Article Cite This: Anal. Chem. XXXX, XXX, XXX−XXX
pubs.acs.org/ac
Near-Infrared-to-Ultraviolet Light-Mediated Photoelectrochemical Aptasensing Platform for Cancer Biomarker Based on Core−Shell NaYF4:Yb,Tm@TiO2 Upconversion Microrods Zhenli Qiu, Jian Shu, and Dianping Tang* Key Laboratory for Analytical Science of Food Safety and Biology (MOE & Fujian Province), State Key Laboratory of Photocatalysis on Energy and Environment, Department of Chemistry, Fuzhou University, Fuzhou 350108, People’s Republic of China ABSTRACT: Titanium dioxide (TiO2; as a potential photosensitizer) has good photocurrent performance and chemical stability but often exhibits low utilization efficiency under ultraviolet (UV) region excitation. Herein, we devised a near-infrared light-to-UV light-mediated photoelectrochemical (PEC) aptasensing platform for the sensitive detection of carcinoembryonic antigen (CEA) based on core−shell NaYF4:Yb,Tm@TiO2 upconversion microrods by coupling with target-triggered rolling circle amplification (RCA). The upconversion microrods synthesized through the hydrothermal reaction could act as a photosensing platform to convert the nearinfrared (near-IR) excitation into UV emission for generation of photoinduced electrons. The target analyte was determined on a functional magnetic bead by using the corresponding aptamers with a sandwich-type assay format. Upon target CEA introduction, a complex was first formed between capture aptamer-1-conjugated magnetic bead (Apt1-MB) and aptamer-2-primer DNA (Apt2pDNA). Thereafter, the carried primer DNA by the aptamer-2 paired with linear padlock DNA to trigger the RCA reaction. The guanine (G)-rich product by RCA reaction was cleaved by exonuclease I and exonuclease III (Exos I/III), thereby resulting in the formation of numerous individual guanine bases to enhance the photocurrent of core−shell NaYF4:Yb,Tm@TiO2 upconversion microrods under near-IR illumination (980 nm). Under optimal conditions, the near-IR light-mediated PEC aptasensing system could exhibit good photoelectrochemical response toward target CEA and allowed for the detection of target CEA as low as 3.6 pg mL−1. High reproducibility and good accuracy were achieved for analysis of human serum specimens. Importantly, the nearIR-activated PEC aptasensing scheme provides a promising platform for ultrasensitive detection of other biomolecules.
U
report focusing on upconversion materials for the development of PEC immunoassays by the near-infrared-to-ultraviolet light model until now. A photoelectrochemical sensing system is a distinctive signaltransduction pathway in which the photoactive materials can be excited by a suitable wavelength of light.14 The photocurrent change referring to the charge separation derives from production of electron donor/acceptor by the biological reaction during the target-recognition process.15 Recent research works on PEC sensing platform have largely developed in bioanalytical fields because of its low cost, low background signal, accessible operation, device portability, and high sensitivity.14−16 One vital issue for PEC sensing development lies in the choice of photoactive materials.17−19 Titanium dioxide (TiO2; a conventional semiconductor material) has been perceived as a promising candidate for photoelectrochemical biosensing thanks to its high photon energy and chemical stability, commercial availability, low cost, and security.20−22 Unfavorably, one major
pconversion (UC) has attracted considerable attention in various applications from optics to biology owing to the potential capacity of revolutionizing multiple technologies.1,2 Usually, upconversion is associated with an anti-Stokes process through absorption of the low-energy photons to generate the excited electrons and subsequently transfer to another species,3 thus resulting in the emission of the higher energy photons.4 Recently, upconversion materials have attracted increasing attention because of their unique characteristics such as low toxicity, low photodamage, high photostability, and sharp emission,5−7 which have been extensively deployed in different fields, e.g., photodynamic therapy,8 medical imaging,9 and solar energy.10 Lin’s group reported a novel UV-emitting photosensitizer for photodynamic therapy based on NaYF4:Yb3+,Tm3+@NaGdF4:Yb3+@TiO2 upconversion nanomaterials.11 Tsang et al. utilized BaGdF5:Yb/Er upconversion nanoprobes for the determination of Ebola virus.12 Ma et al. synthesized the infrared light-activated photocatalysts, NaYF4:Yb,Tm@ TiO2/Ag nanohybrids.13 The near-infrared-to-ultraviolet (nearIR-to-UV) light strategy provides a desirable opportunity to apply it for a photoelectrochemical (PEC) device for tumor marker detection. To the best of our knowledge, there is no © XXXX American Chemical Society
Received: October 30, 2017 Accepted: November 24, 2017 Published: November 24, 2017 A
DOI: 10.1021/acs.analchem.7b04479 Anal. Chem. XXXX, XXX, XXX−XXX
Article
Analytical Chemistry
Scheme 1. Schematic Illustration of Near-Infrared (NIR) Light-Mediated Photoelectrochemical Aptasensing Platform for Detection of Target CEA Based on NaYF4:Yb,Tm@TiO2 Upconversion Microrods with Rolling Circle Amplification (RCA)a
a
(A) Aptamer−CEA−aptamer reaction between capture aptamer-1-functionalized magnetic bead (Apt1-MB) and the aptamer-2-primer DNA conjugate (Apt2-pDNA) with a sandwich-type assay format, and the released process of guanine (G) bases followed by the RCA reaction; (B) diagram of energy transfer (ET) among lanthanide ion and TiO2 under near-IR irradiation leading to the formation of hole−electron pairs.
(Exo I) and exonuclease III (Exo III), the RCA product is digested to release numerous individual guanine (G) bases.36 The generated free guanines enhance the photocurrent of NaYF4:Yb,Tm@TiO2 upconvension microrods under the nearinfrared light excitation. The aim of this study is to explore a novel upconversion materials-based photoelectrochemical biosensing system for sensitive detection of low-abundant biomolecules in biological fluids.
limitation of using TiO2 alone relies on a narrow absorption range, since it can be only excited under ultraviolet light (wavelength, λ < 400 nm).23 Moreover, ultraviolet light is rarely applied in PEC detection due to a low fraction of solar energy (approximately 5%) and its higher energy photons, which might cause biomolecular damage and the destruction of the sensing system.24,25 To overcome the aforementioned concerns, research has looked to develop innovative and powerful photoactive materials, e.g., by depositing noble metals onto quantum dots or semiconductors.26−29 Compared with visible region illumination, the near-IR region accounts for a large proportion (about 50%) of the solar spectrum and avoids destroying biological systems due to low phototoxicity. Inspiringly, the emergence of lanthanide (Ln3+)-doped upconversion materials opens a new horizon for the development of a PEC sensing platform.30−33 Generally, a host lattice of NaYF4 is selected for the efficient upconversion materials owing to its low-phonon lattice energy. The doped Yb3+ ions can absorb the near-IR light, whereas the doped Tm3+ emitters can produce the UV light,34,35 which matches well with the characteristic absorption peak of TiO2. To this end, our motivation in this work is synthesizing core−shell NaYF4:Yb,Tm@TiO2 upconversion microrods for development of a PEC sensing platform by near-IR-to-UV light-mediated strategy. Use of the core−shell structures is expected as an optical converter to generate upconverting UV emission and re-motivate the TiO2 shell, thereby protecting the upconversion core (NaYF4:Yb,Tm) from surface quenching and increasing the photoelectric conversion efficiency. Carcinoembryonic antigen (CEA; as a glycoprotein often associated with colorectal cancer) is used to monitor patients with this type of cancer. By using CEA as a model analyte, herein we report the proof-of-concept of a sensitive and feasible PEC aptasensing platform for CEA detection based on core−shell NaYF4:Yb,Tm@TiO2 upconversion microrods (Scheme 1). The signal is acquired on the basis of near-IR-to-UV light-medicated strategy and amplified through rolling circle amplification (RCA) technique. The assay consists of the aptamer−CEA−aptamer reaction and photocurrent measurement. Two aptamers are utilized for CEA detection on a biofunctional magnetic bead with a sandwich-type assay mode. Upon aptamer−CEA−aptamer reaction, the carried primer DNA on the end of the aptamer triggers the RCA reaction, thus resulting in formation of a long G-rich oligonucleotide strand. In the presence of exonuclease I
■
EXPERIMENTAL SECTION Materials and Chemicals. YbCl3·6H2O (99.99%), YCl3· 6H2O (99.99%), TmCl3·6H2O (99.99%), TiF4 (99%), Nhydroxysulfosuccinimide (NHS), 1-ethyl-3-(3(dimethylamino)propyl)carbodiimide hydrochloride (EDC), and (N-morpholino)ethanesulfonic acid monohydrate (MES) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Oleic acid, NH4F (98%), carboxylated magnetic bead (MB; 100 nm in diameter, 5.0 mg mL−1), and poly(vinylpyrrolidone) (PVP-40) were acquired from Aladdin (Shanghai, China). All of the other chemicals were of analytical grade and used without further purification (Sinopharm Chemical Reagent Co., Ltd., China). Ultrapure water used in this work was prepared by a Millipore water purification system (18.2 MΩ cm−1, Milli-Q, Merck KGaA, Germany). All of the buffers including phosphate-buffered saline (PBS; 10 mM, pH 7.4) solution were the products of SigmaAldrich. Human serum samples were gifted from the local Fujian Provincial Hospital (Fuzhou, China). T4 DNA ligase, Phi29 DNA polymerase, Exo I, Exo III, and dNTP were obtained from Thermo Scientific (MA, USA). All oligonucleotides were acquired from Sangon Biotech Inc. (Shanghai, China), and the sequences were listed as follows: capture aptamer-1 DNA (Apt1): 5′‐NH 2AAAAAGGGGGTGAAGGGATACCC‐3′
aptamer-2-primer (Apt2-pDNA): 5′‐ATACCAGCTTATTCAATTTGAGCATAATA ‐GTTCCACAGTTAC‐3′
aptamer-2-G-rich probe (Apt2-G): 5′‐ATACCAGCTTATTCAATTGGGGGGAAGGGGGG‐3′ B
DOI: 10.1021/acs.analchem.7b04479 Anal. Chem. XXXX, XXX, XXX−XXX
Article
Analytical Chemistry
MB (25 μL, 25 mg mL−1) and Apt2-pDNA (25 μL, 1.0 μM), and then the mixture was incubated for 60 min at 37 °C under slight shaking on a shaker (note: Apt1-MB and Apt2-pDNA sandwiched the target CEA during this process, generating a complex with the primer DNA). Following that, the mixture was magnetically separated and washed with pH 7.4 PBS. The resulting precipitate was re-dispersed in a 100 μL reaction buffer containing 1× ligation buffer (pH 7.8, 40 mM Tris-HCl, 10 mM MgCl2, 10 mM dithiothreitol, and 0.5 mM ATP), T4 DNA ligase (40 U), and linear padlock DNA (10 μL, 1.0 μM), and reacted for 4 h at 37 °C (note: the circular DNA template for RCA reaction was prepared by ligation and circularization of the linear padlock DNA during this process). After magnetic separation and washing as before, the product was used for RCA reaction (induced by the primer−circular DNA on magnetic bead) in a 100 μL Tris-HAc buffer (33 mM, pH 7.9) containing MgAc2 (10 mM), KAc (66 mM), Tween 20 (0.1%, v/v), dithiothreitol (1.0 mM), dNTP (200 μM), BSA (0.1 mg mL−1), and Phi29 DNA polymerase (5 U). The reaction was carried out for 40 min at 37 °C. Subsequently, the magnetic complexes with the RCA product were collected as before. Afterward, the resultant complexes were suspended in a 100 μL reaction buffer (67 mM glycine−KOH, 6.7 mM MgCl2, and 1.0 mM dithiothreitol, pH 9.5) containing Exo I (10 U) and Exo III (10 U) in order to digest the long G-rich oligonucleotide sequences for generation of numerous individual guanine bases). Finally, the supernatant after magnetic separation was added into 3.0 mL of PBS (pH 7.4, 10 mM) for the subsequent photocurrent measurement. Photocurrent Measurement. Prior to measurement, a waterproof tape with a round hole (6.0 mm in diameter) was stuck on a cleaned fluorine−tin oxide (FTO) electrode (S ≈ 28.26 mm2). Then, the photosensitive electrode was prepared by dropping NaYF4:Yb,Tm@TiO2 upconversion microrods (20 μL, 50 mg mL−1, dispersed in ultrapure water) on the electrode and then naturally dried at RT. Following that, photocurrent measurement was carried out by using a laser irradiation (200 mW, 980 nm) as the light source on an AutoLab electrochemical workstation (μAUTIII.FRA2.v, Eco Chemie, Netherlands) at a constant potential of 0 V with a conventional three-electrode system consisting of a NaYF4:Yb,Tm@TiO2-modified working electrode, a Pt-wire counter electrode, and an Ag/AgCl reference electrode.
linear padlock DNA: 5′‐p‐TATTATGCTCACCCCCCAACCCCCCAACCCCCC ‐GTAACTGTGGAAC‐3′
The underlined sequences were two aptamers of target CEA (AGGGGGTGAAGGGATACCC and ATACCAGCTTATTCAATT), respectively. The 5′ end of padlock DNA was modified with a phosphate group. The italic/bold sequences of the linear padlock DNA were the binding region with the primer DNA for the RCA reaction. Moreover, the bold/italic letters of Apt2-pDNA were complementary with those of padlock DNA, respectively. Prior to use, all of the oligonucleotides were first heated to 95 °C for 5 min and then naturally cooled to room temperature (RT) for use. Synthesis of NaYF4:Yb,Tm Upconversion Microrods. NaYF4:Yb,Tm upconversion microrods were synthesized according to the literature with minor modification.37,38 Initially, NaOH (15 mmol) was dissolved in ultrapure water (3.0 mL) and then mixed with ethanol (10 mL) and oleic acid (10 mL) under vigorous stirring. Meanwhile, the RECl3 mixture (4.0 mL, 0.2 M) including YbCl3·6H2O, YCl3·6H2O, TmCl3·6H2O (molar ratio, Y:Yb:Tm = 79.8:20:0.2) was added into an aqueous solution of NH4F (2.0 mL, 2.0 M) under vigorous stirring for 30 min. Following that, two resulting mixtures were transferred into a 50 mL Teflon-lined autoclave and heated at 220 °C for 12 h. Finally, the obtained product (i.e., NaYF4:Yb,Tm) was washed with ultrapure water and ethanol alternately by centrifugation, and dried at 80 °C. Synthesis of Core−Shell NaYF4:Yb,Tm@TiO2 Upconversion Microrods. Prior to synthesis, 100 mg of the aboveprepared NaYF4:Yb,Tm was first dispersed homogeneously into PVP-40 (4.0 mL, 0.2 g mL−1) under stirring. Thereafter, the resultant suspension was thrown into 20 mL of ethanol and continuously stirred for 30 min at RT, followed by addition of TiF4 (4.0 mL, 40 mM). After that, the whole suspension was transferred into a 50 mL Teflon-lined autoclave and heated at 180 °C for 4 h. The resulting product (i.e., NaYF4:Yb,Tm@ TiO2) was washed and dried as above. Preparation of Capture Aptamer-1-Conjugated Magnetic Bead. Prior to use, the carboxylated magnetic beads were separated magnetically, washed with MES buffer (100 mM, pH 6.0), and then suspended in MES buffer at a final concentration of 25 mg mL−1 magnetic beads. Next, the capture aptamer-1 DNA probes were covalently conjugated onto magnetic beads through a typical carbodiimide coupling procedure.39 Initially, NHS (200 μL, 0.01 M) and EDC (200 μL, 0.04 M) were injected into the above-prepared MB suspension (1.0 mL, 25 mg mL−1) and incubated for 6 h at RT in order to activate the carboxylic groups on the magnetic beads. Following that, the aminated capture aptamer-1 (100 μL, 10 μM) was added in the mixture, and reacted for 12 h at RT. During this process, the capture aptamer-1 was covalently conjugated to magnetic beads. Afterward, the resultant suspension was magnetically separated and washed with MES buffer (100 mM, pH 6.0). The excess active sites on magnetic beads were blocked by using BSA (3.0 wt %). Finally, the formed aptamer-1-conjugated magnetic beads (Apt1-MBs) were dispersed into 1.0 mL of PBS (10 mM, pH 7.4) for further use (C[Apt1‑MB] ≈ 25 mg mL−1). Aptamer−Target−Aptamer Reaction on Magnetic Bead with Rolling Circle Amplification. For the detection of target CEA, the analytes with different concentrations were initially added in PBS (100 μL, 10 mM, pH 7.4) containing Apt1-
■
RESULTS AND DISCUSSION Characterization of NaYF4:Yb,Tm@TiO2 Upconversion Microrods. Scheme 1 gives the schematic illustration of the near-IR light-mediated photoelectrochemical aptasensing platform toward target CEA based on NaYF 4 :Yb,Tm@TiO2 upconversion microrods. In this system, Apt1-MB is prepared by covalent conjugation of capture aptamer-1 with the carboxylated magnetic bead with a classical carbodiimide coupling. Upon target CEA introduction, the sandwiched complex is formed between Apt1-MB and Apt2-pDNA and the carried primer DNA with the aptamer-2 undergoes an unbiased RCA reaction through the linear padlock-based circular DNA template with the assistance of ligase and polymerase. In the presence of Exo I and Exo III, the RCA product is digested for the generation of numerous free guanine bases (as the electron donors), thereby resulting in the amplification of the photocurrent on NaYF4:Yb,Tm@TiO2 microrods-modified electrode. By monitoring the change in the photocurrent, the concentration of target CEA in the sample can be quantitatively evaluated with sensitivity enhancement. C
DOI: 10.1021/acs.analchem.7b04479 Anal. Chem. XXXX, XXX, XXX−XXX
Article
Analytical Chemistry
Figure 1. HRTEM images of (A) NaYF4:Yb,Tm microrods and (B) core−shell NaYF4:Yb,Tm@TiO2 microrods (insets: orresponding HRTEM images); (C) XRD patterns of (a) TiO2, (b) NaYF4:Yb,Tm microrods, and (c) core−shell NaYF4:Yb,Tm@TiO2 microrods; (D−F) XPS spectra of (D) NaYF4:Yb,Tm@TiO2 microrods (insets: Yb 4d and Tm 4d), (E) Ti 2p, and (F) O 1s orbits.
Figure 2. (A) Upconversion photoluminescence spectra of (a) NaYF4:Yb,Tm and (b) NaYF4:Yb,Tm@TiO2; (B) UV−vis−near-IR absorbance spectra of (a) TiO2, (b) NaYF4:Yb,Tm@TiO2, and (c) NaYF4:Yb,Tm; (C) agarose gel electrophoresis image for RCA product in the (a) absence and (b) presence of Exos I/III (M: DNA marker); (D) photocurrent responses of NaYF4:Yb,Tm@TiO2-modified FTO electrode under near-IR light in PBS (10 mM, pH 7.4) in the (b) absence and (c, d) presence of 1.0 ng mL−1 target CEA (b, d) with and (c) without the RCA reaction [note: (a) newly prepared NaYF4:Yb,Tm@TiO2-modified FTO electrode alone; (c) Apt2-G used for the detection of target CEA on Apt1-MB].
Panels A and B of Figure 1 show high-resolution transmission electron microscopy (HRTEM; Tecnai G2 F20 S-TWIN FEI, USA) images of the as-synthesized microrods. A typical rod-like topological structure was observed at NaYF4:Yb,Tm materials (Figure 1A), indicating the successful preparation of the
microrods. The size of NaYF4:Yb,Tm microrods was approximately 1.0 μm in length and 100 nm in diameter. As seen from Figure 1B, a layer of additional materials was coated on the surface of NaYF4:Yb,Tm microrods after reaction with TiF4 (as the titanium source), and the thickness of the shell was about 50 D
DOI: 10.1021/acs.analchem.7b04479 Anal. Chem. XXXX, XXX, XXX−XXX
Article
Analytical Chemistry
Figure 3. Effects of (A) incubation time for the aptamer−CEA reaction, (B) RCA reaction time, and (C) incubation time of Exos I/III with RCA product on the near-IR light-mediated PEC aptasensing platform (1.0 ng mL−1 CEA used in this case).
that the TiO2 shell hindered the near-IR light, thus resulting in the decrease of the near-IR excitation intensity when reaching the surface of the upconversion material. Meanwhile, the photon energy from the upconversion process could be absorbed by the TiO2 shell. To demonstrate this issue, UV−visible−near-IR absorption spectroscopy was used to investigate the assynthesized TiO2, NaYF4:Yb,Tm and NaYF4:Yb,Tm@TiO2 (Figure 2B). A sharp peak at TiO2 alone (curve a) arose from typical 380 nm absorption, corresponding to the characteristic bandgap absorption of TiO2 (∼3.2 eV), which could derive from the emission peaks of Tm3+ in the UV region. In contrast, an obvious absorption peak of NaYF4:Yb,Tm (curve b) at about 980 nm belonged to the characteristic of Yb3+ (as a sensitizer). The characteristic peak of NaYF4:Yb,Tm@TiO2 microrods combined with TiO2 and NaYF4:Yb,Tm in a single architecture, which allowed the TiO2 shell to absorb the emission light of NaYF4:Yb,Tm forming photoresponse.24 Thus, the near-IR-toUV light could effectively utilize the emission light via the upconversion process. As mentioned above, the photocurrent of near-IR-mediated NaYF4:Yb,Tm@TiO2 could be amplified through targettriggered RCA reaction, accompanying the generation of free guanine bases. To realize our design, several concerns arise about whether (i) target CEA could induce the RCA reaction, (ii) the RCA product could be digested by Exo I and Exo III to produce the individual guanine, and (iii) the guanine as the electron donor could enhance the photocurrent of NaYF4:Yb,Tm@TiO2 microrods. First, we used gel electrophoresis to investigate the RCA product (Figure 2C). As seen from lane a, the RCA product heavily aggregated at the initial site of this lane. Obviously, the base number was far beyond 1500 bp. After digestion with Exo I and Exo III, however, most spots disappeared (lane b), indicating that Exo I and Exo III catalyzed the RCA product into the mononucleotides. Next, NaYF4:Yb,Tm@TiO2-based photoelectrochemical aptasensing platform was further verified for the detection of target CEA (1.0 ng mL−1 used as an example) with and without the RCA reaction (Figure 2D). Curve a gives the photocurrent of NaYF4:Yb,Tm@TiO2-modified FTO electrode alone. Herein, the NaYF4:Yb,Tm core absorbed the low-energy near-IR light to emit high-energy ultraviolet light, while the TiO2 shell could harvest the ultraviolet light to enhance the photocurrent conversion efficiency. Owing to high surface coverage for the TiO2 deposition, NaYF4:Yb,Tm@TiO2 was favorable for the construction of the PEC aptasensing platform. As a control test, the photocurrent of this system was also monitored in the absence of CEA (curve b), which was almost the same as that NaYF4:Yb,Tm@TiO2 alone (curve a), indicating that Apt2-pDNA could not be nonspecifically adsorbed onto the Apt1-MB. Signicantly, the photocurrent largely increased in the
nm. Relative to NaYF4:Yb,Tm microrods, the surface of core− shell NaYF4:Yb,Tm@TiO2 microrods became rougher. Moreover, we also found that introduction of TiO2 shell could largely improve the water solubility of the microrods. Furthermore, the microrods were characterized using powder X-ray diffraction (XRD; PANalytical X’Pert spectrometer, Netherlands) and Xray photoelectron spectroscopy (XPS; VG Scientific ESCALAB 250 spectrometer, USA). As shown in Figure 1C, the characteristic diffraction peaks of the as-prepared samples matched well with the standard anatase TiO2 phase (PDF No. 65-5714) (curve a) and NaYF4:Yb,Tm phase (PDF No. 281192) (curve b), indicating the high crystallinity of composition without any impurity peaks. After the formation of core−shell NaYF4:Yb,Tm@TiO2 microrods, all the characteristic peaks for TiO2 and NaYF4:Yb,Tm alone were simultaneously acquired (curve c), suggesting a good structural property. Figure 1D reveals the full survey spectrum of the NaYF4: Yb,Tm@TiO2 with the elements of Ti, O, Na, F, Y, Yb, and Tm. The peaks at 172.18 and 174.58 eV (left inset) and 186.58 eV (right inset) were attributed to the spectra of Tm 4d, and Yb 4d, respectively (Figure 1D).40 The binding energies at 457.68 and 463.58 eV from Ti4+ ions corresponded to Ti 2p3/2 and Ti 2p1/2, respectively (Figure 1E), in accordance with a previous report.39 The asymmetrical peak at the O 1s band revealed the presence of two kinds of oxygen species (Figure 1F). The binding energy at 528.98 eV derived from the characteristic peak of Ti−O−Ti, whereas that at 531.98 eV originated from the hydroxyl radicals (H−O).41 The results indicated that core−shell NaYF4:Yb,Tm@ TiO2 microrods were successfully synthesized by our design, which provided a necessary prerequisite for the development of near-IR light-mediated photoelectrochemical sensing platform. Feasibility Evaluation of Near-IR Light-Mediated PEC Aptasensing Platform. The luminescence characterization of the NaYF4:Yb,Tm@TiO2 microrods provided further evidence to testify whether lanthanide-doped NaYF4 could convert nearIR excitation light to high-energy UV via the upconversion process, and TiO2 shell highly got UV-absorption generating electron−hole pairs. Figure 2A displays the strong upconversion emission of NaYF4:Yb,Tm (curve a) under the near-IR excitation (980 nm), and the strong blue violet light (Figure 2A, inset). Actually, Yb3+ acted as a sensitizer to adsorb the near-IR light (primarily 980 nm), whereas Tm3+ served as an activator to give the multiemissions. The emission peaks at 291, 348, and 363 nm derived from 1I6 → 3H6, 1I6 → 3F4, and 1D2 → 3H6 transitions of Tm3+, respectively (curve a). Another two emission peaks at 453 and 479 nm originated from the transitions of Tm3+: 1D2 → 3F4 and 1G4 → 3H6.24,42 After modification with TiO2 shell, the intensity of the peaks decreased significantly (even disappeared) at 291 and 348 nm (curve b). The reason was ascribed to the fact E
DOI: 10.1021/acs.analchem.7b04479 Anal. Chem. XXXX, XXX, XXX−XXX
Article
Analytical Chemistry
Figure 4. (A) Photocurrent responses of NaYF4:Yb,Tm@TiO2-based PEC aptasensing platform toward different-concentration CEA standards under a 980 nm near-IR excitation; (B) corresponding calibration plots; (C) specificity of near-IR light-mediated NaYF4:Yb,Tm@TiO2 PEC aptasensing platform against 1.0 ng mL−1 CEA, 100 ng mL−1 PSA, 100 ng mL−1 TB, and 100 ng mL−1 human IgG (note: mixture contained the above nontarget analytes); and (D) the stability of NaYF4:Yb,Tm@TiO2-modifed FTO electrode.
presence of 1.0 ng mL−1 CEA (curve d). Logically, a puzzling question was whether the strong signal derived from the digested guanine from the RCA product. For comparison, we designed another similar single-stranded DNA with Apt2-pDNA [Aptamer-2-G-rich probe (Apt2-G): 5′-ATACCAGCTTATTCAATTGGGGGGAAG GGGGG-3′] for the detection of 1.0 ng mL−1 CEA on Apt1-MB without the RCA reaction. As shown from curve c, the photocurrent was obviously more than that of curve a, suggesting that the increasing photocurrent roots in guanine were digested from GGGGGGAAGGGGGG by Exo I and Exo III. The reason was attributed to the fact that the dissociative guanine was oxidized to high mutagenic 8oxoguanine more easily than the combined guanine in singlestranded DNA. By coupling with RCA reaction and Exos I/III, numerous free guanines were produced, thereby resulting in the increasing photocurrent. These results further demonstrated the feasibility of the near-IR light-mediated PEC aptasensing platform for the detection of target CEA. Optimization of Experimental Conditions. To maximize the photocurrent of the near-IR light-mediated PEC aptasensing platform, several experimental conditions, e.g., the aptamer− CEA reaction time, RCA reaction time, and incubation time of Exos I/III, should be optimized. A short incubation time was unfavorable for the formation of the aptamer−CEA complex. As seen from Figure 3A, the photocurrent increased with the increasing aptamer−CEA reaction time and tended to level off after 60 min using 1.0 ng mL−1 CEA as an example. A longer incubation time did not cause a significant increase in the photocurrent density. To save assay time, 60 min was used for the aptamer−CEA reaction. At this condition, we also investigated
the effects of the RCA reaction time and the digestion time of Exos I/III on the photocurrent of near-IR light-mediated PEC aptasensing platform. Actually, this step was very important because it directly affected the amount of free guanines. Notably, the detectable photocurrent depends on the individual guanine produced from the Exos I/III-assisted RCA reaction. The influence of RCA reaction time on the photocurrent of the nearIR light-mediated PEC aptasensing platform is shown in Figure 3B. Similarly, the photocurrent increased with increasing time and reached a platform after 40 min. A longer reaction time did not produce any significant, observable variation. To save assay time, 40 min was applied as the optimal RCA reaction time. Figure 3C reveals the effect of Exo I and Exo III cleavage time for RCA long product on the photocurrent of this system. A high photocurrent was observed after a cleavage time of 30 min. However, the photocurrent increased slowly when the reaction time was longer than 30 min. Thus, 30 min was selected as the digestion time toward the RCA product in this work. Analytical Performance of Near-IR Light-Mediated PEC Aptasensing Platform. Under the optimum conditions, the near-IR light-mediated NaYF4:Yb,Tm@TiO2 photoelectrochemical aptasensing platform was utilized for quantitative determination of target CEA, accompanying rolling circle amplification. Figure 4A shows the photocurrent densities of the NaYF4:Yb,Tm@TiO2-based PEC aptasensing platform relative to CEA standards with different concentrations, and the photocurrent density increased with increasing CEA concentration. As seen from Figure 4B, a good linear relationship between the photocurrent density and the logarithm of CEA concentration was acquired within a dynamic working range F
DOI: 10.1021/acs.analchem.7b04479 Anal. Chem. XXXX, XXX, XXX−XXX
Article
Analytical Chemistry Table 1. Comparison of Analytical Performance of Different CEA Detection Schemes detection method
linear range (ng mL−1)
LOD (pg mL−1)
ref
electrochemical immunoassay electrochemiluminescence immunoassay mass spectrometry fluorescence immunoassay barometer biosensor chemiluminescent immunosensor lateral flow test strip PEC aptasensing
0.012−85 0.05−100 0.07−1000 0.05−20 0.025−1.6 0.1−60 10−80 0.01−40
50 8 20 30 50 50 10000 3.6
43 44 45 39 46 47 48 this work
from 10 pg mL−1 to 40 ng mL−1. The linear regression equation could be fitted to y = 1.6729 + 0.7126 log C[CEA] (R2 = 0.9938; n = 8). The limit of detection (LOD) could be calculated to be 3.6 pg mL−1 at 3σ (where σ is the standard deviation of a blank sample, n = 11), which was comparable to a commercialized ELISA kit (Sigma-Aldrich; 0.05 ng mL−1) and other CEA detection protocols (Table 1). Such a high sensitivity derived from the unique photosensitive characteristics of NaYF4:Yb,Tm@TiO2 upconversion materials and the amplification ability of targettriggered RCA reaction on the magnetic beads. Nevertheless, one disadvantage of our system is that the overall assay time is relatively long (∼6 h per sample). Therefore, future work should focus on improvement of the overall assay time. Selectivity, Reproducibility, and Stability. To investigate the selectivity and specificity of NaYF4:Yb,Tm@TiO2-based PEC aptasensing platform, several biomarkers/proteins (e.g., prostate specific antigen, PSA; thrombin, TB; human IgG) were monitored by using our strategy in the absence and presence of target CEA. In this case, a low-concentration CEA (1.0 ng mL−1) and a high-level interfering agent (100 ng mL−1) were used as a comparative study. As shown in Figure 4C, the developed PEC detection system toward these nontarget analytes gave almost the same photocurrents as the blank sample. A strong photocurrent was achieved toward target CEA. More significantly, the coexistence of the interfering materials with target CEA did not cause significant increase in the photocurrent, compared with target CEA alone. Hence, the specificity of the NaYF4:Yb,Tm@TiO2-based PEC aptasensing platform was satisfactory. Generally, the photosensitive characteristics of photoactive materials can be affected under light irradiation. To clarify this point, the photocurrents of NaYF4:Yb,Tm@TiO2-modified FTO electrode were measured under the near-IR light with a repeated “on−off” light irradiation. As shown in Figure 4D, the background photocurrent at the off switch and the response photocurrent at the on state were almost stable. The relative standard deviation (RSD) values were 7.9% (on) and 8.6% (off) (n = 10), respectively. These results indicated that NaYF4:Yb,Tm@TiO2-modified FTO electrode could be repeatedly used for photocurrent measurement. The reproducibility of nearIR light-mediated NaYF4:Yb,Tm@TiO2 PEC aptasensing platform was further studied with five parallel tests (1.0 ng mL−1 CEA used in this case), and the RSD value was 8.9%, suggesting a good reproducibility. Monitoring of Human Serum Samples and Evaluation of Method Accuracy. To evaluate the accuracy of the newly developed method and the possible application for the analysis of complex real samples, six human serum specimens including the different-concentration CEA, gifted from the local Fujian Provincial Hospital (Fuzhou, China), were determined by using the near-IR light-mediated PEC aptasensing platform.
The results calculated by the regression equation in Figure 4B were compared with those from the commercial CEA ELISA kit (Table 2). The accuracy of this method was evaluated via a Table 2. Comparison of Analytical Results for Human CEA Serum Samples by Near-IR Light-Mediated Photoelectrochemical Aptasensing Platform and CEA ELISA Kit concn for given method (mean ± SD, ng mL−1; n = 3)a sample no.
PEC aptasensing
CEA ELISA kit
texp
1 2 3 4 5 6
0.84 ± 0.08 0.089 ± 0.007 7.76 ± 0.43 0.14 ± 0.01 15.52 ± 1.11 26.34 ± 1.78
0.93 ± 0.09 0.096 ± 0.005 7.59 ± 0.58 0.16 ± 0.02 15.93 ± 1.21 27.26 ± 1.36
1.29 1.41 0.41 1.55 0.43 0.71
a
Each sample was determined in triplicate, and the high-concentration CEA samples were determined with an appropriate dilution.
Student’s t-test method. As shown in Table 2, all the texp values in these cases were less than tcrit (tcrit[0.05,4] = 2.77), and the maximum relative standard deviation did not exceed 10%. No significant differences at the 0.05 significance level were encountered in the analysis of six clinical serum samples between two methods. Thus, the near-IR light-mediated NaYF4:Yb,Tm@ TiO2 PEC aptasensing platform can be considered as an optional scheme for the detection of CEA in clinical diagnostics.
■
CONCLUSIONS In summary, this work constructed a novel photoelectrochemical aptasensing platform based on core−shell NaYF4:Yb,Tm@TiO2 upconversion microrods for sensitive detection of target CEA by using near-infrared-to-ultraviolet light. The photocurrent was readily produced by the upconversion process of NaYF4:Yb,Tm@TiO2 microrods. The NaYF4:Yb,Tm core-based spectral converter efficiently transformed near-IR light into the matched UV light to excite the TiO2 shell, which caused the electron−hole pair to generate the photocurrent. Target-induced RCA reaction on magnetic beads with a sandwiched assay format was utilized for the formation of a long G-rich DNA strand. The signal was amplified by the enzymatic hydrolysate (numerous individual guanine bases) toward the RCA product. Compared with conventional photoelectrochemical detection systems, highlights of this study can be sumaried as follows: (i) the near-IR irradiation as a light source possesses the overwhelming characteristic of minimal photobleaching and low phototoxicity in comparison with traditional visible/UV light excitation; (ii) NaYF4:Yb,Tm@TiO2 upconversion microrods can tackle this drawback (e.g., the large bandgap of TiO2 photosensitizer is G
DOI: 10.1021/acs.analchem.7b04479 Anal. Chem. XXXX, XXX, XXX−XXX
Article
Analytical Chemistry
(22) Ye, J.; Liu, W.; Cai, J.; Chen, S.; Zhao, X.; Zhou, H.; Qi, L. J. Am. Chem. Soc. 2011, 133, 933−940. (23) Li, J.; Cushing, S.; Zheng, P.; Meng, F.; Chu, D.; Wu, N. Nat. Commun. 2013, 4, 2651−2658. (24) Tang, Y.; Di, W.; Zhai, X.; Yang, R.; Qin, W. ACS Catal. 2013, 3, 405−412. (25) Qin, W.; Zhang, D.; Zhao, D.; Wang, L.; Zheng, K. Chem. Commun. 2010, 46, 2304−2306. (26) Zhu, Y.; Zhang, N.; Ruan, Y.; Zhao, W.; Xu, J.; Chen, H. Anal. Chem. 2016, 88, 5626−5630. (27) Fan, G.; Zhu, H.; Du, D.; Zhang, J.; Zhu, J.; Lin, Y. Anal. Chem. 2016, 88, 3392−3399. (28) Yan, Z.; Wang, Z.; Miao, Z.; Liu, Y. Anal. Chem. 2016, 88, 922− 929. (29) Zhang, Z.; Yu, Y.; Wang, P. ACS Appl. Mater. Interfaces 2012, 4, 990−996. (30) Yang, D.; Ma, P.; Hou, Z.; Cheng, Z.; Li, C.; Lin, J. Chem. Soc. Rev. 2015, 44, 1416−1448. (31) Hao, J.; Yan, B. J. Mater. Chem. A 2015, 3, 4788−4792. (32) Macedo, A.; Ferreira, R.; Ananias, D.; Reis, M.; Amaral, V.; Carlos, L.; Rocha, J. Adv. Funct. Mater. 2010, 20, 624−634. (33) Li, Z.; Lv, S.; Wang, Y.; Chen, S.; Liu, Z. J. Am. Chem. Soc. 2015, 137, 3421−3427. (34) Challenor, M.; Gong, P.; Lorenser, D.; Fitzgerald, M.; Dunlop, S.; Sampson, D.; Swaminathan Iyer, K. ACS Appl. Mater. Interfaces 2013, 5, 7875−7880. (35) Chen, G.; Damasco, J.; Qiu, H.; Shao, W.; Ohulchanskyy, T.; Valiev, R.; Wu, X.; Han, G.; Wang, Y.; Yang, C.; Ågren, H.; Prasad, P. Nano Lett. 2015, 15, 7400−7407. (36) Zhao, W.; Han, Y.; Zhu, Y.; Zhang, N.; Xu, J.; Chen, H. Anal. Chem. 2015, 87, 5496−5499. (37) Zhang, Y.; Zhang, L.; Deng, R.; Tian, J.; Zong, Y.; Jin, D.; Liu, X. J. Am. Chem. Soc. 2014, 136, 4893−4896. (38) Zhang, Y.; Hong, Z. Nanoscale 2013, 5, 8930−8933. (39) Qiu, Z.; Shu, J.; Tang, D. Anal. Chem. 2017, 89, 5152−5160. (40) Tou, M.; Mei, Y.; Bai, S.; Luo, Z.; Zhang, Y.; Li, Z. Nanoscale 2016, 8, 553−562. (41) Xu, Z.; Quintanilla, M.; Vetrone, F.; Govorov, A.; Chaker, M.; Ma, D. Adv. Funct. Mater. 2015, 25, 2950−2960. (42) Lucky, S. S.; Muhammad Idris, N.; Li, Z.; Huang, K.; Soo, K. C.; Zhang, Y. ACS Nano 2015, 9, 191−205. (43) Barman, S. C.; Hossain, M. F.; Yoon, H.; Park, J. Y. Biosens. Bioelectron. 2017, 100, 16−22. (44) Pang, X.; Li, J.; Zhao, Y.; Wu, D.; Zhang, Y.; Du, B.; Ma, H.; Wei, Q. ACS Appl. Mater. Interfaces 2015, 7, 19260−19267. (45) Liu, R.; Liu, X.; Tang, Y.; Wu, L.; Hou, X.; Lv, Y. Anal. Chem. 2011, 83, 2330−2336. (46) Fu, Q.; Wu, Z.; Du, D.; Zhu, C.; Lin, Y.; Tang, Y. ACS Sens. 2017, 2, 789−795. (47) Li, J.; Cao, Y.; Hinman, S. S.; McKeating, K. S.; Guan, Y.; Hu, X.; Cheng, Q.; Yang, Z. Biosens. Bioelectron. 2017, 100, 304−311. (48) Wang, J.; Cao, F.; He, S.; Xia, Y.; Liu, X.; Jiang, W.; Yu, Y.; Zhang, H.; Chen, W. Talanta 2018, 176, 444−449.
limited to UV light excitation); and (iii) establishment of the split-type assay mode for the aptamer−target reaction and photocurrent measurement in two cells can efficiently avoid the damage of biomolecules. Importantly, NaYF4:Yb,Tm@TiO2based assay by near-infrared light opens a new horizon for development of upconversion materials-based PEC detection strategies.
■
AUTHOR INFORMATION
Corresponding Author
*Phone: +86-591-2286 6125. Fax: +86-591-2286 6135. E-mail:
[email protected]. ORCID
Dianping Tang: 0000-0002-0134-3983 Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We thank the National Natural Science Foundation of China (Grant Nos. 21675029 and 21475025), the National Science Foundation of Fujian Province (Grant No. 2014J07001), and the Program for Changjiang Scholars and Innovative Research Team in University (Grant No. IRT15R11) for financial assistance.
■
REFERENCES
(1) Li, X.; Wang, R.; Zhang, F.; Zhao, D. Nano Lett. 2014, 14, 3634− 3639. (2) Kim, J.-H.; Kim, J.-H. ACS Photonics 2015, 2, 633−638. (3) Han, S.; Deng, R.; Xie, X.; Liu, X. Angew. Chem., Int. Ed. 2014, 53, 11702−11715. (4) Naik, G.; Welch, A.; Briggs, J.; Solomon, M.; Dionne, J. Nano Lett. 2017, 17, 4583−4587. (5) Greybush, N. J.; Saboktakin, M.; Ye, X.; Della Giovampaola, C.; Oh, S. J.; Berry, N. E.; Engheta, N.; Murray, C. B.; Kagan, C. R. ACS Nano 2014, 8, 9482−9491. (6) Zhang, F.; Braun, G.; Shi, Y.; Zhang, Y.; Sun, X.; Reich, N.; Zhao, D.; Stucky, G. J. Am. Chem. Soc. 2010, 132, 2850−2851. (7) Tsang, M.; Bai, G.; Hao, J. Chem. Soc. Rev. 2015, 44, 1585−1607. (8) Idris, N.; Gnanasammandhan, M.; Zhang, J.; Ho, P.; Mahendran, R.; Zhang, Y. Nat. Med. 2012, 18, 1580−1585. (9) Hou, Z.; Li, Z.; Ma, P.; Cheng, Z.; Li, X.; Zhang, X.; Dai, Y.; Yang, D.; Lian, H.; Lin, J. Adv. Funct. Mater. 2012, 22, 2713−2722. (10) Börjesson, K.; Dzebo, D.; Albinsson, B.; Moth-Poulsen, K. J. Mater. Chem. A 2013, 1, 8521−8524. (11) Hou, Z.; Zhang, Y.; Deng, K.; Chen, Y.; Li, X.; Deng, X.; Cheng, Z.; Lian, H.; Li, C.; Lin, J. ACS Nano 2015, 9, 2584−2599. (12) Tsang, M.; Ye, W.; Wang, G.; Li, J.; Yang, M.; Hao, J. ACS Nano 2016, 10, 598−605. (13) Ma, Y.; Liu, H.; Han, Z.; Yang, L.; Liu, J. J. Mater. Chem. A 2015, 3, 14642−14650. (14) Zhao, W.; Xu, J.; Chen, H. Chem. Soc. Rev. 2015, 44, 729−741. (15) Zhuang, J.; Tang, D.; Lai, W.; Xu, M.; Tang, D. Anal. Chem. 2015, 87, 9473−9480. (16) Zhao, W.; Yu, X.; Xu, J.; Chen, H. Nanoscale 2016, 8, 17407− 17414. (17) Huo, H.; Xu, Z.; Zhang, T.; Xu, C. J. Mater. Chem. A 2015, 3, 5882−5888. (18) Dai, H.; Chen, S.; Li, Y.; Zeng, B.; Zhang, S.; Hong, Z.; Lin, Y. Biosens. Bioelectron. 2017, 92, 687−694. (19) Zhao, K.; Yan, X.; Gu, Y.; Kang, Z.; Bai, Z.; Cao, S.; Liu, Y.; Zhang, X.; Zhang, Y. Small 2016, 12, 245−251. (20) Da, P.; Li, W.; Lin, X.; Wang, Y.; Tang, J.; Zheng, G. Anal. Chem. 2014, 86, 6633−6639. (21) Liu, P.; Liu, X.; Huo, X.; Tang, Y.; Xu, J.; Ju, H. ACS Appl. Mater. Interfaces 2017, 9, 27185−27192. H
DOI: 10.1021/acs.analchem.7b04479 Anal. Chem. XXXX, XXX, XXX−XXX
