Mutational Spectrum Induced by Chromium(III) in Shuttle Vectors

962

Chem. Res. Toxicol. 1997, 10, 962-970

Mutational Spectrum Induced by Chromium(III) in Shuttle Vectors Replicated in Human Cells: Relationship to Cr(III)-DNA Interactions Tsui-Chun Tsou, Ren-Jye Lin, and Jia-Ling Yang* Molecular Carcinogenesis Laboratory, Department of Life Sciences, National Tsing Hua University, Hsinchu 300, Taiwan, Republic of China Received March 18, 1997X

Trivalent chromium (Cr(III)), the ultimate species of chromium(VI) intracellular reduction, can associate with DNA forming Cr(III) monoadducts and DNA-DNA cross-links. However, the mutational specificity of Cr(III) has not been determined partly because Cr(III) has difficulty entering cells. In this study, we have characterized the types of Cr(III)-induced DNA lesions in two buffer systems and the mutational spectrum of Cr(III)-treated shuttle vectors replicated in human 293 cells. Plasmids were treated with Cr(III) in buffers consisting of either 10 mM potassium phosphate, pH 7.5 (designated as KP), or 0.2 mM Tris-HCl and 20 µM EDTA, pH 7.4 (designated as TE/50). The amounts of Cr(III) bound to DNA increased as Cr(III) concentration increased in both buffers; these Cr(III)-DNA associations were stable in both buffers during a 24-h dialysis. The electrophoretic mobility of supercoiled DNA was markedly retarded in samples treated with Cr(III) in TE/50 but not KP buffer, suggesting that Cr(III)mediated DNA-DNA cross-links were generated in TE/50 but did not form in KP. Polymerasestop assay showed that DNA polymerases were mostly blocked at the 3′ adjacent bases of guanines on templates treated with Cr(III) in TE/50 but were not observed on those treated in KP. The signals of Cr(III)-mediated cross-links generated in TE/50 buffers were reduced when they were dialyzed against KP buffers. Similarly, Cr(III)-DNA monoadducts formed in KP were converted to primer-template cross-links by dialysis against TE/50. The mutation frequency of Cr(III) in the supF gene of pSP189 or pZ189 shuttle vectors replicated in human cells increased as Cr(III) concentration increased in both buffers. DNA sequencing analysis showed that single-base substitutions (61-68%), two-base substitutions (3-5%), and deletions (21-34%) were induced in similar frequencies in plasmids treated with Cr(III) in either TE/ 50 or KP. The Cr(III)-induced base-substitution hot spots are different from those occurring spontaneously. Cr(III) enhances G‚C base substitutions, particularly G‚C f C‚G transversions, at 5′GA, 5′CG, and 5′AG sites. Base-substitution hot spots did not correlate with strong polymerase-stop sites, suggesting that base substitutions are derived from Cr(III) monoadducts, not from DNA-DNA cross-links.

Introduction Although Cr(III)1 is an essential trace element in glucose and lipid metabolism (1), Cr(VI) compounds increase risks of respiratory tract cancers (2, 3). Cr(VI) also induces chromosomal abnormalities (4, 5), cell transformations (6), apoptosis (7), signal transductions (8, 9), and gene mutations (10, 11) in cultured mammalian cells. Cr(VI) compounds are more effective than Cr(III) compounds at inducing cytotoxicity and carcinogenicity because the cellular uptake capability of the former is significantly higher than that of the latter (2, 3, 12). Nevertheless, Cr(VI) does not directly interact with DNA in vitro (13-15). Once Cr(VI) enters cells, it is believed to exert genotoxicity through metabolic activation (16, 17). The ultimate kinetically stable Cr(III) and several reactive species, including short-lived chromium intermediates and ROS, are generated upon Cr(VI) reduction (16-20). Exposing cultured cells to Cr(VI) * Author to whom correspondence should be addressed. Fax: 8863-5721746. E-mail: [email protected]. X Abstract published in Advance ACS Abstracts, August 1, 1997. 1 Abbreviations: Cr(III), trivalent chromium; Cr(VI), hexavalent chromium; TE/50, 0.2 mM Tris-HCl and 20 µM EDTA (pH 7.4); KP, 10 mM potassium phosphate (pH 7.5); ROS, reactive oxygen species; ICP-MS, inductively coupled plasma-mass spectrometer.

S0893-228x(97)00040-4 CCC: $14.00

generates several types of DNA damage including singlestrand breaks, radical-DNA adducts, and Cr-DNA adducts, as well as Cr-mediated DNA-DNA and DNAprotein cross-links (7, 21-24). Intercellular chromium contents can rapidly reach millimolar levels, hundreds of times greater than extracellular chromium concentrations (25, 26), and accumulate in cell nuclei (25). Although Cr(III) is inefficient at entering cells (2, 3, 12), the major form of chromium inside the cells has been estimated to be Cr(III) (23, 24), which can subsequently bind to DNA and proteins (1315, 20). In the presence of H2O2, Cr(III) induces markedly more hydroxyl radicals than Cr(VI) does and subsequently leads to strand breakage and the formation of 8-hydroxydeoxyguanosine in DNA (27, 28). Hexacoordinate Cr(III) aromatic bidentate amine complexes induce mutations in Salmonella typhimurium that may result from DNA damage generated by an active redox center (29). Furthermore, Cr(III) can enhance mutations in single-stranded phage DNA replicated in Escherichia coli (30, 31). At low concentrations, Cr(III) increases DNA polymerase processivity and decreases the fidelity of DNA replication (30, 31), whereas DNA-DNA cross-links induced by high concentrations of Cr(III) stop DNA synthesis (32). Cr(III) may thus be an important species © 1997 American Chemical Society

DNA Damage and Mutational Spectrum of Cr(III)

leading to Cr(VI) mutagenesis in cells. Shuttle vector systems have been applied to examine the molecular mutagenesis of many environmental carcinogens (33). The mutational spectra induced by a particular carcinogen, e.g., benzo[a]pyrenediol epoxide, in shuttle vector systems (34) almost always reflect that observed in the endogenous genes of mammalian cells having similar DNA repair capabilities (35). In this study, we adopted shuttle vector systems to examine the mutational spectrum induced by Cr(III). Shuttle vectors carrying the supF target gene were treated with Cr(III) in either phosphate-based (i.e., 10 mM potassium phosphate, pH 7.5 (KP)) or Tris-EDTA-based (i.e., 0.2 mM Tris-HCl and 20 µM EDTA, pH 7.4 (TE/50)) buffers. The Cr(III)-treated plasmids were transfected into the human cell line 293 and allowed 2 days for replication. Progeny plasmids were then rescued, purified, and introduced into indicator bacterial strains. Mutant plasmids were amplified and subsequently analyzed using DNA sequencing. Moreover, the amounts of Cr(III) bound to plasmids and the Cr(III)-induced DNA polymerase-stop sites generated in the supF gene were determined. The relationship between the mutational specificity and types of DNA lesions generated in Cr(III)-treated plasmids in these two buffers was compared to explicate the role of Cr(III) in mutagenesis during Cr(VI) intracellular reduction.

Experimental Procedures Plasmids and Cells. Shuttle vectors pZ189 and pSP189 and the E. coli strain MBM7070 were provided by Dr. M. M. Seidman (Otsuka Pharmaceuticals, Rockville, MD). Both pZ189 and pSP189 vectors contained the mutagenic target supF, a tyrosine amber-suppressor tRNA gene, flanked by the ampicillin gene and the bacterial origin of replication (36, 37). These vectors also carried the replication origin and large-T antigen gene from simian virus 40. The shuttle vector pSP189 also contained an 8-bp signature sequence with 2 × 48 possible unique plasmids to permit unambiguous identification of independent mutant clones following mutagenesis (37). The numbering used in this study, except where otherwise indicated, is that of the gene in pZ189 where the unique EcoRI site GAATTC is denoted as position 1. The human embryonic kidney cell line, 293, which served as the eukaryotic hosts for shuttle vectors and the E. coli SY204 cells were obtained from Dr. V. M. Maher (Michigan State University, MI). The E. coli MBM7070 (36) and SY204 host cells (38) carrying an lacZ amber mutation were used to distinguish plasmids containing supF mutations from those containing wild-type supF sequences. The human 293 cells were grown in Dulbecco’s modified Eagle media (Life Technologies, Grand Island, NY) supplemented with sodium bicarbonate (2.2%, w/v), L-glutamine (0.03%, w/v), penicillin (100 units/mL), streptomycin (100 µg/mL), and fetal calf serum (10%). Human cell cultures were maintained at 37 °C in a humidified incubator containing 10% CO2 in air. The E. coli cells were grown in Luria-Bertani media at 37 °C. Determination of Cr(III) Binding to DNA. CrCl3‚6H2O (99.995% pure) was purchased from Aldrich Chemical (Milwaukee, WI). Plasmid pSP189 (10 µg, 3.08 × 10-8 mol of nucleotides) was treated with CrCl3 (1-1000 µM, freshly prepared in H2O) at 37 °C for 30 min in 50 µL of either TE/50 or KP. Immediately after treatment, the reaction mixtures were passed through Sephadex G-50 columns (Boehringer Mannheim GmbH, Germany) at 2700 rpm for 4 min to remove the unbound Cr(III) ions. One set of those Cr(III)-treated samples was placed on a membrance (VSWP 02500, Millipore, Bedford, MA), dialyzed against TE/50 or KP buffer at room temperature for 24 h (drop dialysis), and then passed through Sephadex G-50 columns. The amount of Cr(III) bound to the plasmid was determined using an inductively coupled plasma-mass spec-

Chem. Res. Toxicol., Vol. 10, No. 9, 1997 963 trometer (ICP-MS; SCIEX ELAN 5000, Perkin Elmer, Norwalk, CT). The ICP-MS conditions were set as follows: power, 5000 W; plasma flow rate, 15 L/min; auxiliary flow rate, 0.8 L/min; and sample flow rate, 0.8 L/min. Cr(III) standard concentrations were prepared by series dilutions of 1000 mg/L chromium(III) nitrate (Merck, Darmstadt, Germany) to 1-200 ppb in either TE/50 or KP. The numbers of chromium adducts were calculated and expressed as the numbers of chromium molecules bound per 1000 nucleotides. Agarose Gel Electrophoresis and Southern Analysis. Immediately after Cr(III) treatment, DNA samples were analyzed by electrophoresis in 0.8% agarose gels containing ethidium bromide (0.2 µg/mL). The gel was then placed on a transilluminator UV box and photographed from above with Polaroid type 665 positive/negative film. The band intensities of negatives were determined using a computing densitometer equipped with the ImagQuant analysis program (Molecular Dynamics, Sunnyvale, CA). DNA samples in gels were then denatured and Southern transferred to nylon membranes. The membrane was washed, dried, and exposed to UV light (1200 × 100 µJ/cm2) using a XL-1000 UV cross-linker (Spectronics Co., Westbury, NY). The immobilized DNA samples in the membrane were hybridized with 32P-labeled probes which were prepared from [R-32P]dCTP (specific activity, 800 Ci/mmol; Amersham, Little Chalfont, U.K.) and the NEBlot random primer kit (BioLabs, Beverly, MA). Hybridization was performed in a hybridization oven (Hybaid Ltd., Middlesex, U.K.). Next, the membrane was washed, dried, and plastic wrapped. Either phosphor screens or X-ray films were exposed to radioactivity on the membrane. The band intensities on the phosphor screens were quantified using a PhosphorImager equipped with the ImagQuant analysis program (Molecular Dynamics). Polymerase-Stop Assay of Cr(III)-Treated Templates. The ability of chromium adducts to interfere with DNA synthesis was determined by the in vitro DNA polymerase-stop assay described previously, with modifications (32, 39). Briefly, EcoRI- and DpnI-linearized pZ189 were extracted with phenol/ chloroform and further purified using a Centricon-30 concentrator (Amicon, Danvers, MA). The DNA sample (4 µg) was then treated with CrCl3 in 15 µL of either TE/50 or KP as described above. The unbound Cr(III) was removed by drop dialysis against TE/50 or KP buffer at room temperature. The dialyzed DNA samples were used as templates for polymerase-stop assay that was carried out in a manner similar to the DNA sequencing reaction, except that the dideoxyribonucleotides were omitted. To obtain Cr(III)-mediated polymerase-stop sites on the two strands of the supF gene, [γ-32P]ATP (specific activity, 5000 Ci/mmol; Amersham) end-labeled primer 1, 5′225ACGGGGTCTGACG213, and primer 2, 5′-26GTATCACGAGGCCCT-12, were annealed with the EcoRI- and DpnI-linearized templates, respectively. The Cr(III)-treated DNA templates (2 µg) and γ-32P-labeled primers (2.3 pmol) were mixed in a 10 µL buffer containing 40 mM Tris-HCl (pH 7.5) and 10 mM MgCl2. The template-primer mixture was then heated at 95 °C for 3 min and rapidly cooled on ice. Next, 1-2 units of diluted Sequenase (US Biochemicals, Cleveland, OH) and four deoxyribonucleotides (final concentrations of 12.5 µM of each were used) were added to 2.5 µL of the template-primer mixture. The polymerization reaction was performed at 37 °C for 5 min. Dideoxy sequencing reaction was also performed on the untreated DNA template to provide DNA size markers. The products of the polymerasestop assays and dideoxy sequencing reactions were analyzed by electrophoresis in a 6% polyacrylamide gel. Mutagenesis Assay. The mutagenicity of DNA containing Cr(III) adducts was assayed using the shuttle vector system described previously (34). Briefly, 10 µg of untreated or Cr(III)-treated plasmids (purified with Sephadex G-50 columns) were mixed with 1.5 mL of HEPES-buffered solution containing calcium and phosphate (40). The DNA mixtures were transfected into human 293 cells (8 × 105) on 150-mm diameter dishes. After a 2-day replication period, plasmids were isolated from the cells by alkaline lysis and treated with DpnI restriction endonuclease to remove unreplicated plasmids. The replicated

964 Chem. Res. Toxicol., Vol. 10, No. 9, 1997

Figure 1. Determination of numbers of Cr(III) bound per plasmid. Supercoiled pSP189 was treated with CrCl3 at 37 °C for 30 min in either TE/50 buffer (circles) or KP buffer (triangles). The reaction mixtures were purified by Sephadex G-50 gel filtration (open symbols) and analyzed by ICP-MS as described in Experimental Procedures. One set of Cr(III)-treated samples was subjected for a 24-h dialysis before G-50 purification (filled symbols). Data were obtained by averaging 2-5 experiments, and the bars represent SD. plasmids were introduced into competent E. coli SY204 or MBM7070 cells, respectively, using calcium chloride (for pZ189) or electroporation (for pSP189) (40). The electroporation was conducted by pulsing the competent bacteria-DNA mixture once using a Cell-Porator (Life Technologies) set at 1500 V, 330 µF, and 4000 Ω. The transformed cells were then assayed for ampicillin resistance and mutations in the supF gene. Bacteria receiving plasmids with supF mutations formed white or light blue colonies, whereas those receiving a functional supF gene formed blue colonies on agar plates containing ampicillin, 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside, and isopropyl β-D-thiogalactopyranoside. Mutant colonies were restreaked on those agar plates to confirm the phenotypes. The plasmids with mutant supF genes were amplified, purified, and then analyzed using electrophoresis in 0.8% agarose gels. Mutant plasmids were sequenced according to the dideoxy sequencing procedure using Sequenase and primer 1 (for mutants derived from pZ189) or primer 3, 5′GGCGACACGGAAATGTTGAA (65-46 bases upstream of EcoRI site; for mutants derived from pSP189). Either [R-35S]dATP (specific activity, 1000 Ci/mmol; Amersham) or [γ-32P]ATP end-labeled primer was used for autoradiographic detection of the sequence. Mutant plasmids with supF deletions were subjected for restriction mapping by EcoRI, BamHI, and HindIII.

Results Characterization of Cr(III)-Treated Plasmids. Shuttle vector pSP189 was treated with various concentrations of CrCl3 in either TE/50 or KP buffer. Following removal of unbound Cr(III) ions by Sephadex G-50 gel filtration, the amounts of chromium bound to plasmids were assayed by ICP-MS. Only a background level of chromium was recovered when CrCl3 was applied to the G-50 column. As shown in Figure 1, the amounts of chromium adducts per plasmid increased linearly when CrCl3 concentrations in both TE/50 (open circles) and KP (open triangles) buffers were increased. The capability of Cr(III) bound to DNA in TE/50 was much higher than that in KP at the same dose ranges. The amounts of chromium bound per 1000 nucleotides generated by 200 µM CrCl3 in TE/50 and KP were ∼170 and ∼25, respectively. At 500 µM CrCl3, the amounts of chromium bound

Tsou et al.

Figure 2. Effect of Cr(III) on the electrophoretic mobility of supercoiled plasmids. Supercoiled plasmids (660 ng) were reacted with Cr(III) in either TE/50 buffer (lanes 1-6) or KP buffer (lanes 7-11) as described in Experimental Procedures. The Cr(III) concentrations are indicated in panel a. Immediately after Cr(III) treatment, DNA samples were analyzed by electrophoresis in an agarose gel containing ethidium bromide (panel a). The relative intensity of ethidium bromide fluorescence within areas marked with brackets (i.e., the position of supercoiled DNA) was determined by a densitometer. DNA samples in gels shown in panel a were denatured, Southern transferred to a nylon membrane, and hybridized with a R-32Plabeled probe. The radioactivity of DNA was visualized by exposing to a phosphor screen (panel b). The relative amount of supercoiled DNA on the blots (area within brackets) was determined using a PhosphorImager.

per 1000 nucleotides increased to ∼150 in KP buffers. Conversely, DNA samples treated with 500 µM CrCl3 in TE/50 could not be recovered from the G-50 columns. One other set of the Cr(III)-DNA samples was drop dialyzed for 24 h before passing through G-50 columns to examine the stability of Cr(III)-DNA interactions. Figure 1 shows that the numbers of Cr(III) bound to DNA were approximately the same in Cr(III)-treated DNA with or without a 24-h dialysis against buffers used for Cr(III) treatment. Furthermore, 92.0 ( 3.1% (mean ( SD; 3 determinants) of chromium remain bound to DNA in KP buffer when those G-50-purified samples were incubated for 24 h with EDTA at a 2-fold molar excess over the Cr(III) concentration and then drop dialyzed. Approximately 80% (78.2 ( 6.2%; average of 9 determinants) of chromium remain bound to DNA in TE/50 buffer when those samples were chelated with EDTA at a 5-fold molar excess over the Cr(III) concentration. These results indicate that Cr(III) ions associate with DNA in both buffers. The above results also suggest that different types of Cr(III)-DNA associations may be generated by these two buffer systems. Figure 2 shows agarose gel patterns and Southern blots of supercoiled plasmids treated with Cr(III) in vitro. The electrophoretic mobility of supercoiled plasmids was markedly reduced when DNA samples were treated with g100 µM Cr(III) in TE/50 buffer (Figure 2, lanes 3-6). On the other hand, when supercoiled plasmids were reacted with millimolar levels of Cr(III) in KP buffer, their electrophoretic mobilities remain the same as that of untreated DNA (Figure 2, lanes 7-11). The phenomenon that reaction buffers affect the electrophoretic mobility of Cr(III)-treated supercoiled plasmids has sug-


gested that Cr(III)-mediated DNA-DNA cross-links were generated in TE/50 but did not form in KP buffer. The agarose gel patterns also showed a reduced ethidium bromide fluorescence intensity of supercoiled plasmids treated with Cr(III) in both buffers. This quench effect would suggest that Cr(III) may interfere with ethidium bromide bound to DNA. Additionally, DNA aggregates were observed in samples treated with 0.8 and 4 mM Cr(III) in TE/50 and KP buffers, respectively. Polymerase-Stop Assay. Polymerase-stop assay was performed to determine how templates containing Cr(III) adducts interfered with DNA replication. Plasmid pZ189 was linearized with EcoRI or DpnI, purified, and treated with CrCl3 (25-200 µM) in TE/50, and unbound Cr(III) was removed using dialysis before the polymerasestop assay. Complete polymerization was verified by the formation of a full-length product: i.e., 225 bases using primer 1 and EcoRI-linearized templates and 233 bases using primer 2 and DpnI-linearized templates. Figure 3 shows that EcoRI-linearized templates treated by CrCl3 in TE/50 generated unique patterns in three regions as compared with untreated templates. At Cr(III) concentrations g 100 µM, polymerase was strongly blocked near the primer sites (region III). Several polymerase-stop sites (region II) were found in CrCl3-treated templates, and the highest signal intensities were observed in templates treated with 50 µM CrCl3. These results show that the DNA replication was mostly blocked at one base located at the 3′ side of a guanine on the template strand. Furthermore, full-length DNA products decreased with increases in CrCl3 concentrations (Figure 3, top of region II). At 50 µM, full-length DNA signals were 50% of those from untreated templates; such signals were not observed in templates treated with g100 µM CrCl3 (Figure 3). The radioactivity in the loading wells markedly increased as CrCl3 concentrations were increased; the relative intensities were 3-, 11-, 33-, and 51-fold of those observed for untreated templates when EcoRI-linearized DNA was treated with 25, 50, 100, and 200 µM CrCl3, respectively (Figure 3, region I; average of 3-5 experiments). These enhanced radioactive signals in the loading well have been considered as primer-template cross-links (32). Similar results were obtained in DpnI-linearized pZ189 treated with CrCl3. The polymerization was also carried out on templates treated with CrCl3 in KP. Interestingly, apparently neither polymerase-stop sites nor radioactivity in the loading wells was enhanced above background levels when templates were treated with 50-1000 µM CrCl3 in KP (data not shown). To examine the stability of Cr(III)-mediated DNA cross-links generated in TE/50, Cr(III)-treated DNA samples were drop dialyzed against one of the two buffers before the polymerase-stop assay was performed. The intensities of the polymerase-stop sites caused by Cr(III) in TE/50 were reduced after a 4-h dialysis against KP (data not shown); additionally, the radioactivity in the loading wells of the sequencing gel decreased (Figure 4, lanes 2 and 3). When the DNA samples were treated with 50 µM CrCl3 in KP and then dialyzed against TE/50, the radioactivity in the loading wells of the sequencing gel increased as dialysis periods increased (Figure 4, lanes 4-6), but still no significant polymerase-stop sites were observed (data not shown). This result suggests that buffer environments affect the types of Cr(III)-DNA associations. Cr(III) Mutagenesis and Mutational Spectrum. Immediately after treatment with CrCl3 in either TE/50

Chem. Res. Toxicol., Vol. 10, No. 9, 1997 965

Figure 3. Polymerase-stop assay of Cr(III)-treated template. Plasmids were linearized with EcoRI before treatment with 25200 µM CrCl3 in TE/50 buffers as described in Experimental Procedures. The Cr(III)-treated templates were replicated using Sequenase, four deoxyribonucleotides, and primer 1. The products of these polymerase-stop reactions and dideoxy sequencing reactions of untreated plasmids (G, A, T, C) were analyzed in a 6% acrylamide gel. The gel was cut into three regions, and the lanes were lined up from loading wells (region I) to the bottom of the gel (region III). The full-length DNA products were shown to be EcoRI at the top of region II. The dots shown in region II on the right-hand sides of samples treated with 50 µM Cr(III) denote the bases located on the 3′ sides of template guanines.

or KP, treated and untreated shuttle vectors were passed through G-50 columns and transfected into human 293 cells for replication. The progeny plasmids were rescued and introduced into indicator E. coli strains to determine the supF mutant frequency. As shown in Table 1, the frequency of supF mutants increased linearly as a


Tsou et al. Table 2. Types of Mutations Generated in the supF Gene of Cr(III)-Treated and Untreated Plasmids Replicated in 293 Cells number of mutants observeda Cr(III)-treatedb supF mutations group A group B group C

Figure 4. Effect of reaction environment on Cr(III)-induced primer-template cross-links. EcoRI-linearized plasmid pZ189 (3 µg of DNA/15 µL) was treated with 50 µM Cr(III) in either TE/ 50 or KP buffer at 37 °C for 30 min. The unbound Cr(III) was removed by drop dialysis against either TE/50 or KP buffer for various times as indicated. The in vitro DNA polymerization reaction was carried out and analyzed as described in Figure 3. Only the radioactivity in the loading wells is shown. Lane 1 was DNA sequencing reaction of untreated template using dideoxycytidine triphosphate in chain termination. Table 1. Mutant Frequency Obtained by Transformation of E. coli with Progeny of Cr(III)-Treated and Untreated Shuttle Vectors Replicated in 293 Cells number of CrCl3 (µM) 0 1 10 25 50

transformants

mutants

pZ189 in TE/50 Buffera 22 776 2 19 164 3 19 092 13 19 029 8 14 343 13

frequency of supF mutant (×10-4) 0.88 1.57 6.81 4.20 9.06

Bufferb

0 25 50 0 50 200 500

pSP189 in TE/50 52 355 1 110 690 42 85 450 44

pSP189 in KP Bufferb 48 845 6 41 780 13 91 220 39 83 900 39

0.19 3.79 5.15 1.23 3.11 4.28 4.65

a Data obtained from six independent transfection experiments. The transformation experiments were performed using the calcium chloride procedure, and the E. coli host strain was SY204. b Data obtained from two independent transfection experiments. The transformation experiments were performed using electroporation, and the E. coli host strain was MBM7070.

function of CrCl3 concentration. DNA sequence analysis was performed in 23 mutants derived from progeny of pZ189 treated with Cr(III) in TE/50 (from six transfection experiments); 4 of the 23 mutants (17%) could have been siblings and were not included in Table 2. Among the 19 independent mutants sequenced, 13 contained singlebase substitutions, 4 were deletions, and 2 were duplications (Table 2, group A). The shuttle vector pSP189 that was designed for the identification of independent mutants (37) was chosen to obtain more detailed information on Cr(III) mutagenesis. Of the 282 pSP189-derived mutants analyzed in this study, 16 (5.7%) were found to be actual sibling mutants. Table 2 shows a total of 76 and 82 independent mutants derived in progeny of pSP189 treated with Cr(III) in TE/50 buffer (group B) and in KP buffer (group C), respectively. Similar frequencies for each type of mutation derived from these two populations were observed; i.e., 61-62% of these mutants were single-base substitutions, 3-5% were twobase substitutions, and 32-34% were deletions. To compare Cr(III)-induced mutational specificity with that occurring spontaneously, DNA sequence analysis was also performed on 108 mutants obtained from untreated pSP189 replication in human 293 cells (in several separate experiments). The results showed 63% of these

single-base 13 (68) substitutions two-base 0 substitutions deletionsd 3 (16) compound 1 (5) deletionse duplications 2 (11) total 19

47 (62)

total

50 (61) 110 (62)

untreated 68c (63)

2 (3)

4 (5)

6 (3)

9 (8)

11 (14) 14 (18)

19 (23) 9 (11)

33 (19) 24 (14)

13 (12) 14 (13)

2 (3) 76

0 (0) 82

4 (2) 177

4 (4) 108

a Numbers in parentheses indicate percentages. b Groups A-C represent mutants derived from pZ189 treated with Cr(III) in TE/ 50, pSP189 treated with Cr(III) in TE/50, and pSP189 treated with Cr(III) in KP, respectively. c Two mutants having a single-base substitution plus a single-base insertion were categorized in this group. d Simple deletions. e In addition to supF deletions, these mutants had insertions and/or rearrangements.

Table 3. Kinds of Base Substitutions Generated in the supF Gene of Cr(III)-Treated and Untreated Plasmids Replicated in 293 Cells number of mutations observeda kinds of base substitutions

Cr(III)-treatedb group A group B group C

transversions G‚C f T‚A 3 (23) G‚C f C‚G 10 (77) A‚T f C‚G 0 A‚T f T‚A 0 transitions G‚C f A‚T 0 A‚T f G‚C 0 total 13

all

untreated

14 (28) 18 (35) 0 0

15 (26) 17 (29) 2 (3) 0

32 (26) 45 (37) 2 (2) 0

27 (31) 18 (21) 1 (1) 2 (2)

19 (37) 0 51

20 (35) 39 (32) 4 (7) 4 (3) 58 122

37 (43) 1 (1) 86

a Numbers in parentheses indicate percentages. b Groups A-C are defined in Table 2.

spontaneous mutants were single-base substitutions, 8% were two-base substitutions, 25% were deletions, and 4% were duplications (Table 2). Table 3 summarizes the specific kinds of base substitutions generated by replication of Cr(III)-treated and untreated plasmids in human 293 cells. All the base substitutions derived in group A were G‚C base pair transversions: i.e., 10 G‚C f C‚G (77%) and 3 G‚C f T‚A (23%). All of those observed in group B occurred at G‚C-base pairs: i.e., 19 G‚C f A‚T (37%), 18 G‚C f C‚G (35%), and 14 G‚C f T‚A (28%). The major kinds of base substitutions observed in group C also occurred at G‚C base pairs (90%); only 6 of the 58 (10%) base substitutions occurred at A‚T base pairs. Similar frequencies of G‚C f T‚A, G‚C f C‚G, and G‚C f A‚T were observed in groups B and C. Among these base substitutions, the frequencies of G‚C f C‚G observed in Cr(III)-treated groups were higher than those generated in untreated plasmids (Table 3). These results indicate that the specific kinds of mutations enhanced by Cr(III) treatment were similar in mutants derived from plasmids treated in KP and TE/50; this is in spite of the different patterns of the Cr(III)-DNA interactions found in the two buffers described above. The specific locations of base substitutions in the supF t-RNA gene occurring spontaneously and induced by Cr(III) are shown in Figures 5 and 6a, respectively. Singlebase substitutions occurring at positions 104, 108, 123,



Figure 5. Locations of spontaneously occurring base substitutions in the supF gene coding region. Underlines represent two-base substitutions; double underlines represent single-base substitutions plus single-base insertions. The 3′ downstream bases of the supF gene coding region of pSP189 differ from those of pZ189; these positions are not numbered.

Figure 6. Locations of base substitutions (a) and polymerase-stop sites (b) induced by Cr(III) in the supF gene coding region. The mutations derived from plasmids treated with Cr(III) in TE/50 and KP buffers, respectively, are shown above and below the 5′ to 3′ sequence of the nontranscribed strand. Stars shown below the supF sequences indicate spontaneously occurring hot sopts. The 5′ upstream and 3′ downstream bases of the supF gene coding region of pSP189 differ from those of pZ189; these positions are not numbered. Lower case letters indicate mutations derived from pZ189. Underlines represent two-base substitutions. One Cr(III)induced G‚C base substitution derived from group A occurring in the 5′ promoter region is not shown. The polymerase-stop sites obtained in templates treated with 50 µM Cr(III) were analyzed using a PhosphorImager (b). The relative signal intensities of polymerase-stop sites are shown by the varying lengths of bars.

129, 163, and 168 were frequently observed (46%) in untreated plasmids (Figure 5). Three mutational hot spots occurring at positions 133, 139, and 155 were enhanced by Cr(III) treatment in KP buffers; three mutational hot spots at positions 105, 133, and 164 were enhanced by Cr(III) treatment in TE/50 buffers (Figure 6a). The hot spot at position 133 was commonly enhanced in both Cr(III)-treated groups. The Cr(III)enhanced single-base substitutions occurring at positions 133, 139, 155, and 164 were infrequently observed in untreated plasmids (Figure 5).

The relative intensities of polymerase-stop sites on templates treated with 50 µM Cr(III) in TE/50 buffer (region II of Figure 3) were quantified using a PhosphorImager, and the results are shown in Figure 6b. Strong polymerase-stop sites occurred at positions 116, 124, 126, 164, 172, and 173 of the supF coding region. Only position 164 was also a hot spot for base substitutions induced by Cr(III). Whereas positions 133, 139, and 155 were mutational hot spots for Cr(III), these positions were weak sites for stopping DNA synthesis. This comparison indicates that most of the Cr(III)-mediated


polymerase-stop sites were cold Cr(III)-induced base substitution spots and vice versa. All the Cr(III)-induced G‚C base substitutions found in the supF coding region were pooled; their flanking bases were analyzed and compared with those derived spontaneously to determine the existence of sequence specificity. Both spontaneous and Cr(III)-derived base substitutions were less frequently observed at 5′GC, 5′GT, and 5′TG sites. The 5′GA and 5′GG sequences were the frequent sites observed for the G‚C base substitutions occurring spontaneously. Base substitutions at 5′GA, 5′CG, and 5′AG sites were enhanced by Cr(III) treatment, but occurrences at 5′GG and 5′GG sites were decreased as compared with those derived spontaneously. DNA sequencing results showed that only 1 of the 13 spontaneous deletions (7.7%) had deleted sizes larger than 100 bp, whereas 8 of the 33 Cr(III)-induced deletions (24.2%) had these large deletions. Previous analyses of DNA sequences in deletion mutations showed that short direct and inverted repeats were observed frequently at the deletion break points (41, 42). Analysis of supF deletions with known sequences around break points showed that 3 of the 11 spontaneous (27%) and 5 of the 30 Cr(III)-induced (17%) supF deletions had such short repeats at the deletion break points. This analysis indicates that Cr(III) treatment can enhance deletions, and these deletions seemed to occur randomly in shuttle vectors.

Discussion Although Cr(III) directly binds to DNA, its inefficiency in entering cells (2, 3, 12) hampered our understanding of the mutagenic potential of this metal. In this study, we adopted a shuttle vector system to illustrate the types of mutations induced by replication of Cr(III)-treated plasmids in human 293 cells. In comparison with the mutations occurring spontaneously, Cr(III) induces G‚C base substitutions, particularly G‚C f C‚G transversions, located at highly specific sites (5′GA, 5′CG, and 5′AG). Cr(III) also enhances gene deletions and rearrangements. Moreover, we have determined the types of Cr(III)-DNA associations using ICP-MS, agarose gel eletrophoretic mobility, and polymerase-stop assays. ICP-MS results show that Cr(III) ions stably associate with DNA in both TE/50 and KP buffers. DNA synthesis by Sequenase was markedly blocked, primarily at one base located on the 3′ sides of guanines in templates during in vitro replication of templates treated with Cr(III) in TE/50. The guanine-specific arrest of DNA replication we noted generally agrees with a recent report from Bridgewater et al. in which they treated an 89-bp synthetic DNA template with Cr(III) in 10 mM Tris-HCl, pH 7.6 (32). However, we also found that such polymerase-stop sites do not form in templates treated with Cr(III) in KP buffers, even in templates containing high amounts of chromium adducts. These results suggest that buffer environments affect the types of Cr(III)-DNA associations. Cr(III) is known to bind to both the phosphate backbone and the nucleotide bases of DNA, particularly guanines (13, 14). CrCl3‚6H2O in solutions at physiological pH values and temperatures is presented as the aquo form trans-[Cr(H2O)4Cl2]+ (15) which may attack the negatively charged phosphate backbone and lead to stable Cr(III) monoadducts. These Cr(III) monoadducts may subsequently react with the other DNA molecules

Tsou et al.

forming DNA cross-links between the two complementary strands or interplasmid DNAs; however, high concentrations of phosphate ions present in KP buffers may coordinate with Cr(III) monoadducts and thereby suppress the ability of Cr(III) to induce DNA-DNA crosslinks. Cr(III) monoadducts generated in KP could be converted into primer-template cross-links during dialysis against TE/50 buffers. Results shown here suggest that the major types of DNA lesions induced by CrCl3‚6H2O in KP buffers are Cr(III) monoadducts that do not block DNA replication, and those formed in TE/ 50 buffers are interstrand cross-links that terminate polymerase processivity. Interestingly, despite the apparently different types of Cr(III)-DNA adducts formed in shuttle vectors, similar mutational spectra were generated when they replicated in human cells. A scenario was proposed for this phenomena in which these different types of Cr(III) adducts generated in vitro are exchangeable due to altered solution environments: e.g., the transfection solution and the cellular physiological conditions. Indeed, our data showed that the amounts of Cr(III)mediated DNA-DNA cross-links are markedly altered by substitution of buffer environments. Recently, Zhitkovich et al. showed that Cr(III)-mediated DNA-protein cross-links were derived from the interaction between Cr(III)-amino acids and DNA, whereas amino acids (cysteine or histidine) do not cross-link to Cr(III)-DNA (20). This suggests that DNA-protein cross-links are not involved in the mutagenesis of Cr(III)-treated shuttle vectors. Comparison of the frequency of polymerase-stop signals and mutational hot spots indicates that strong polymerase-stop sites were cold spots for base substitutions. Similarly, base substitution hot spots were weak polymerase-stop sites. These results suggest that the majority of Cr(III)-induced polymerase-stop sites would not induce base substitutions. In human cells, DNA polymerases encountering Cr(III)-mediated DNA cross-links may strongly block DNA replication and promote gene deletions and rearrangements by incomplete recombination repair. In contrast, low numbers of chromium monoadducts on the templates may enhance the processivity of polymerase with a reduced fidelity (30). DNA polymerases may misincorporate deoxyribonucleotides due to a preference for dGMP across chromium monoadducts, thereby resulting in G‚C base substitutions, primarily G‚C f G‚C, in subsequent replication cycles. We have previously demonstrated that 8-hydroxydeoxyguanosine and strand breakage in DNA are generated by incubation of Cr(III)-DNA with H2O2 (27, 28). Those studies also showed that •OH radicals are possibly the major ROS formed during the reaction of H2O2 with Cr(III)-DNA and leading to DNA lesions. Hydrogen peroxide is formed in aerobic cells as a result of normal cellular metabolism, and high levels of H2O2 are found in several cancer cell lines (43, 44). Hydrogen peroxide freely passes though cell membranes and can reach any cellular compartment (43, 44). Cr(III)-shuttle vectors may interact with H2O2 in cells, and subsequently generate •OH radicals causing DNA lesions, e.g., 8-hydroxydeoxyguanosine. It has been shown that DNA polymerases misincorporate dAMP across 8-hydroxydeoxyguanosine in templates and subsequently result in G‚C f T‚A transversions (45, 46). Moreover, Cr(III) also increases polymerase bypass ROS-induced DNA damage


(31). Thus, ROS may also play a role in Cr(III) mutagenesis. The molecular mutagenicity of hydrogen peroxide, singlet oxygen, and peroxynitrite has been studied using shuttle vector systems (42, 47, 48). Among the singlebase substitutions enhanced in the supF gene in H2O2treated monkey CV-1 cells, hot spots occurred at positions 133, 159, and 168 (42); only position 133 was a hot spot for Cr(III). Singlet oxygen induced mainly G‚C f T‚A and G‚C f C‚G in the supF gene replicated in monkey COS7 cells (47). Nevertheless, Cr(III)-induced mutational hot spots are different from those derived from singlet oxygen treatment. The mutational hot spots induced by peroxynitrite-treated pSP189 replicated in human 293 cells were at positions 113, 124, 133, 156, and 164 predominantly with G‚C f T‚A involved (48); positions 133 and 164 are also Cr(III) hot spots, but the major kinds of base substitutions were G‚C f C‚G. At present, the mutagenicity of other ROS-induced base damage leading to G‚C f C‚G transversions remains unexplored. Snow and Xu have shown that replication of Cr(III)treated single-stranded phage DNA in vitro or in bacteria enhanced the mutation frequency 2-3-fold above that of untreated controls (30). Cr(III)-enhanced reversion mutagenesis was significantly potentiated in mismatch repair-deficient E. coli strains under non-SOS conditions but not after SOS-induction, suggesting that either mismatch repair or SOS-associated processes decreased Cr(III) mutagenesis (31). Additionally, Cr(III) enhanced C f A transversions in that reversion mutagenesis assay system (31). Hexacoordinate Cr(III) aromatic bidentate amines can induce reversion mutations in Salmonella assay with T‚A base pair mutant strains (29). Those reversion assays, however, were incapable of detecting the guanine-specific mutagenesis observed here. Nevertheless, whether Cr(III) can enhance DNA damage in cytosine, adenine, or thymine that could subsequently lead to mutations in other cells requires further investigation. Recently, Juedes and Wogan reported a spontaneous supF mutational spectrum derived from a pool of untreated and KNO3-treated pSP189 replicated in human 293 cells (48). The locations of spontaneous base substitutions in the supF gene observed in this study were quite different from those reported by Juedes and Wogan (48). This may partly be due to different transfection protocols being performed, which could influence mutational hot spots (49). As discussed above, Cr(III)-mediated DNA-DNA crosslinks may enhance gene deletions and rearrangements. Strand breakage induced by ROS in Cr(III)-DNA may also be the etiology of gene deletions. However, these DNA lesions are repaired much faster then Cr(III)mediated cross-links (7, 50). Our previous study of the Cr(VI)-induced mutational spectrum showed that T‚A base pair transversions are the major kinds of mutations induced by three Cr(VI) compounds in the hypoxanthine (guanine) phosphoribosyltransferase gene of Chinese hamster ovary cells (10). Cr(VI) compounds also induce revertants in Salmonella typhimurium strains that are sensitive to oxidative damages, leading to T‚A base pair substitutions (51). However, Cr(VI) induces more G‚C than T‚A base substitutions in TK6 human lymphoma cells (11). These contradictory results for Cr(VI) mutational specificity could possibly be due to different antioxidant machinery,


Cr(VI) metabolic pathways, and DNA repair capabilities existing in those cell lines. At present, determining which forms of chromium metabolites and DNA lesions induced during Cr(VI) reduction cause each specific kind of mutation remains a vital challenge. Nevertheless, this study has clearly indicated that Cr(III) enhances G‚C base pair substitutions and gene deletions.

Acknowledgment. The authors would like to thank the National Science Council, Republic of China, for financial support of the work presented in this manuscript under Contract No. NSC85-2621-B007-003Z.

References (1) Anderson, R. A. (1993) Recent advances in the clinical and biochemical effects of chromium deficiency. In Essential and Toxic Trace Elements in Human Health and Disease: An Update (Prasad, A. S., Ed.) Vol. 380, pp 221-234, Wiley-Liss Inc., New York. (2) IARC. (1990) Chromium, nickel, and wedding. In IARC Monographs on the evaluation of the carcinogenic risks of chemicals to humans, Vol. 19, International Agency for Cancer Research, Lyon. (3) Langa˚rd, S., and Norseth, T. (1986) Chromium. In Handbook on the Toxicology of Metals, 2nd ed. (Friberg, L., Nordberg, G. F., and Vouk, V., Eds.) pp 185-210, Elsevier Science, Amsterdam. (4) Sen, P., and Costa, M. (1986) Incidence and localization of sister chromatid exchanges induced by nickel and chromium compounds. Carcinogenesis 7, 1527-1533. (5) Sen, P., Conway, K., and Costa, M. (1987) Comparison of the localization of chromosome damage induced by calcium chromate and nickel compounds. Cancer Res. 47, 2142-2147. (6) Biedermann, K. A., and Landolph, J. R. (1990) Role of valence state and solubility of chromium compounds on induction of cytotoxicity, mutagenesis, and anchorage independence in diploid human fibroblasts. Cancer Res. 50, 7835-7842. (7) Manning, F. C. R., Blankenship, L. J., Wise, J. P., Xu, J., Bridgewater, L. C., and Patierno, S. R. (1994) Induction of internucleosomal DNA fragmentation by carcinogenic chromate: relationship to DNA damage, genotoxicity, and inhibition of macromolecular synthesis. Environ. Health Perspect. 102 (Suppl. 3), 159-167. (8) Ye, J., Zhang, X., Young, H. A., Mao, Y., and Shi, X. (1995) Chromium(VI)-induced nuclear factor-κB activation in intact cells via free radical reactions. Carcinogenesis 16, 2401-2405. (9) Kim, G., and Yurkow, E. J. (1996) Chromium induces a persistent activation of mitogen-activated protein kinases by a redoxsensitive mechanism in H4 rat hepatoma cells. Cancer Res. 56, 2045-2051. (10) Yang, J.-L., Hsieh, Y.-C., Wu, C.-W., and Lee, T.-C. (1992) Mutational specificity of chromium(VI) compounds in the hprt locus of Chinese hamster ovary-K1 cells. Carcinogenesis 13, 2053-2057. (11) Chen, J., and Thilly, W. G. (1994) Mutational spectrum of chromium(VI) in human cells. Mutat. Res. 323, 21-27. (12) Lu, Y.-Y., and Yang, J.-L. (1995) Long-term exposure to chromium(VI) oxide leads to defects in sulfate transport system in Chinese hamster ovary cells. J. Cell. Biochem. 57, 655-665. (13) Tsapakos, M. J., and Wetterhahn, K. E. (1983) The interaction of chromium with nucleic acids. Chem.-Biol. Interact. 46, 265277. (14) Koster, A., and Beyersmann, D. (1985) Chromium binding by calf thymus nuclei and effects on chromatin. Toxicol. Environ. Chem. 10, 307-313. (15) Hneihen, A. S., Standeven, A. M., and Wetterhahn, K. E. (1993) Differential binding of chromium(VI) and chromium(III) complexes to salmon sperm nuclei and nuclear DNA and isolated calf thymus DNA. Carcinogenesis 14, 1795-1803. (16) Wetterhahn, K. E., Hamilton, J. W., Aiyar, J., Borges, K. M., and Floyd, R. (1989) Mechanism of chromium(VI) carcinogenesis: reactive intermediates and effect on gene expression. Biol. Trace Element Res. 21, 405-411. (17) Aiyar, J., Berkovits, H. J., Floyd, R. A., and Wetterhahn, K. E. (1991) Reaction of chromium(VI) with glutathione or with hydrogen peroxide: identification of reactive intermediates and their role in chromium(VI)-induced DNA damage. Environ. Health Perspect. 92, 53-62. (18) Shi, X., Mao, Y., Knapton, A. D., Ding, M., Rojanasakul, Y., Gannett, P. M., Dalal, N., and Liu, K. (1994) Reaction of Cr(VI) with ascorbate and hydrogen peroxide generates hydroxyl radicals


(19)

(20)

(21)

(22) (23)

(24) (25) (26)

(27)

(28)

(29) (30)

(31) (32) (33) (34)

and causes DNA damage: role of a Cr(IV)-mediated Fenton-like reaction. Carcinogenesis 15, 2475-2478. Liu, K. J., Shi, X., Jiang, J. J., Goda, F., Dalal, N., and Swartz, H. M. (1995) Chromate-induced chromium(V) formation in live mice and its control by cellular antioxidants: an L-band electron paramagnetic resonance study. Arch. Biochem. Biophys. 323, 3339. Zhitkovich, A., Voitkun, V., and Costa, M. (1996) Formation of the amino acid-DNA complexes by hexavalent and trivalent chromium in vitro: importance of trivalent chromium and the phosphate group. Biochemistry 35, 7275-7282. Hamilton, J. W., and Wetterhahn., K. E. (1989) Differential effects of chromium(VI) on constitutive and inducible gene expression in chick embryo liver in vivo and correlation with chromium(VI)induced DNA damage. Mol. Carcinogen. 2, 274-286. Liebross, R. H., and Wetterhahn, K. E. (1992) In vivo formation of chromium(V) in chick embryo liver and red blood cells. Carcinogenesis 13, 2113-2120. Sugiyama, M., Tsuzuki, K., and Ogura, R. (1991) Effect of ascorbic acid on DNA damage, cytotoxicity, glutathione reductase, and formation of paramagnetic chromium in Chinese hamster V-79 cells treated with sodium chromate(VI). J. Biol. Chem. 266, 33833386. Sugiyama, M. (1994) Role of paramagnetic chromium in chromium(VI)-induced damage in cultured mammalian cells. Environ. Health Perspect. 102 (Suppl. 3), 31-33. Sechlmeyer, U., Hechtenberg, S., Klyszcz, H., and Beyersmann, D. (1990) Accumulation of chromium in Chinese hamster V-79 cells and nuclei. Arch. Toxicol. 64, 506-508. Wise, S. J. P., Stearns, D., Wetterhahn, K. E., and Patierno, S. R. (1994) Cell-enhanced dissolution of carcinogenic lead chromate particles: the role of individual dissolution products in clastogenesis. Carcinogenesis 15, 2249-2254. Tsou, T.-C., Chen, C.-L., Liu, T.-Y., and Yang, J.-L. (1996) Induction of 8-hydroxydeoxyguanosine in DNA by chromium(III) plus hydrogen peroxide and its prevention by scavengers. Carcinogenesis 17, 103-108. Tsou, T.-C., and Yang, J.-L. (1996) Formation of reactive oxygen species and DNA strand breakage during interaction of chromium(III) and hydrogen peroxide in vitro: evidence for a chromium(III)-mediated Fenton-like reaction. Chem.-Biol. Interact. 102, 133-153. Sugden, K. D., Geer, R. D., and Rogers, S. J. (1992) Oxygen radical-mediated DNA damage by redox-active Cr(III) complexes. Biochemistry 31, 11626-11631. Snow, E. T., and Xu, L. S. (1991) Chromium(III) bound to DNA templates promotes increased polymerase processivity and decreased fidelity during replication in vitro. Biochemistry 30, 11238-11245. Snow, E. T. (1994) Effects of chromium on DNA replication in Vitro. Environ. Health Perspect. 102 (Suppl. 3), 41-44. Bridgewater, L. C., Manning, F. C. R., Woo, E. S., and Patierno, S. R. (1994) DNA polymerase arrest by adducted trivalent chromium. Mol. Carcinogen. 9, 122-133. Kraemer, K. H., and Seidman, M. M. (1989) Use of supF, an Escherichia coli tyrosine suppressor tRNA gene, as a mutagenic target in shuttle-vector plasmids. Mutat. Res. 220, 61-72. Yang, J.-L., Maher, V. M., and McCormick, J. J. (1987) Kinds of mutations formed when a shuttle vector containing adducts of (()-7β,8R-dihydroxy-9R,10R-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene replicates in human cells. Proc. Natl. Acad. Sci. U.S.A. 84, 3787-3791.

Tsou et al. (35) Yang, J.-L., Chen, R.-H., Maher, V. M., and McCormick, J. J. (1991) Kinds and location of mutations induced by (()-7β,8Rdihydroxy-9R,10R-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene in the coding region of hypoxanthine (guanine) phosphoribosyltransferase gene in diploid human fibroblasts. Carcinogenesis 12, 7175. (36) Seidman, M. M., Dixon, K., Razzaque, A., Zagursky, R. J., and Berman, M. L. (1985) A shuttle vector plasmid for studying carcinogen-induced point mutations in mammalian cells. Gene 38, 233-237. (37) Parris, C. N., and Seidman, M. M. (1992) A signature element distinguishes sibling and independent mutations in a shuttle vector plasmid. Gene 117, 1-5. (38) Sarkar, S., Dasgupta, U. B., and Summers, W. C. (1984) Errorprone mutagenesis detected in mammalian cells by a shuttle vector containing the supF gene of Escherichia coli. Mol. Cell. Biol. 4, 2227-2230. (39) Yang, J.-L., Maher, V. M., and McCormick, J. J. (1988) Kinds and spectrum of mutations induced by 1-nitrosopyrene adducts during plasmid replication in human cells. Mol. Cell. Biol. 8, 3364-3372. (40) Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (41) Thacker, J., Chalk, J., Ganesh, A., and North, P. (1992) A mechanism for deletion formation in DNA by human cell extracts: the involvement of short sequence repeats. Nucleic Acids Res. 20, 6183-6188. (42) Moraes, E. C., Keyse, S. M., and Tyrrell, R. M. (1990) Mutagenesis by hydrogen peroxide treatment of mammalian cells: a molecular analysis. Carcinogenesis 11, 283-293. (43) Toyokuni, S., Okamoto, K., Yodoi, J., and Hiai, H. (1995) Persistent oxidative stress in cancer. FEBS Lett. 358, 1-3. (44) Wiseman, H., and Halliwell, B. (1996) Damage to DNA by reactive oxygen and nitrogen species: role in inflammatory disease and progression to cancer. Biochem. J. 313, 17-29. (45) Moriya, M. (1993) Single-stranded shuttle phagemid for mutagenesis studies in mammalian cells: 8-oxoguanine in DNA induces targeted G‚C f T‚A transversions in simian kidney cells. Proc. Natl. Acad. Sci. U.S.A. 90, 1122-1126. (46) Grollman, A. P., and Moriya, M. (1993) Mutagenesis by 8-oxoguanine: an enemy within. Trends Genet. 9, 246-249. (47) de Oliveira, R. C., Ribeiro, D. T., Nigro, R. G., Mascio, P. D., and Menck, C. F. M. (1992) Singlet oxygen induced mutation spectrum in mammalian cells. Nucleic Acids Res. 16, 4319-4323. (48) Juedes, M. J., and Wogan, G. N (1996) Peroxynitrite-induced mutation spectra of pSP189 following replication in bacteria and in human cells. Mutat. Res. 349, 51-61. (49) Seetharam, S., and Seidman, M. M. (1992) Modulation of ultraviolet light mutational hotspots by cellular stress. J. Mol. Biol. 228, 1031-1036. (50) Xu, J., Manning, F. C. R., and Patierno, S. R. (1994) Preferential formation and repair of chromium-induced DNA adducts and DNA-protein crosslinks in nuclear matrix DNA. Carcinogenesis 15, 1443-1450. (51) Sugden, K. D., Burris, R. B., and Rogers, S. J. (1990) An oxygen dependence in chromium mutagenesis. Mutat. Res. 244, 239-244.

TX970040P

Mutational Spectrum Induced by Chromium(III) in Shuttle Vectors

Recommend Documents