Nanoarrays on Passivated Aluminum Surface for Site-Specific

Subscriber access provided by Washington University | Libraries

Article

Nanoarrays on Passivated Aluminum Surface for Site-specific Immobilization of Biomolecules Shiyu Li, Shuangshuang Zeng, Lei Chen, Zhen Zhang, Klas Hjort, and Shi-Li Zhang ACS Appl. Bio Mater., Just Accepted Manuscript • DOI: 10.1021/acsabm.8b00037 • Publication Date (Web): 04 Jun 2018 Downloaded from http://pubs.acs.org on June 5, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Bio Materials

Nanoarrays on Passivated Aluminum Surface for Site-specific Immobilization of Biomolecules Shiyu Li1, Shuangshuang Zeng1, Lei Chen2, Zhen Zhang1, Klas Hjort1, Shi-Li Zhang1* 1

Department of Engineering Sciences, The Ångström Laboratory, Uppsala University, SE-751 21 Uppsala, Sweden

2

Department of Immunology, Genetics and Pathology, Science for Life Laboratory, Uppsala University, SE-752 37 Uppsala, Sweden ∗

To whom correspondence should be addressed: [email protected]

Abstract：：The rapid development of biosensing platforms for highly sensitive and specific detection raises the desire of precise localization of biomolecules onto various material surfaces. Aluminum has been strategically empolyed in the biosensor system due to its compatiblity with CMOS technology and its optical and electrical properties, such as prominent propagation of surface plasmons. Herein, we present an adaptable method for preparation of carbon nanoarrays on aluminum surface passivated with poly(vinylphosphonic acid) (PVPA). The carbon nanoarrays were defined by means of electron beam induced deposition (EBID) and they were employed to realize site-specific immobilization of target biomolecules. To demonstrate the concept, selective streptavidin/neutravidin immobilization on the carbon nanoarrays was achieved through protein physisorption with a significantly high contrast of the carbon domains over the surrounding PVPA-modified aluminum surface. By adjusting the fabrication parameters, local protein densities could be varied on similarlysized nanodomains in a parallel process. Moreover, localization of single 40 nm biotinylated beads was achieved by loading them on the neutravidin-decorated nanoarrays. As a further

1 ACS Paragon Plus Environment

ACS Applied Bio Materials 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

demonstration, DNA polymerase with a streptavidin tag was bound to the biotin-beads that were immoblized on the nanoarrays and in situ rolling circle amplification (RCA) was subsequently performed. The observation of organized DNA arrays synthesized by RCA verified the nanoscale localization of the enzyme with retained biological activity. Hence, the presented approach could provide a flexible and universal avenue to precise localizing various biomolecules on aluminum surface for potential biosensor and bioelectronic applications.

Keywords: aluminum, nanoarrays, biomolecules immobilization, electron beam induced deposition (EBID), polymerase, DNA, rolling circle amplification (RCA)


Page 2 of 32

Page 3 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Localization of target biomolecules at high spatial-resolution is of paramount importance in various biological and medical applications such as biosensors, diagnostics, drug discovery and fundamental cell studies.1-4 For example, an efficient loading of long-length DNA strands into a zero-mode waveguide array greatly improves single-molecule real-time DNA sequencing.5, 6 Likewise, placement of proteins onto plasmonic nanoantennas is crucial for sensitive detection by surface plasmon resonance related analytical tools.7, 8 In addition, a well-controlled nanoscale organization of designed peptides and specific ligands on a planar surface allows a precise mimicking of extracellular nanoenvironment for the investigation of cell-material interactions.9, 10 For all the applications mentioned here, an accurate positioning and a selective immobilization of biological entities with retained biofunctionality have to be fulfilled. To realize manipulation of proteins, DNA and oligopeptides at nanoscale precision, a variety of bionanopatterning techniques have been studied.2, 11 Current methodologies comprise topdown strategies including dip-pen nanolithography,12 nanocontact printing,13 and nanoimprint lithography14 as well as alternative bottom-up approaches such as block copolymer micelle nanolithography15 and nanosphere lithography.16 Each approach is confined with its own limitations with respect to throughput, resolution, cost, complexity, and compatibility with the process flow. For instance, while dip-pen nanolithography permits direct-write patterning with a resolution of sub-50 nm and flexibility of tuning local biomolecule densities, it suffers from a very low throughput. In contrast, block copolymer micelle nanolithography can produce sub-10 nm sized domains over a large area in high throughput and without requiring sophisticated instrumentations.17 However, it is limited by the poor ability of adjusting distribution and geometries of nanopatterns. Lately, as a direct-write resist-less nanofabrication technique, electron beam induced deposition (EBID), has been pursued to 3 ACS Paragon Plus Environment


build nanoarrays for immobilization of biomolecules.18, 19 In EBID, a substrate spot exposed to a focused electron beam can result in the localized deposition of materials from a dissociated vapor precursor.20 In comparison with electron beam lithography (EBL), which requires the multiple process steps of resist coating, development, pattern transfer by means of chemical etching or deposition, and mask removal; EBID is a more straightforward method with great versatility.21 Furthermore, due to the nature of the EBID process, the resolution limit of EBID is superior to EBL and has areported smallest feature of sub-1 nm size.22 Despite the aforementioned approaches featured with advantages and drawbacks in different aspects, further efforts have been devoted to generating nanopatterns of biomolecules on gold,23, 24 SiO2/glass,25, 26 and polymeric substrates27, 28 such as polydimethylsiloxane (PDMS). To functionalize the surface with specific recognition sites and inhibit nonspecific binding, extensive studies have been carried out using molecules with terminated thiol29 and silane30 groups, for respective anchoring on gold and SiO2/PDMS surfaces. However, as a costeffective material with unique plasmonic property and manufacturing amenability, aluminum (Al) has been receiving strongly increasing attention in applications for biosensing platforms,31-33 such as building nanophotonic devices for next generation sequencing.34 Therefore, for mixed-material biochips containing Al, it is desirable to selectively modify each material surface with specific molecules. Organophosphoric acid has been reported to passivate several metals and metal oxides, such as Al or TiO2, while not reacting with either gold or SiO2 surfaces in aqueous medium.35,

36

Moreover, the phosphonic acids display

stronger binding with metal oxides than carboxylic acids and the passivated surface can also prevent further salinization, which could be of use for functionalization of surrounding SiO2 surface.37 More importantly, simple phosphonate passivation on Al surface has been reported to show efficacies in preventing protein nonspecific adsorption,38 which is crucial for selective and sensitive detection in a complex biosensing system. Nonetheless, the lack of


Page 4 of 32

Page 5 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


further development of bionanopatterning on Al surface in a more effortless and versatile manner has restricted the use of Al-based nanodevices for precise immobilization of biomolecules in biomedical applications. Here, we report a widely accessible and adaptable approach to nanopositioning of target biomolecules on PVPA passivated Al substrate based on EBID for potential biosensor applications. We demonstrate the robust selective PVPA passivation of Al surface against the nonspecific adsorption of biomolecules, using neutravidin and oligonucleotide as examples. With the EBID technique, we can directly write carbon-containing nanofeatures on the passivated Al surface with controllable size and distribution at nanoscale precision. We show the capability of biofunctionalization of the prepared nanopatterns with a significantly high contrast for both protein and DNA. We are able to tune the local density of biomolecules by simply adjusting the fabrication parameters of the EBID process. To further demonstrate the biocompatibility and versatility of this method, we place DNA polymerase with a streptavidin tag onto the nanodomain with the assistance of an intermediate immobilization of biotinylated latex beads. We verify the well-defined localization and perseveration of enzyme activity by performing in situ rolling circle amplification (RCA) and detecting the synthesized DNA products by fluorescence microscopy. The complete process flow from nanoarray generation on passivated Al surface to nanopositoning of target biomolecules is schematically presented in Figure 1.



Figure 1. Schematic illustration of localization of target DNA polymerase and in situ RCA on PVPA-passivated Al surface via EBID nanopatterning. The procedure involves generating carbon-containing nanoarrays with controlled geometry on PVPA-terminated Al substrate, derivatization of neutravidin proteins on nanoarrays to provide specific binding sites, loading of 40 nm biotinylated latex beads for smaller binding domains and alternating binding chemistry, and site-specific immobilization of DNA polymerase with streptavidin tag and performing in situ RCA to synthesize single-stranded DNA with controlled nanoscale organization. Experimental Section Reagents and Materials. Poly(vinylphosphonic acid) (PVPA) (Mw=24000) was obtained from Polysciences (USA). 3-(N-morpholino)propanesulfonic acid,4-morpholinepropanesulfonic acid (MOPS), potassium acetate, DL-dithiothreitol (DTT) and Streptavidin-Cy3 conjugate were purchased from Sigma-Aldrich (Germany). Phosphate buffered saline (PBS, pH 7.4), Tween-20, NeutrAvidin, SlowFade Gold antifade mountant, SYBR Gold nucleic acid gel stain, 40 nm biotin-labeled latex bead with yellow-green fluorescent (Ex/Em, 505/515), ×10 reaction buffer for Phi29 DNA polymerase, dNTP mix and T4 DNA ligase were supplied by Fisher Scientific GTF AB (Sweden). DNA polymerase with a streptavidin tag from DNA/Polymerase Binding Kit P6 was bought from Pacific Biosciences (USA). The designed oligonucleotides and conjugated oligonucleotides were manufactured by Integrated DNA Technologies (Belgium). The sequences are as follows: 6 ACS Paragon Plus Environment

Page 6 of 32

Page 7 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Template (PAGE purification): 5’-p-GTTCTGTCATACAGTGAATGCGAGTCCGTCTAA CTAGTGCTGGATGATCGTCCAAAGCGATCTGCGAGACCGTATAAGAGTGTCTA-3’, Primer (Standard desalting): 5’-AAAAAAAAAATATGACAGAACTAGACACTCTT-3’, Detection probe (HPLC purification): 5’-Texas Red-CAGTGAATGCGAGTCCGTCT-3’, Biotin-modified detection probe (HPLC purification): 5’-Texas Red-CAGTGAATGCGA GTCCGTCT-Biotin-3’. PVPA Passivation on Aluminum Surface. Aluminum surface was prepared on 100 mm Si wafers with a 60 nm thick thermal oxidized SiO2 top layer. The 10 nm thick Al was deposited by physical vapor deposition (PVD) (PVD 75, Kurt J. Lesker, USA). The wafer was then sliced to chips of 1 cm by 1 cm in size for further processing. The chips were cleaned with acetone in ultrasonic bath for 10 min and successive isopropanol rinses, dried with nitrogen flow and then treated with oxygen plasma (PVA TePla, Germany) at 1000 W for 5 min. Next, the chips were incubated with preheated 2 vol% aqueous solution of PVPA for 2 min at 90 °C, shortly rinsed with deionized water and dried with nitrogen afterwards. Finally, the chips were placed in an oven to anneal at 80 °C for 15 min. Preparation of Micropatterned Surface. The micropatterned surfaces were fabricated on 100 mm Si wafers with a 60 nm thick layer of SiO2. The photolithography setup was operated in a Class 100 cleanroom. For the Al micropattern, a standard UV photolithography combined with thermal evaporation of 10 nm Al film and lift-off process were performed with Shipley 1813 photoresist (MicroChem, USA). The patterned wafers were sliced to chips of 1 cm by 1 cm in size for the following experiments. X-ray Photoelectron Spectroscopy (XPS) Analysis. The selective PVPA passivation on the Al patterned SiO2 surface was characterized by XPS. All measurements were performed on a Physical Electronics Quantum 2000 Scanning ESCA microprobe (Physical Electronics, USA) 7 ACS Paragon Plus Environment


with monochromatized Al Kα X-ray source (hν = 1486.7 eV). The analyzing spot was 200 µm and a pass energy of 23.5 eV was used for high-resolution spectra of P 2p and Al 2p. Fabrication of Carbon Nanoarrays by Electron Beam Induced Deposition (EBID). The PVPA passivated surfaces for nanopatterning were prefabricated with 50 nm thick gold marks, for a precise alignment and convenient localization. Nanoarrays on PVPA layer were generated by an electron beam lithography (EBL) system (nB5, NanoBeam, UK). The global focus mapping fitted with 1st polynomial functions was calibrated and calculated with four gold registration marks in the chip corners to give an optimal focus value for a local region. The accelerating voltage was 80 kV and the background pressure was below 2·10-6 Torr in the sample chamber during the writing. The exposure was carried out with a beam current around 6 nA and a fixed beam step size of 1 nm. To provide varied electron doses under the given beam current, the exposure was adjusted by the integral dwell time of the beam in each target domain and the minimal area dose increment was set as 1 C/m2. Morphological Characterization of Nanopatterned Surface. The carbon nanoarrays on PVPA passivated surface were observed in a scanning electron microscope (SEM, Leo1550, Zeiss, Germany). To avoid carbon nanodomain damage by the electron beam, a lower accelerating voltage of 1.2 kV was used with 20 µm aperture at a 2.8 mm working distance. Atomic force microscopy (AFM) analysis of nanopatterned surface was characterized by an XE150 scanning probe microscope (PSIA, Korea). Samples were measured in an intermittent non-contact mode with cantilever from Bruker (USA). All the AFM images were obtained with a resolution of 512 × 512 pixels and a scan rate of 1 Hz/line. Adsorption Assays of Protein and DNA on Micropatterned Surface. For protein adsorption assays, the chips were incubated with 60 µL of 50 nM neutravidin in a MOPS buffer (50 mM MOPS, pH 7.4, 75 mM potassium acetate, 5 mM DTT, 0.05% Tween-20) at room temperature for 30 min and rinsed with deionized water. The localization of neutravidin 8 ACS Paragon Plus Environment

Page 8 of 32

Page 9 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was detected by 15 min incubation with 0.01% 40 nm biotin-labeled beads, rinsed with water for 5 times and dried by blowing nitrogen. For DNA adsorption assays, the chips were incubated with 60 µL of 100 nM Texas Red-modified oligonucleotides in PBS buffer (pH 7.4) at 45 °C for 30 min, rinsed with PBS buffer and water and dried with nitrogen. Nanoscale Localization of Target Biomolecules and Biotin-Labeled Beads. The nominal 100 and 200 nm nanoarrays fabricated on the PVPA passivated Al surface with an electron dose of 115 C/m2 were used to carry out the biofunctionalization assays. The interval between each nanodomain was set as 1.5 µm due to the diffraction limit of optical read-out. For protein adsorption assay, Cy3 labeled streptavidin was used for a direct visualization of protein localization. The selective adsorption of proteins on the nanoarrays was examined by incubating the nanopatterned chip surface with 50 µL of 100 nM Streptavidin-Cy3 in a MOPS buffer (pH 6.5, 0.01% Tween-20) at room temperature for 1 h. Subsequently, the chips were washed with the same buffer and deionized water to remove the redundant proteins. The capacity of direct adsorption of DNA on nanoarrays was tested by incubating the surface with 50 µL of 1 µM Texas Red-modified oligonucleotides in PBS buffer (pH 7.4) at 45 °C for 1 h. Afterward, the surfaces were rinsed with PBS buffer and wafer. The specific immobilization of biotin-labeled beads and biotin-modified DNA strands was carried out on neutravidin-decorated nanoarrays. For generating such nanoarrays, the samples were incubated with 100 nM neutravidin in a MOPS buffer (pH 6.5) at room temperature for 1 h, followed by similar washing treatment as described above. Then, the surfaces were incubated, with 0.01% 40 nm biotin-labeled fluorescent beads in PBS buffer for 15 min and 100 nM biotin-modified oligonucleotides with Texas Red label in PBS buffer for 30 min, respectively. Finally, the samples were washed by successive PBS buffer and water rinses. All the samples were mounted with SlowFade Gold antifade mountant and immediately observed with fluorescence microscopy. 9 ACS Paragon Plus Environment


DNA Polymerase Binding and Rolling Circle Amplification (RCA). For preparing circular and primed DNA templates, DNA ligation was performed by incubating 5’-phosphorylated template and primer at a 1:3 concentration ratio with T4 DNA ligase (2U/µL) in 1× T4 DNA ligase buffer solution (40 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, 5 mM ATP) at 37 °C for 1.5 h, followed by inactivation at 65 °C for 10 min. For binding polymerase to template, polymerase (10 nM) was incubated with primer-bound template (30 nM) in a Binding Buffer v2 (Pacific Biosciences) at 30 °C for 30 min, and finishing all preparations with a hold at 4 °C. To bind the polymerase/template complex on the biotinylated nanoarrays, the nanopatterned chips were incubated with the polymerase/template complex solution on ice for 30 min. Subsequently, the chip surfaces were gently rinsed 5 times with ice-cold 1× reaction buffer for Phi29 DNA polymerase (33 mM Tris-acetate, 10 mM magnesium acetate, 66 mM potassium acetate, 1 mM DTT, 0.1% Tween-20). To initiate RCA by immobilized polymerase, the chip surfaces were incubated with 1× reaction buffer for Phi29 DNA polymerase with additional 10 µM each of dATP, dCTP, dGTP and dTTP at 37 °C for 70 min, followed by 5 times MOPS buffer washing. The RCA product was labeled by incubation with the detection probe (100 nM) at 45 °C for 30 min, followed by 3 times of MOPS buffer rinses. Finally, samples were mounted with SlowFade Gold antifade mountant to protect fluorescent dyes from fading during fluorescence microscopy. Fluorescence Microscopy and Image Analysis. The fluorescence micrographs of micropatterned surface were captured by an inverted fluorescence microscope (IX73, Olympus, Japan) equipped with a digital CMOS camera (OCRA-Flash4.0 LT, Hamamatsu). Fluorescence scanning of biomolecule immobilized nanostructured surface was conducted with a commercial inverted fluorescence confocal microscope (AxioObserver LSM700, Zeiss, Germany). For all measurements, a 63× oil objective (Plan-Apochromat 63×/1.40 DIC M27, Zeiss) was used and illuminated either with an emission laser line of 488 nm or 555 nm. 10 ACS Paragon Plus Environment

Page 10 of 32

Page 11 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Images were captured by a photomultiplier tube (PMT) detector either with a detection wavelength of 500-800 nm or 560-800 nm. Exposure time was set to 0.67 µs/pixel and other parameters, including laser power, detector gain and pinhole size, were kept constant among the same experimental group. Images were processed and analyzed by using Fiji/ImageJ software (freely available at http://www.nih.gov). Estimation of Beads Localization Number on Nanoarrays. To estimate the population of biotinylated latex beads localized on different nanoarrays, the bead loading was assumed to follow the Poisson distribution. The percentage of occupancy with single, double, triple and multiple (higher than triple) beads could be derived from zero-loading fractions based on the Poisson statistics. With an average bead occupancy λ, the percentage p of nanoarrays occupied by k biotinylated beads is given as:

; =

1 !

The percentage of zero-bead occupancy is:

; 0 = × 100 2 Solving (2) for λ and substituting it into (1) yield an expression for the percentage of varied number-of-beads occupancy as a function of the percentage of zero-bead occupancy on nanoarrays:

; =

; 0− ln; 0 3 !

The percentages of zero-bead occupancy on the 100 and 200 nm nanoarrays, ; 0, were obtained from the statistical data shown in Figure 6b. The fraction of single polymerase immobilization on the beads was also calculated using the same route by knowing the fraction of empty polymerase loaded nanodomains.



Results and Discussion Selective Passivation of Aluminum Surface against Adsorption of Biomolecules To demonstrate the viability of selective passivation of Al against nonspecific adsorption of biomolecules, arrays of square Al micropatterns were fabricated on SiO2 surface to perform PVPA derivatization and biomolecule adsorption assays. The molecular structure of PVPA is shown in Figure 2a, with each molecule containing about 200 phosphonic acid groups. A thermal deposition process was carried out to treat the patterned mixed material surface with aqueous PVPA solution as described in Materials and Methods. With a thin layer of native Al2O3 on the Al surface, the phosphonic acid groups can specifically react with the hydroxyl groups to form Al-O-P bonds.39 In contrast, no stable PVPA layer can form on the SiO2 surface in the aqueous medium, due to the hydrolysis of Si-O-P bonds.36 The selective deposition of PVPA on Al was confirmed using XPS (Figure 2b). The typical P 2p peak at 135 eV observed in PVPA-treated Al surface indicates the successful passivation of Al by PVPA. The weak peak at 133 eV on the untreated Al surface is assigned to Al 2s plasmon loss peak, which is a common interference peak for assignment of P 2p.40 The absence of P 2p peak on the PVPA treated SiO2 surface verified the selectivity of phosphonate chemistry.


Page 12 of 32

Page 13 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Selective passivation of Al against nonspecific adsorption of protein and DNA by PVPA modification. (a) Molecular structure of PVPA. (b) XPS spectra of P 2p on PVPAtreated and untreated Al surfaces. (c) Fluorescence micrographs of neutravidin (green) and oligonucleotide (red) adsorption on Al micropatterns on top of SiO2, with (w/) and without (w/o) PVPA treatment. (Scale bars, 20 µm.) Neutravidin was visualized with the assistance of biotinylated fluorescent latex beads, and the oligonucleotide was labeled with Texas Red dye. (d) Quantitative results of the fluorescence intensity on the two material surfaces with or without PVPA treatment. Mean values and standard deviations from four independent experiments are presented. Background correction was performed for each group.

The PVPA-mediated anti-adsorption property was investigated by incubating the micropatterned surface with neutravidin and oligonucleotide as two test biomolecules. The presence of neutravidin was visualized with the assistance of biotinylated fluorescent latex beads and the oligonucleotide was directly labeled with Texas Red dye. A demonstration to validate the antifouling property of the PVPA layer is shown in Figure 2c. Without PVPA treatment, both neutravidin and oligonucleotide could adsorb to the Al surface with high density. The obvious fluorescence on bare SiO2 region also indicates a strong neutravidin physisorption on SiO2. The higher signal level from the Al area comparing to that from the SiO2 substrate was mainly caused by the proximity of the fluorescent bead to the metal.41 On 13 ACS Paragon Plus Environment


the PVPA-treated surfaces, the adsorption of neutravidin and oligonucleotide on Al surface was substantially suppressed and an excellent contrast of neutravidin adsorption over the surrounding SiO2 surface was observed. Quantitative intensity analysis of the fluorescence micrographs verified that the PVPA-passivated Al surface was effectively repellent to neutravidin and oligonucleotide (Figure 2d). The mean fluorescence intensity for neutravidin and oligonucleotide on the PVPA-treated Al regions was very weak, nearing the background level. In comparison to the untreated Al surface, the signal levels on the PVPA-treated Al surface were reduced by about 25 and 35 times, respectively, for neutravidin and oligonucleotide. It is well established that proteins can physically adsorb onto solid-state surfaces through electrostatic and hydrophobic interactions. In this case, the large amounts of neutravidin adsorbed on Al could be dominated by the electrostatic interaction of the negatively charged neutravidin (isoelectric point = 6.3) and positively charged Al2O3 surface (point of zero charge around 8)42 at the physiological pH of 7.4. Therefore, on account of the abundant phosphonic acid side groups, the PVPA passivation layer provides a negatively charged surface against the physisorption of neutravidin. The presence of negative charge on the PVPA surface is also supported by the report of a zeta potential of -11.02 mV on PVPA-based nanoparticles at pH 7.4.43 Similarly, it can also effectively prevent the chemisorption of negatively charged oligonucleotide, which can covalently react with Al2O3 through phosphate backbone.44 In addition, without adding neutral detergent (Tween 20) during the protein incubation step, the fluorescence intensity from untreated Al surface was appreciably higher but with a similar low level on the PVPA-treated Al surface, which implied that the hydrophobic interaction was also suppressed by the PVPA passivation to some extent. Although the effectiveness of PVPA passivation against nonspecific adsorption of protein and DNA can be influenced by pH of the buffer via the charge repulsion principle, the harsh


Page 14 of 32

Page 15 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


conditions deviant from physiological pH can often lead to denaturation of many proteins. One advantage of the PVPA passivation is that the organophosphonate chemistry does not require strictly controlled environmental conditions in comparison with the commonly used poly(ethylene glycol) (PEG) passivation by silanization, with which the silanzation could be precluded by, e.g., water contamination. This advantage can render it convenient for practical surface modification. An additional advantage with the PVPA passivation is that the abundant phosphonic functional groups within PVPA molecules could help to form a denser layer that that of the self-assembled monolayer of PEG molecules. Dense layers formed by phosphonic acid-based passivation have been extensively used for the protection of metals from corrosion45 and they can also be used as the passivation layer against surface silanization.37 In conclusion, the PVPA passivation of Al exhibited prominent effects in preventing nonspecific adsorption of biomolecules. Preparation and Characterization of Nanopatterns by EBID For nanopatterning on the PVPA-passivated Al surface, a commercial EBL system was employed to conduct EBID with the benefit of high reproducibility in defining designed patterns. The Al substrate is suitable for direct e-beam writing, because it can dissipate electrical current and minimize electrostatic charging, which is crucial in preserving the deposition resolution. Under electron beam irradiation, the volatile carbon residue in the EBL chamber and the PVPA layer in the exposed area can be decomposed. Both processes contribute to the deposition of the reduced carbon on the irradiated region. As a result, the formation of carbon-containing nanodomains on PVPA-passivated surface will mirror the geometrical arrangement of the e-beam exposure. Carbon square domain arrays of nominal 100 nm lateral length were generated on the PVPA-passivated Al surface and the designed square domains ended with a rounded profile (Supporting Information, Figure S1a).



The main technical parameters that govern the electron beam writing process are the primary beam energy, the beam current and the dwell time.46 The dissociation and deposition process are mainly induced by secondary electrons in the energy range below 50 eV, which are generated by primary electrons and backscattered electrons.47 An accelerating voltage of 80 kV and a beam current of 6 nA were used for all nanofabrication processes in this work. Since the beam energy and current are often kept stationary during one-off writing, the electron dose is a dominant factor to influence the formation of carbon nanodomains, which is determined by the dwell time of the electron beam. The electron dose was varied from 4 to 115 C/m2 in this study to examine the dose effects on the lateral dimension of the nanodomains. When changing the dose from 55 C/m2 to 115 C/m2, the side length was slightly increased from 110 nm to 125 nm for the nominal 100 nm square nanodomains and was kept almost constant around 214 nm for the nominal 200 nm domains (Supporting Information, Figure S1b). Hence, the electron dose only had a minor influence on the written feature size, which is consistent with previous reports.48,

49

As observed under SEM (Supporting Information, S1c), the

broadening of the lateral dimension of the nanodomains varied approximately from 5% to 20% with the various doses used. One hypothesis is that this phenomenon was caused by the deposition of dissociated molecules on the side flanks of the nanodomains induced by secondary electrons emitted from the nanodomains.47 The nanodomain profile was difficult to recognize below 20 C/m2 electron dose under SEM, which implied that the amount of carbon material at such conditions was too low to produce distinguishable secondary electron contrast (Supporting Information, Figure S2). It is worth mentioning that the nanodomains were fabricated on the designated surface area for convenient localization in virtue of the alignment with prefabricated gold marks in the EBL system. With this capacity, carbon nanodomains could be spatially controlled with other EBL prefabricated nanostructures at nanoscale precision if they were made by using the same


Page 16 of 32

Page 17 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


alignment mark during the fabrication process. Thus, this approach can be facilely integrated in the nanofabrication process flow with an accurate spatial organization, which cannot be easily achieved with using other nanopatterning techniques such as nanoimprint lithography and nanocontact printing. Biofunctionalization of Target Nanodomains To assess the feasibility of selective biofunctionalization of the EBID fabricated carbon nanoarrays, the nanopatterned surfaces were incubated with fluorophore labeled biomolecules. The Cy3-streptavidin was selectively physisorbed to the carbon nanoarrays with a significantly higher contrast over the non-patterned passivating PVPA regions, as shown in the left image of Figure 3a. For the DNA derivatization assays, direct adsorption and indirect bio-affinity approaches were both examined by incubating biotinylated Texas Red labeled oligonucleotide with plain carbon nanoarrays and neutravidin-decorated nanoarrays. As a result, the labeled DNA molecules were unable to adsorb on the plain nanoarrays. Via biotinavidin interaction, a distinct localization of the biotinylated DNA was observed on neutravidin-decorated nanoarrays (Figure 3a). For a quantitative analysis, a factor of signal contrast extracted from the images was defined, Specificity (S), as the mean fluorescence intensity on each nanodomain divided by the background signal of an area of the same size, to evaluate the localization selectivity of biomolecules. The statistical results confirmed that outstanding localization selectivity was achieved for direct adsorption of streptavidin and neutravidin mediated binding of biotinylated DNA, on the 100 nm and 200 nm nanoarrays (Figure 3b). The very low S-value of labeled DNA on plain carbon nanoarrays verified the absence of DNA molecules on the carbon nanodomains. The higher S-value on the 200 nm domains than on the 100 nm ones for both protein and DNA arrays may be caused by a larger amount of nanolocalized biomolecules with a similar background level. One plausible explanation of this observation is that the continuity of the carbon deposit was not the same 17 ACS Paragon Plus Environment


due to the proximity effect of the EBID process. Even though the 100 nm and 200 nm nanodomains were fabricated with the same electron dose of 115 C/m2, the larger domains were exposed to a higher amount of integrated primary electrons than the smaller domains. The higher amount of the accumulated charge on the larger domains could lead to the formation of a more continuous carbon deposit, which could, in turn, provide more active sites for the adsorption of biomolecules. For the successful biofunctionalized groups, all the Svalues were over 250 and topped with 583 (Figure 3b), which demonstrated the ability of this nanopatterning method for selective immobilization of biomolecules. The mechanism underlying the excellent selective localization of streptavidin was due to the strong adsorption on carbon nanodomains and the anti-adsorption property of the PVPA layer, as described earlier. It was noted that the carbon nanodomains defined by means of EBID were suggested to be negatively charged.18, 50 Therefore, the physisorption of nearly neutral streptavidin (isoelectric point 5~6) and neutravidin (isoelectric point = 6.3) at pH of 6.5 in our study would be mainly due to the hydrophobic interaction. This hypothesis was supported by an observation of minimized protein adsorption on carbon nanodomains, when sufficient neutral detergent was added to the incubating buffer to weaken the hydrophobic interactions (Supporting Information, Figure S3). Likewise, for a negatively charged biotinylated DNA strand, it would be easy to understand that a low level of adsorption was exhibited on the plain carbon nanoarrays and a high specificity binding was obtained on the neutravidin functionalized nanoarrays via the avidin-biotin recognition. Consequently, the prepared EBID nanopatterns would provide a general biofunctionalization scheme of localizing biomolecules on target areas at nanoscale accuracy.


Page 18 of 32

Page 19 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Biofunctionalization of carbon nanoarrays with streptavidin and oligonucleotide. (a) Fluorescence images of carbon nanoarrays immobilized with fluorescently-labeled protein and DNA. The carbon nanoarrays were nominal 100 nm size written with dose of 115 C/m2. The left fluorescence image is Cy3-streptavidin-decorated nanoarrays. The middle one is the fluorescence image of neutravidin-decorated carbon nanoarrays immobilized with biotinylated Texas Red labeled oligonucleotide. The right one is the image of carbon nanoarrays directly incubated with biotinylated Texas Red labeled oligonucleotide. (Scale bar: 5 µm) (b) Statistical results of the immobilization specificity of biomolecules on different size nanoarrays from the fluorescence images represented in a. The Specificity is defined as the mean fluorescence per nanodomain divided by the nearby background signal from an area of the same size. Mean values and standard deviations from four independent experiments are presented.

To further investigate the influence of fabrication parameters on adsorption of biomolecules, the dose of electrons was systematically varied in the fabrication of the carbon nanoarrays. Adsorption of Cy3-strepavidin assay was used as an indication. In Figure 4a, representative images show the variation of fluorescence intensity with electron dose from 4 to 115 C/m2. For both 100 nm and 200 nm nanoarrays, the brightness level of streptavidin adsorbed nanoarrays was strongly dependent on the dose. A quantitative analysis (Figure 4b) shows that the fluorescence intensity was notably increased with the electron dose. For the 200 nm nanoarrays, the fluorescence signal was increased with the dose by more than 10 times of the lowest intensity level. The fluorescence rose slowly in the dose range below 15 C/m2 for both 19 ACS Paragon Plus Environment


different nanoarray sizes. In particular, a steep increase was observed in the range of 15 to 55 C/m2 on the 200 nm nanoarrays. For both sizes of nanoarrays, the fluorescence tended to approach a plateau when the electron dose was above 80 C/m2.

Figure 4. Effects of electron dose on the adsorbed amount of streptavidin on nanodomains. (a) Fluorescence images of the Cy3-streptavidin-decorated nanoarrays for different design sizes and electron doses. The doses increase ranging from 4 to 115 C/m2 (from the top left subarray to the bottom right one). (b) The fluorescence intensity per dot increases with the dose per domain. Mean values and standard deviations from four independent experiments are presented. (c) Representative fluorescence images of Cy3-streptavidin-decorated 100 nm nanoarrays with two different doses. (Scale bar: 5 µm) (d) 3D-representation of the fluorescence intensity plots corresponding to the images in c. (e) Histogram analysis of the intensity of the fluorescence in the images in c. 20 ACS Paragon Plus Environment

Page 20 of 32

Page 21 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The increase of fluorescence with the electron dose was likely owing to an increased amount of adsorbed proteins. Based on the aforementioned observation of domain size evolution with the electron dose, the change of lateral dimension should only have a minor effect on the amount of protein adsorption. By referring to the mechanism for the formation of carbon nanodomain, the observed behavior of protein adsorption on nanodomains was likely connected to the local surface chemistry and roughness of the domain. The carbon domains written with electron dose below 20 C/m2 looked vague under SEM inspection, which would imply that the deposition of carbon material was inefficient under such conditions. In this regard, the low amount of adsorbed proteins could be interpreted as a result of insufficient deposition of carbon on the electron-beam exposed area. As the exposure time was increased, the accumulation of adsorbed carbon would lead to the formation of a continuous carbon layer, which should alter the property of local surface including chemistry and roughness. Therefore, a significant increase of adsorbed protein on the carbon domains was observed in this regime on the 200 nm nanoarrays. Whereas a further increase of exposure time would merely result in a thickened carbon layer, the amount of protein physisorbed on a given area was saturated with unchangeable surface properties, which could account for the observation of an almost constant fluorescence signal at high electron doses. This dose-dependent behavior of protein adsorption could be used to tune the local density of biomolecules within a similar size region of interest. A detailed comparison of protein adsorption on the 100 nm nanoarrays at different electron doses is shown in Figure 4c-e. The average fluorescence intensity of nanodomains with 115 C/m2 was nearly 3 times higher than that with 25 C/m2, which was proportional to the protein local density, albeit not equivalent to. The histogram analysis shows that the amount of proteins localized on the nanoarrays were narrowly distributed, with a better performance at higher doses. These findings point to the adjustability 21 ACS Paragon Plus Environment


of biomolecule local densities by simply tuning the electron dose through the presented biofunctionalization strategy. Nanopositioning of DNA Polymerase and In Situ RCA To exploit the latent capacity of the presented bionanopatterning approach, experiments of positioning streptavidin-tagged DNA polymerase on nanopatterned Al surfaces were carried out. The enzyme activity was subsequently examined by performing in situ RCA. For this purpose, fluorescent biotinylated latex beads of 40 nm in diameter were first immobilized on the neutravidin-decorated nanoarrays fabricated with various electron doses. As shown in Figure 5a, the biotinylated beads were selectively localized on the nanodomains and the bead occupation rate was influenced by the electron dose for nanoarrays of both sizes (100 and 200 nm). The statistical results show that the occupancy of biotin beads increased with the increase of electron dose, and reached a nearly stable value around 63% for the 100 nm array and 81% for the 200 nm ones (Figure 5c). This result was in agreement with the preceding result in that the amount of adsorbed streptavidin increased with the increase of electron dose. With a similar target area, a higher density of binding sites led to a higher probability of nanobeads immobilization. Thus, the dependence of the occupancy of biotinylated beads on electron dose further verified that the local protein density could be adjusted by electron dose in EBID process. As a fluorescent-independent result, the localization of biotinylated beads on the 100 nm nanoarrays was observed under SEM (Figure 5b). The AFM characterization result also confirmed the localization of the biotinylated beads on carbon nanoarrays (Supporting Information, Figure S4). From the SEM image, the majority of occupied nanodomains were found to have single and double beads localization on the 100 nm arrays due to the size exclusion effect. Hence, the biotinylated beads immobilized on the neutravidin-decorated nanoarrays via the avidin-biotin


Page 22 of 32

Page 23 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


binding should follow the Poisson-distribution throughout the nanoarrays.38, 51As a result, individual carbon nanodomains could be occupied with zero, one, two, three, or more nanosized beads. To estimate the number of beads on differently sized nanoarrays, the fluorescence intensity distribution was analyzed from the images of bead loaded nanoarrays by employing the Poisson statistics to calculate the percentage of each number group, as shown in Figure 5d. By setting an optimal fluorescence threshold, the nanodomains occupied with beads were selected as the target region to give the histogram analysis of mean fluorescence brightness. Thus, the analyzed fluorescence signal was from the nanodomains that contained one or more fluorescent biotinylated beads. For the 100 nm nanoarrays, a narrow peak of around the 500 (arbitrary unit) fluorescence level was observed, which could be ascribed to the single bead occupied nanodomains. At higher fluorescence brightness, the intensity distribution did not appear as discrete levels of integral multiples of the peak around 500, which was probably caused by the slight variation of the minimal fluorescence from individual fluorescent beads. Hence, the Poisson statistics was employed to establish the relationship between fluorescence intensity and occupancy number. As shown in Figure 5d, the calculated occupancy rate followed the profile of fluorescence intensity distribution for both size nanoarrays, indicating the expected Poisson-distributed bead loading. In a detailed analysis, the variable fluorescence fraction was correlated to the different number of beads occupancy rate, for single, double, triple and multiple occupancy. As the calculated occupancy rate noted in Figure 5d, a series of sections was defined by the same value of fluorescence fraction. With each section located in a nearly integral multiple range of the lowest range, the fluorescence per section was responsible for the corresponding localization of varied number of beads. Therefore, the observed localization behavior of biotinylated beads on neutravidindecorated nanoarrays agreed well with expectations based on the Poisson-distribution statistics. The localization yield of single biotinylated beads achieved around 30% for both



sizes of nanoarrays at a given electron dose. It is worth noting that the localization of single 40 nm bead on the 100 nm nanodomains allowed for a further confinement of the biofunctional region and alteration of binding chemistry, indicating the potential of more accurate positioning of avidin tagged biomolecules than that on simple 100 nm nanodomains.

Figure 5. Positioning of biotinylated latex beads onto neutravidin-decorated nanoarrays. (a) Fluorescence images of localization of 40 nm biotinylated latex beads on different size neutravidin-decorated nanoarrays with various doses (upper) and magnified portion of the arrays (lower) at an electron dose of 115 C/m2. (Scale bar: 5 µm) (b) SEM image of bead loaded nanoarrays with observed localization of single and double beads. (c) Statistics of bead occupancy rate with the electron dose. (d) Histogram analysis of fluorescence intensity 24 ACS Paragon Plus Environment

Page 24 of 32

Page 25 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


on biotinylated bead localized nanoarrays of different sizes and different rates of bead occupancy calculated with the Poisson statistics, except that the zero-bead occupancy rate is obtained from experimental results. The dose used for the two different sizes was 115 C/m2. Mean values and standard deviations from four independent experiments are presented. Background correction was performed for each group.

As an essential enzyme to synthesize DNA, DNA polymerase has been extensively employed for DNA cloning, sequencing, labeling and other applications.52, 53 To further demonstrate the compatibility and extensibility of the presented bionanopatterning approach, DNA polymerase with a streptavidin tag was positioned on the biotinylated bead loaded nanoarrays and in situ RCA was subsequently performed to detect the activity and localization of the immobilized polymerase. Before loading onto the biotinylated nanoarrays, the streptavidin tagged DNA polymerase was firstly bound to a circular template/primer. After multiple washing steps to eliminate nonspecifically adsorbed polymerase/template complex, subsequent in situ RCA on the patterned surface was carried out to synthesize single-stranded DNA containing repetitive sequences complementary to the circular template. Using complementary Texas Red-labeled oligonucleotides as a probe, the amplified DNA strands were detected by fluorescence microscopy (Figure 6a). As previously discussed, the carbon nanoarray was unable to directly adsorb DNA molecules, which would form the basis for the specific detection of the polymerase-synthesized DNA strands. For the nanoarrays of both sizes, an obviously organized localization of fluorescent biotinylated beads and synthesized DNA were observed. This result indicates the successful immobilization of the DNA polymerase and the preservation of the enzyme biofunctionality. The strong colocalization of two fluorescent signals of superimposed false-color images indicates that the active DNA polymerase was localized to the nanoarray via the specific avidin-biotin binding. As a control experiment without loading biotinylated beads, the polymerase/template complex was directly incubated 25 ACS Paragon Plus Environment


with plain carbon nanoarrays and in situ RCA on the patterned surface was subsequently performed. The results showed no RCA product on the patterned areas without loading the beads (Supporting Information, Figure S5), which verified that the previous positioning of DNA polymerase on the biotinylated bead loaded nanoarrays was through the avidin-biotin binding. The incapability of direct use of carbon nanoarrays for this assay could be caused by the very low amount of negatively charged DNA polymerase/template complex adsorbed on the nanodomains and the deactivation of the physisorbed enzyme.

Figure 6. Colocalization of biotinylated beads and single-stranded DNA synthesized by immobilized DNA polymerase. (a) Fluorescence micrographs of immobilized biotinylated fluorescent beads (green), DNA strand synthesized by RCA (red) and the merged images to show the colocalization. (Scale bar: 5 µm) (b) Statistical results of loading percentage of biotinylated beads, colocalized DNA polymerase and single DNA polymerase on two different nanoarrays. Mean values and standard deviations from four independent experiments are presented. For each group, over 1000 carbon nanodomains were analyzed as statistical targets.

The level of colocalization was quantitatively analyzed by a further statistical analysis of the biotinylated beads and localization of RCA product (Figure 6b). With a higher occupancy rate 26 ACS Paragon Plus Environment

Page 26 of 32

Page 27 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of biotinylated beads on the 200 nm arrays, the percentage of the colocalized DNA polymerase was also higher. The fluorescence intensity of the RCA product was determined by both the length of synthesized DNA and the number of immobilized polymerase. Similar to the previous assumption, the loading rate of single polymerase can also be estimated by using the Poisson statistics once the missing fraction of colocalization is known. Localization of approximately 10% and 30% single polymerase was achieved, respectively, for the 100 nm and 200 nm nanoarrays. From the fluorescence images, the colocalization analysis was impossible to achieve without an excellent anti-adsorption property of background passivation. The RCA performed on blank Al surface without PVPA treatment showed a very high background level and randomly distributed RCA product (Supporting Information, Figure S6). In conclusion, the combination of PVPA passivation with EBID nanopatterning allowed us to specifically position the target enzyme onto organized nanoscale domains with retained biofunctionality. Conclusions To summarize, a flexible and general strategy was demonstrated for specific immobilization of target biomolecules on passivated Al surface at nanoscale precision using electron beam induced deposition. This method permits immobilization of various biomolecules with tunable local density, controlled spatial distribution and excellent biocompatibility in an effortless fashion. The use of simple PVPA passivation offers broader options for altering surface chemistry on mixed material surfaces containing Al in a biological system. Taking advantages of combining this passivation approach with the EBID technique, protein and DNA immobilized nanoarrays can be generated with an outstanding localization contrast to nontargeted areas. The demonstration of specific positioning of DNA polymerase and in situ synthesis of DNA by means of RCA points toward the potential generalization to immobilize other enzymes via the avidin-biotin coupling. The presented versatile scheme of localizing 27 ACS Paragon Plus Environment


biomolecules of interest on passivated Al surface can contribute to the development of Al based biomedical devices, such as DNA sequencers and surface plasmon resonance sensors.

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected]. Tel.: +46 18 4717247. Note The authors declare no competing financial interest.

ASSOCIATED CONTENT Supporting Information: SEM images of carbon-nanoarrays fabricated with varied electron doses, diagram of the nanodomain size with varied electron doses, fluorescence images of Cy3-streptavidin immobilized nanoarrays with using different neutral detergent concentration, AFM image of biotinylated bead localized nanoarrays, fluorescence image of RCA carried out on plain carbon nanoarrays and that on blank aluminum surface. Acknowledgements We would like to thank Prof. U. Landegren for kindly arranging the collaboration and providing scientific support, the BioVis platform of Uppsala University and J. Adler for the assistance with image acquisition and analysis, and X. Xingxing for thoughtful discussion. This work was supported by the Swedish Research Council (621-2014-6300) and a scholarship to L. Shiyu (201606100043) from the China Scholarship Council (CSC).


Page 28 of 32

Page 29 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES (1) Lee, K. B.; Kim, E. Y.; Mirkin, C. A.; Wolinsky, S. M., The Use of Nanoarrays for Highly Sensitive and Selective Detection of Human Immunodeficiency Virus Type 1 in Plasma. Nano Lett. 2004, 4 (10), 1869-1872. (2) Mendes, P. M.; Yeung, C. L.; Preece, J. A., Bio-nanopatterning of Surfaces. Nanoscale Res. Lett. 2007, 2 (8), 373-384. (3) Drmanac, R.; Sparks, A. B.; Callow, M. J.; Halpern, A. L.; Burns, N. L.; Kermani, B. G.; Carnevali, P.; Nazarenko, I.; Nilsen, G. B.; Yeung, G; Dahl, F.; Fernandez, A.; Staker, B.; Pant, K. P.; Baccash, J.; Borcherding, A. P.; Brownley, A.; Cedeno, R.; Chen, L. S.; Chernikoff, D.; Cheung, A.; Chirita, R.; Curson, B.; Ebert, J. C.; Hacker, C. R.; Hartlage, R.; Hauser, B.; Huang, S.; Jiang, Y.; Karpinchyk, V.; Koenig, M.; Kong, C.; Landers, T.; Le, C.; Liu, J.; McBride, C. E.; Morenzoni, M.; Morey, R. E.; Mutch, K.; Perazich, H.; Perry, K.; Peters, B. A.; Peterson, J.; Pethiyagoda, C. L.; Pothuraju, K.; Richter, C.; Rosenbaum, A. M.; Roy, S.; Shafto, J.; Sharanhovich, U.; Shannon, K. W.; Sheppy, C. G.; Sun, M.; Thakuria, J. V.; Tran, A.; Vu, D.; Zaranek, A. W.; Wu, X. D.; Drmanac, S.; Oliphant, A. R.; Banyai, W. C.; Martin, B.; Ballinger, D. G.; Church, G. M.; Reid, C. A., Human Genome Sequencing Using Unchained Base Reads on Self-Assembling DNA Nanoarrays. Science 2010, 327 (5961), 78-81. (4). Huang, J. H.; Grater, S. V.; Corbellinl, F.; Rinck, S.; Bock, E.; Kemkemer, R.; Kessler, H.; Ding, J. D.; Spatz, J. P., Impact of Order and Disorder in RGD Nanopatterns on Cell Adhesion. Nano Lett. 2009, 9 (3), 1111-1116. (5) Larkin, J.; Henley, R. Y.; Jadhav, V.; Korlach, J.; Wanunu, M., Length-independent DNA Packing into Nanopore Zero-mode Waveguides for Low-input DNA Sequencing. Nat. Nanotechnol. 2017, 12 (12), 1169-1175. (6) Larkin, J.; Foquet, M.; Turner, S. W.; Korlach, J.; Wanunu, M., Reversible Positioning of Single Molecules inside Zero-Mode Waveguides. Nano Lett. 2014, 14 (10), 6023-6029. (7) Chen, K.; Guo, P. J.; Dao, T. D.; Li, S. Q.; Ishiii, S.; Nagao, T.; Chang, R. P. H., ProteinFunctionalized Indium-Tin Oxide Nanoantenna Arrays for Selective Infrared Biosensing. Adv. Opt. Mater. 2017, 5 (17), 1700091 (8) Adato, R.; Altug, H., In-situ Ultra-sensitive Infrared Absorption Spectroscopy of Biomolecule Interactions in Real Time with Plasmonic Nanoantennas. Nat. Commun. 2013, 4. (9) Wang, X.; Li, S. Y.; Yan, C.; Liu, P.; Ding, J. D., Fabrication of RGD Micro/Nanopattern and Corresponding Study of Stem Cell Differentiation. Nano Lett. 2015, 15 (3), 1457-1467. (10) Li, S. Y.; Wang, X.; Cao, B.; Ye, K.; Li, Z. H.; Ding, J. D., Effects of Nanoscale Spatial Arrangement of Arginine-Glycine-Aspartate Peptides on Dedifferentiation of Chondrocytes. Nano Lett. 2015, 15 (11), 7755-7765. (11) Yao, X.; Peng, R.; Ding, J. D., Cell-Material Interactions Revealed Via Material Techniques of Surface Patterning. Adv. Mater. 2013, 25 (37), 5257-5286. (12) Lee, K. B.; Park, S. J.; Mirkin, C. A.; Smith, J. C.; Mrksich, M., Protein Nanoarrays Generated by Dip-pen Nanolithography. Science 2002, 295 (5560), 1702-1705. (13) Li, H. W.; Muir, B. V. O.; Fichet, G.; Huck, W. T. S., Nanocontact Printing: A Route to Sub-50nm-scale Chemical and Biological Patterning. Langmuir 2003, 19 (6), 1963-1965. (14) Truskett, V. N.; Watts, M. P. C., Trends in Imprint Lithography for Biological Applications. Trends Biotechnol. 2006, 24 (7), 312-317. (15) Spatz, J. P.; Mossmer, S.; Hartmann, C.; Moller, M.; Herzog, T.; Krieger, M.; Boyen, H. G.; Ziemann, P.; Kabius, B., Ordered Deposition of Inorganic Clusters from Micellar Block Copolymer Films. Langmuir 2000, 16 (2), 407-415. (16) Haynes, C. L.; Van Duyne, R. P., Nanosphere Lithography: A Versatile Nanofabrication Tool for Studies of Size-dependent Nanoparticle Optics. J. Phys. Chem. B 2001, 105 (24), 5599-5611. (17) Glass, R.; Moller, M.; Spatz, J. P., Block Copolymer Micelle Nanolithography. Nanotechnology 2003, 14 (10), 1153-1160. (18) Schlapak, R.; Danzberger, J.; Haselgrubler, T.; Hinterdorfer, P.; Schaffler, F.; Howorka, S., Painting with Biomolecules at the Nanoscale: Biofunctionalization with Tunable Surface Densities. Nano Lett. 2012, 12 (4), 1983-1989. 29 ACS Paragon Plus Environment


(19) Hager, R.; Halilovic, A.; Burns, J. R.; Schaffler, F.; Howorka, S., Arrays of Individual DNA Molecules on Nanopatterned Substrates. Sci Rep 2017, 7. (20) van Dorp, W. F.; Hagen, C. W., A Critical Literature Review of Focused Electron Beam Induced Deposition. J Appl Phys 2008, 104 (8). (21) Lee, S. W.; Sankaran, R. M., Direct Writing via Electron-driven Reactions. Mater. Today 2013, 16 (4), 117-122. (22) van Dorp, W. F.; Zhang, X. Y.; Feringa, B. L.; Hansen, T. W.; Wagner, J. B.; Hosson, J. T. M., Molecule-by-Molecule Writing Using a Focused Electron Beam. ACS Nano 2012, 6 (11), 1007610081. (23) Ginger, D. S.; Zhang, H.; Mirkin, C. A., The Evolution of Dip-pen Nanolithography. Angew. Chem.-Int. Edit. 2004, 43 (1), 30-45. (24) Rakickas, T.; Gavutis, M.; Reichel, A.; Piehler, J.; Liedberg, B.; Valiokas, R., Protein-Protein Interactions in Reversibly Assembled Nanopatterns. Nano Lett. 2008, 8 (10), 3369-3375. (25) Hoff, J. D.; Cheng, L. J.; Meyhofer, E.; Guo, L. J.; Hunt, A. J., Nanoscale Protein Patterning by Imprint Lithography. Nano Lett. 2004, 4 (5), 853-857. (26) Lohmuller, T.; Aydin, D.; Schwieder, M.; Morhard, C.; Louban, I.; Pacholski, C.; Spatz, J. P., Nanopatterning by Block Copolymer Micelle Nanolithography and Bioinspired Applications. Biointerphases 2011, 6 (1), Mr1-Mr12. (27) Ye, K.; Wang, X.; Cao, L. P.; Li, S. Y.; Li, Z. H.; Yu, L.; Ding, J. D., Matrix Stiffness and Nanoscale Spatial Organization of Cell-Adhesive Ligands Direct Stem Cell Fate. Nano Lett. 2015, 15 (7), 4720-4729. (28) Huang, M.; Galarreta, B. C.; Artar, A.; Adato, R.; Aksu, S.; Altug, H., Reusable Nanostencils for Creating Multiple Biofunctional Molecular Nanopatterns on Polymer Substrate. Nano Lett. 2012, 12 (9), 4817-4822. (29) Love, J. C.; Estroff, L. A.; Kriebel, J. K.; Nuzzo, R. G.; Whitesides, G. M., Self-assembled Monolayers of Thiolates on Metals as a Form of Nanotechnology. Chem. Rev. 2005, 105 (4), 11031169. (30) Zucca, P.; Sanjust, E., Inorganic Materials as Supports for Covalent Enzyme Immobilization: Methods and Mechanisms. Molecules 2014, 19 (9), 14139-14194. (31) Knight, M. W.; King, N. S.; Liu, L. F.; Everitt, H. O.; Nordlander, P.; Halas, N. J., Aluminum for Plasmonics. ACS Nano 2014, 8 (1), 834-840. (32) Knight, M. W.; Liu, L. F.; Wang, Y. M.; Brown, L.; Mukherjee, S.; King, N. S.; Everitt, H. O.; Nordlander, P.; Halas, N. J., Aluminum Plasmonic Nanoantennas. Nano Lett. 2012, 12 (11), 60006004. (33) Levene, M. J.; Korlach, J.; Turner, S. W.; Foquet, M.; Craighead, H. G.; Webb, W. W., Zeromode Waveguides for Single-molecule Analysis at High Concentrations. Science 2003, 299 (5607), 682-686. (34) Eid, J.; Fehr, A.; Gray, J.; Luong, K.; Lyle, J.; Otto, G.; Peluso, P.; Rank, D.; Baybayan, P.; Bettman, B.; Bibillo, A.; Bjornson, K.; Chaudhuri, B.; Christians, F.; Cicero, R.; Clark, S.; Dalal, R.; Dewinter, A.; Dixon, J.; Foquet, M.; Gaertner, A.; Hardenbol, P.; Heiner, C.; Hester, K.; Holden, D.; Kearns, G.; Kong, X. X.; Kuse, R.; Lacroix, Y.; Lin, S.; Lundquist, P.; Ma, C. C.; Marks, P.; Maxham, M.; Murphy, D.; Park, I.; Pham, T.; Phillips, M.; Roy, J.; Sebra, R.; Shen, G.; Sorenson, J.; Tomaney, A.; Travers, K.; Trulson, M.; Vieceli, J.; Wegener, J.; Wu, D.; Yang, A.; Zaccarin, D.; Zhao, P.; Zhong, F.; Korlach, J.; Turner, S.,Real-Time DNA Sequencing from Single Polymerase Molecules. Science 2009, 323 (5910), 133-138. (35) Michel, R.; Lussi, J. W.; Csucs, G.; Reviakine, I.; Danuser, G.; Ketterer, B.; Hubbell, J. A.; Textor, M.; Spencer, N. D., Selective Molecular Assembly Patterning: A New Approach to Micro- and Nanochemical Patterning of Surfaces for Biological Applications. Langmuir 2002, 18 (8), 3281-3287. (36) Mutin, P. H.; Lafond, V.; Popa, A. F.; Granier, M.; Markey, L.; Dereux, A., Selective Surface Modification of SiO2-TiO2 Supports with Phosphonic Acids. Chem. Mat. 2004, 16 (26), 5670-5675. (37) Attavar, S.; Diwekar, M.; Linford, M. R.; Davis, M. A.; Blair, S., Passivation of Aluminum with Alkyl Phosphonic Acids for Biochip Applications. Appl. Surf. Sci. 2010, 256 (23), 7146-7150. (38) Korlach, J.; Marks, P. J.; Cicero, R. L.; Gray, J. J.; Murphy, D. L.; Roitman, D. B.; Pham, T. T.; Otto, G. A.; Foquet, M.; Turner, S. W., Selective Aluminum Passivation for Targeted Immobilization


Page 30 of 32

Page 31 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of Single DNA Polymerase Molecules in Zero-mode Waveguide Nanostructures. Proc. Natl. Acad. Sci. U. S. A. 2008, 105 (4), 1176-1181. (39) Hoque, E.; DeRose, J. A.; Kulik, G.; Hoffmann, P.; Mathieu, H. J.; Bhushan, B., Alkylphosphonate Modified Aluminum Oxide Surfaces. J. Phys. Chem. B 2006, 110 (22), 1085510861. (40) Briggs, D. Handbook of X-ray and Ultraviolet Photoelectron Spectroscopy; Heyden: London, 1977. (41) Aslan, K.; Gryczynski, I.; Malicka, J.; Matveeva, E.; Lakowicz, J. R.; Geddes, C. D., Metalenhanced Fluorescence: an Emerging Tool in Biotechnology. Curr. Opin. Biotechnol. 2005, 16 (1), 55-62. (42) Tombacz, E., pH-dependent Surface Charging of Metal Oxides. Period. Polytech.-Chem. Eng. 2009, 53 (2), 77-86. (43) Sengel, S. B.; Sahiner, N., Poly(vinyl phosphonic acid) Nanogels with Tailored Properties and Their Use for Biomedical and Environmental Applications. Eur. Polym. J. 2016, 75, 264-275. (44) Calais, T.; Playe, B.; Ducere, J. M.; Veyan, J. F.; Rupich, S.; Hemeryck, A.; Rouhani, M. D.; Rossi, C.; Chabal, Y. J.; Esteve, A., Role of Alumina Coatings for Selective and Controlled Bonding of DNA on Technologically Relevant Oxide Surfaces. J. Phys. Chem. C 2015, 119 (41), 23527-23543. (45) Zhao, R.; Rupper, P.; Gaan, S., Recent Development in Phosphonic Acid-Based Organic Coatings on Aluminum. Coatings 2017, 7 (9), 133. (46) Huth, M.; Porrati, F.; Schwalb, C.; Winhold, M.; Sachser, R.; Dukic, M.; Adams, J.; Fantner, G., Focused Electron Beam Induced Deposition: A Perspective. Beilstein J. Nanotechnol. 2012, 3, 597619. (47) Silvis-Cividjian, N.; Hagen, C. W.; Leunissen, L. H. A.; Kruit, P., The Role of Secondary Electrons in Electron-beam-induced-deposition Spatial Resolution. Microelectron. Eng. 2002, 61(2), 693-699. (48) Silvis-Cividjian, N.; Hagen, C. W.; Kruit, P.; Van der Stam, M. A. J.; Groen, H. B., Direct Fabrication of Nanowires in an Electron Microscope. Appl. Phys. Lett. 2003, 82 (20), 3514-3516. (49) Hubner, U.; Plontke, R.; Blume, M.; Reinhardt, A.; Koops, H. W. P., On-line Nanolithography Using Electron Beam-induced Deposition Technique. Microelectron. Eng. 2001, 57(8), 953-958. (50) Hager, R.; Burns, J. R.; Grydlik, M. J.; Halilovic, A.; Haselgrubler, T.; Schaffler, F.; Howorka, S., Co-Immobilization of Proteins and DNA Origami Nanoplates to Produce High-Contrast Biomolecular Nanoarrays. Small 2016, 12 (21), 2877-2884. (51) Kinz-Thompson, C. D.; Palma, M.; Pulukkunat, D. K.; Chenet, D.; Hone, J.; Wind, S. J.; Gonzalez, R. L., Robustly Passivated, Gold Nanoaperture Arrays for Single-Molecule Fluorescence Microscopy. ACS Nano 2013, 7 (9), 8158-8166. (52) Manrao, E. A.; Derrington, I. M.; Laszlo, A. H.; Langford, K. W.; Hopper, M. K.; Gillgren, N.; Pavlenok, M.; Niederweis, M.; Gundlach, J. H., Reading DNA at Single-nucleotide Resolution with a Mutant MspA Nanopore and Phi29 DNA Polymerase. Nat. Biotechnol. 2012, 30 (4), 349-353. (53) Soderberg, O.; Gullberg, M.; Jarvius, M.; Ridderstrale, K.; Leuchowius, K. J.; Jarvius, J.; Wester, K.; Hydbring, P.; Bahram, F.; Larsson, L. G.; Landegren, U., Direct Observation of Individual Endogenous Protein Complexes In Situ by Proximity Ligation. Nat. Methods 2006, 3 (12), 995-1000.



Graphic for TOC


Page 32 of 32

Nanoarrays on Passivated Aluminum Surface for Site-Specific

Recommend Documents