based Genome Engineering from a Single Lentiviral Vector. Nucleic Acids Res. 42, e147. (27) Nissim, L., Perli, S. D., Fridkin, A., Perez-Pinera, P., and Lu, T. K. (2014) Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol. Cell 54, 698−710. (28) Wang, S., Hong, W., Dong, S., Zhang, Z.-T., Zhang, J., Wang, L., and Wang, Y. (2018) Genome Engineering of Clostridium Dif f icile Using the CRISPR-Cas9 System. Clin. Microbiol. Infect., DOI: 10.1016/j.cmi.2018.03.026. (29) McAllister, K. N., Bouillaut, L., Kahn, J. N., Self, W. T., and Sorg, J. A. (2017) Using CRISPR-Cas9-Mediated Genome Editing to Generate C. Dif ficile Mutants Defective in Selenoproteins Synthesis. Sci. Rep. 7, 1−12. (30) Wang, S., Dong, S., Wang, P., Tao, Y., and Wang, Y. (2017) Genome Editing in Clostridium Saccharoperbutylacetonicum N1−4 with the CRISPR-Cas9 System. Appl. Environ. Microbiol. 83, 1−16. (31) Wang, Y., Zhang, Z. T., Seo, S. O., Choi, K., Lu, T., Jin, Y. S., and Blaschek, H. P. (2015) Markerless Chromosomal Gene Deletion in Clostridium Beijerinckii Using CRISPR/Cas9 System. J. Biotechnol. 200, 1−5. (32) Jiang, Y., Qian, F., Yang, J., Liu, Y., Dong, F., Xu, C., Sun, B., Chen, B., Xu, X., Li, Y., et al. (2017) CRISPR-Cpf1 Assisted Genome Editing of Corynebacterium Glutamicum. Nat. Commun. 8, 15179. (33) Zetsche, B., Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., Van Der Oost, J., Regev, A., et al. (2015) Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell 163, 759−771. (34) Xu, R., Qin, R., Li, H., Li, D., Li, L., Wei, P., and Yang, J. (2017) Generation of Targeted Mutant Rice Using a CRISPR-Cpf1 System. Plant Biotechnol. J. 15, 713−717. (35) Kim, D., Kim, J., Hur, J. K., Been, K. W., Yoon, S. H., and Kim, J. S. (2016) Genome-Wide Analysis Reveals Specificities of Cpf1 Endonucleases in Human Cells. Nat. Biotechnol. 34, 863−868. (36) Wang, M., Mao, Y., Lu, Y., Tao, X., and Zhu, J. (2017) kang. Multiplex Gene Editing in Rice Using the CRISPR-Cpf1 System. Mol. Plant 10, 1011−1013. (37) Kim, H., Kim, S. T., Ryu, J., Kang, B. C., Kim, J. S., and Kim, S. G. (2017) CRISPR/Cpf1-Mediated DNA-Free Plant Genome Editing. Nat. Commun. 8, 14406. (38) Hur, J. K., Kim, K., Been, K. W., Baek, G., Ye, S., Hur, J. W., Ryu, S., Lee, Y. S., and Kim, J. (2016) Targeted Mutagenesis in Mice by Electroporation of Cpf1 Ribonucleoproteins Generation of Knockout Mice by Cpf1-Mediated Gene Targeting. Nat. Biotechnol. 34, 807−808. (39) Moreno-Mateos, M. A., Fernandez, J. P., Rouet, R., Vejnar, C. E., Lane, M. A., Mis, E., Khokha, M. K., Doudna, J. A., and Giraldez, A. J. (2017) CRISPR-Cpf1Mediates Efficient Homology-Directed Repair and Temperature-Controlled Genome Editing. Nat. Commun. 8, 2024. (40) Yan, M. Y., Yan, H. Q., Ren, G. X., Zhao, J. P., Guo, X. P., and Sun, Y. C. (2017) CRISPR-Cas12a-Assisted Recombineering in Bacteria. Appl. Environ. Microbiol. 83, 1−13. (41) Hartman, A. H., Liu, H., and Melville, S. B. (2011) Construction and Characterization of a Lactose-Inducible Promoter System for Controlled Gene Expression in Clostridium Perf ringens. Appl. Environ. Microbiol. 77 (2), 471−478. (42) Cobb, R. E., Wang, Y., and Zhao, H. (2015) High-Efficiency Multiplex Genome Editing of Streptomyces Species Using an Engineered CRISPR/Cas System. ACS Synth. Biol. 4, 723−728. (43) Tong, Y., Charusanti, P., Zhang, L., Weber, T., and Lee, S. Y. (2015) CRISPR-Cas9 Based Engineering of Actinomycetal Genomes. ACS Synth. Biol. 4 (9), 1020−1029. (44) Ho, T. D., and Ellermeier, C. D. (2015) Ferric Uptake Regulator Fur Control of Putative Iron Acquisition Systems in Clostridium Dif f icile. J. Bacteriol. 197, 2930−2940. L

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology (45) Hussain, H. A., Roberts, A. P., and Mullany, P. (2005) Generation of an Erythromycin-Sensitive Derivative of Clostridium Dif f icile Strain 630 (630Δerm) and Demonstration That the Conjugative Transposon Tn916ΔE Enters the Genome of This Strain at Multiple Sites. J. Med. Microbiol. 54, 137−141. (46) Sebaihia, M., Wren, B. W., Mullany, P., Fairweather, N. F., Minton, N., Stabler, R., Thomson, N. R., Roberts, A. P., CerdeñoTárraga, A. M., Wang, H., et al. (2006) The Multidrug-Resistant Human Pathogen Clostridium Dif f icile Has a Highly Mobile, Mosaic Genome. Nat. Genet. 38, 779−786. (47) Huang, H., Chai, C., Li, N., Rowe, P., Minton, N. P., Yang, S., Jiang, W., and Gu, Y. (2016) CRISPR/Cas9-Based Efficient Genome Editing in Clostridium Ljungdahlii, an Autotrophic Gas-Fermenting Bacterium. ACS Synth. Biol. 5, 1355−1361. (48) Watkins-Chow, D. E., Varshney, G. K., Garrett, L. J., Chen, Z., Jimenez, E. A., Rivas, C., Bishop, K. S., Sood, R., Harper, U. L., Pavan, W. J., et al. (2017) Highly Efficient Cpf1-Mediated Gene Targeting in Mice Following High Concentration Pronuclear Injection. G3: Genes, Genomes, Genet. 7, 719−722. (49) Westbrook, A. W., Moo-Young, M., and Chou, C. P. (2016) Development of a CRISPR-Cas9 Tool Kit for Comprehensive Engineering of Bacillus Subtilis. Appl. Environ. Microbiol. 82, 4876− 4895. (50) Zetsche, B., Heidenreich, M., Mohanraju, P., Fedorova, I., Kneppers, J., Degennaro, E. M., Winblad, N., Choudhury, S. R., Abudayyeh, O. O., Gootenberg, J. S., et al. (2017) Multiplex Gene Editing by CRISPR-Cpf1 Using a Single crRNA Array. Nat. Biotechnol. 35, 31−34. (51) Waligora, A. J., Hennequin, C., Mullany, P., Bourlioux, P., Collignon, A., and Karjalainen, T. (2001) Characterization of a Cell Surface Protein of Clostridium Dif f icile with Adhesive Properties. Infect. Immun. 69, 2144−2153. (52) Roberts, A. P., Hennequin, C., Elmore, M., Collignon, A., Karjalainen, T., Minton, N., and Mullany, P. (2003) Development of an Integrative Vector for the Expression of Antisense RNA in Clostridium Dif f icile. J. Microbiol. Methods 55, 617−624. (53) Kuehne, S. A., Cartman, S. T., Heap, J. T., Kelly, M. L., Cockayne, A., and Minton, N. P. (2010) The Role of Toxin A and Toxin B in Clostridium Dif f icile Infection. Nature 467 (7316), 711− 713. (54) Jiang, W., Bikard, D., Cox, D., Zhang, F., and Marraffini, L. A. (2013) RNA-Guided Editing of Bacterial Genomes Using CRISPRCas Systems. Nat. Biotechnol. 31, 233−239. (55) Soucaille, P., Nguyen, N.-P.-T., Percheron, B., Croux, C., and Meynial-Salles, I. (2016) Clostridium Acetobutylicum Unable to Produce Hydrogen and Useful for the Continous Production of Chemicals and Fuels, WO Patent WO/2016/042160. (56) Kirk, J. A., and Fagan, R. P. (2016) Heat Shock Increases Conjugation Efficiency in Clostridium Dif f icile. Anaerobe 42, 1−5. (57) Nash, K. A., Brown-Elliott, A. B., and Wallace, R. J. (2009) A Novel Gene, erm(41), Confers Inducible Macrolide Resistance to Clinical Isolates of Mycobacterium Abscessus but Is Absent from Mycobacterium Chelonae. Antimicrob. Agents Chemother. 53, 1367− 1376. (58) van Eijk, E., Anvar, S., Browne, H. P., Leung, W., Frank, J., Schmitz, A. M., Roberts, A. P., and Smits, W. (2015) Complete Genome Sequence of the Clostridium Dif f icile Laboratory Strain 630Δerm Reveals Differences from Strain 630, Including Translocation of the Mobile Element CTn5. BMC Genomics 16, 31. (59) Purdy, D., O’Keeffe, T. A. T., Elmore, M., Herbert, M., McLeod, A., Bokori-Brown, M., Ostrowski, A., and Minton, N. P. (2002) Conjugative Transfer of Clostridial Shuttle Vectors from Escherichia Coli to Clostridium Dif f icile through Circumvention of the Restriction Barrier. Mol. Microbiol. 46, 439−452. (60) Gibson, D. G., Young, L., Chuang, R. Y., Venter, J. C., Hutchison, C. A., and Smith, H. O. (2009) Enzymatic Assembly of DNA Molecules up to Several Hundred Kilobases. Nat. Methods 6, 343−345.

(61) Jorgensen, J. H., and Ferraro, M. J. (2009) Antimicrobial Susceptibility Testing: A Review of General Principles and Contemporary Practices. Clin. Infect. Dis. 49, 1749−1755.

M

DOI: 10.1021/acssynbio.8b00087 ACS Synth. Biol. XXXX, XXX, XXX−XXX