New Nucleotide Analogues with Enhanced Signal Properties

122

Bioconjugate Chem. 2010, 21, 122–129

New Nucleotide Analogues with Enhanced Signal Properties Dmitry Cherkasov,*,† Thorsten Biet,‡ Englbert Ba¨uml,‡ Walther Traut,§ and Michael Lohoff† Institute for Medical Microbiology, BMFZ, Philipps University of Marburg, Hans-Meerweinstrasse 2, 35043 Marburg, Germany, and Institute of Chemistry and Institut fu¨r Biologie, Zentrum fu¨r Medizinische Strukturbiologie, Universita¨t Lu¨beck, Ratzeburger Allee 160, 23538 Lu¨beck, Germany. Received August 16, 2009; Revised Manuscript Received October 31, 2009

We describe synthesis and testing of a novel type of dye-modified nucleotides which we call macromolecular nucleotides (m-Nucs). Macromolecular nucleotides comprise a nucleotide moiety, a macromolecular linear linker, and a large macromolecular ligand carrying multiple fluorescent dyes. With incorporation of the nucleotide moiety into the growing nucleic acid strand during enzymatic synthesis, the macromolecular ligand together with the coupled dyes is bound to the nucleic acid. By the use of this new class of modified nucleotides, signals from multiple dye molecules can be obtained after a single enzymatic incorporation event. The modified nucleotides are considered especially useful in the fields of nanobiotechnology, where signal stability and intensity is a limiting factor.

INTRODUCTION Nucleotides conjugated with fluorescent dyes have been widely used to label nucleic acids for different techniques in molecular biology, e.g., FISH, microarray, or Sanger sequencing, for over 20 years. The state of the art structure of these nucleotides comprises a nucleotide moiety, a short linker arm, and a low molecular weight fluorescent dye moiety, e.g., fluorescein or a cyanine dye. Regarding signal strength, this structure has been sufficient for most analytical purposes. The presence of a large population of identically labeled nucleic acid molecules used for signal generation not only contributed to the required strength of the signal, but also compensated for photophysical phenomena of individual molecules like blinking and spectral drift. Recent developments in analytical science opened new frontiers down to the level of nanoscale and single molecules (1–6). Here, the detection of fluorescent signals is increasingly influenced by peculiarities in the photophysical behavior of individual fluorophores, e.g., blinking (7, 8), which result in uncertainties and instability of signal detection. Thus, the development of new technologies may benefit from the redesign of dye-labeled nucleotides. In particular, single molecule sequencing technologies hold great promise regarding cost and time reduction, compared to methods which require bulk populations of DNA molecules for sequencing (9–13). Since the late 1990s, several techniques for single molecule sequencing have been under development by academic groups (14–16) and commercial vendors (e.g., www.helicosbio.com, www.genovoxx.com, www.visigenbio.com, www.pacificbiosciences.com, www.nanoporetech.com); two newly published approaches (17, 18) use differently labeled nucleotides during the primer extension reaction to translate the sequence content into specific light signals that can be detected. The raw data accuracy in both procedures ranges from 80% to 95% in a single run. In comparison, sequencing methods based on the analysis of bulk populations achieve about 99% (www.illumina.com). One of the reasons for the relatively high error rate in those novel approaches is the use of a single fluorophore * E-mail: [email protected]. † Philipps University of Marburg. ‡ Institute of Chemistry, Universita¨t Lu¨beck. § Zentrum fu¨r Medizinische Strukturbiologie, Universita¨t Lu¨beck.

molecule as the source of the light signal. During sequencing, each fluorophore is excited only for a short period of time (tens to hundreds of milliseconds). During this period of time, several photophysical phenomena, e.g., blinking, quenching, spectral shift, and photobleaching (3, 6, 8), can lead to a hindrance of signal detection, resulting in a loss of sequence information. Further augmentation of sequencing speed during single molecule sequencing will most likely require even shorter illumination periods, resulting in a further increase of the error rate. Taken together, single molecule sequencing technologies should address signal stability issues in order to overcome such limitations. In this paper, we present a new type of nucleotide analoguesscollectively called m-Nucs (macromolecular nucleotides) heresthat may solve the problem of signal instability. We assumed that ideally each nucleotide should carry several dye molecules. By using such nucleotides during sequencing, incoporation of only one nucleotide molecule into the growing strand will result in an accumulated signal produced from a bunch of molecules instead of only one fluorophore. Such nucleotides could have several advantages compared to conventionally labeled nucleotides. First, because each dye molecule is functioning as an individual light generator independent from others, the probability of nonemitting states in one particular nucleotide decreases with the number of dye molecules in this nucleotide. Second, the strength of the fluorescent signal from multiple dye molecules is greatly increased compared to that of only one dye molecule. Thus, the crucial parameters signal stability and signal strength could be dramatically improved by multiple labeling of nucleotides with fluorescent dyes. In the present study, we report on the development of such nucleotides and their labeling technology. In the following, we describe the new nucleotide analogues, their synthesis, and their suitability as substrates in solid-phase primer extension assays. The synthesis was conducted by coupling of a long PEG (poly(ethylene glycol)) linker carrying a biotin moiety to nucleotide analogues, the 5-allylamine-dUTP and the 5-propargylamine-dCTP. Subsequently, streptavidin or its derivatives were coupled to the biotin moiety of the PEG linker. The resulting compounds contain the nucleotide moiety, a long PEG linker, and streptavidin, which can be modified with multiple dye molecules. The incorporation of such new nucle-

10.1021/bc900364f  2010 American Chemical Society Published on Web 01/04/2010

Nucleotide Analogues with Enhanced Signal Properties

otides into the growing strand by several DNA polymerases was shown using a solid-phase primer extension assay.

MATERIAL AND METHODS Materials. Chemical reagents and solvents were purchased from Sigma-Aldrich (Seelze, Germany), oligonucleotides from MWG Biotech (now Eurofins MWG Operon, Ebersberg, Germany). All DNA polymerases were from New England Biolabs (Frankfurt a. Main, Germany). Silica gel 60 F254 TLC (thin layer chromatography) plates were purchased from VWR International (Darmstadt, Germany), SA (streptavidin) and paramagnetic beads from Promega (Mannheim, Germany), and premixed 30% acrylamide-bisacrylamide solution from BioRad Laboratories (Munich, Germany). Ultrafiltration vials (Microcon MWCO 50 kD and 100 kD) were purchased from Millipore (Schwalbach, Germany). We used dUTP-16-Biotin and Fluorescein-12-dUTP from Roche Applied Science (Mannheim, Germany); Fluorescein-12-dCTP from Perkin-Elmer (Offenbach a. Main, Germany); dUTP-AA (5-aminoallyl-dUTP) and dCTP-PA (5-propargylamino-dCTP) from Jenabiosciences (Jena, Germany); and NHS-PEG-Fluorescein (N-hydroxysuccinimidyl ester-poly(ethylene glycol)-fluorescein, Mw 5000) and NHS-PEG-5000-biotin (N-hydroxysuccinimidyl esterpoly(ethylene glycol)-biotin, Mw 5000) from Nektar Therapeutics (San Carlos, CA, USA). SA-PE (streptavidin-R-phycoerythrin) was from Invitrogen (Karlsruhe, Germany). HPLC was conducted on TSKgel DEAE-2SW columns from SigmaAldrich. Synthesis of Compounds. General Considerations. The components of the m-Nucs synthesized in this study are a nucleotide moiety, a water-soluble linker (PEG-linker), and streptavidin or its derivatives, e.g., dye-labeled streptavidin. An overview of the composition of nucleotide conjugates is given in Table 2. Synthetic schemes are shown in the Supporting Information Supplement 1 and Figure 1. First, we coupled PEG-biotin to the nucleotides to generate precursors of the m-Nucs (compounds 1 and 2). Next, dNTPPEG-biotin (abbreviated as dNTP-PEG-B) was coupled to streptavidin (SA) or its phycoerythrin (PE)-modified derivative (compounds 3 to 5 and 7). To produce dye-labeled streptavidin derivatives, NHS-PEG-fluorescein was coupled to SA (compound 6). In all protocols, separation of the resulting m-Nucs from unbound dNTP-PEG-biotin or other compounds with a molecular weight of less than 50 kDa was performed via ultrafiltration and repetitive washes. Synthesis of Compounds 1 and 2. To generate compound 1, dUTP-PEG-B, NHS-PEG-5000-biotin (20 mg) was added to a solution of dUTP-AA (500 µL, 20 mM, in 50 mM borate buffer, pH 8.5) and the reaction was allowed to proceed for 1 h at room temperature. After that, compound 1 was isolated by DEAEHPLC in a salt gradient (0.0 to 0.5 M NaCl in Tris-HCl buffer, 50 mM, pH 8.0). Compound 1 was eluted from the DEAEHPLC column at around 0.3 M NaCl. Fractions were collected and analyzed by UV-vis and TLC (silica gel 60 F254) in an ethanol-water mixture (70:30, v/v) for the presence of dUTPAA (retention factor Rf ) 0.4) and dUTP-PEG-B (Rf ) 0.05). The fractions of dUTP-PEG-B with no detectable contaminations of dUTP-AA were combined and stored at -20 °C. Compound 2, dCTP-PEG-B, was synthesized in a similar way, but exchanging dCTP-PA for dUTP-AA. Synthesis of Compounds 3 and 4. To produce compound 3, (dUTP-PEG-B)1-SA, 1 mg of streptavidin was dissolved in 1 mL of 50 mM Tris-HCl buffer, pH 8.0, and an equimolar amount of compound 1 (as a 0.17 mM solution in 0.1 mL of 50 mM Tris-HCl buffer, pH 8.0) was added to the streptavidincontaining solution. The resulting solution was kept at room temperature for 1 h. After that, compound 3 was separated from

Bioconjugate Chem., Vol. 21, No. 1, 2010 123

compounds with lower molecular weight by repetitive ultrafiltration using Microcon MWCO 50 kDa filters according to manufacturer’s instructions, using 50 mM Tris-HCl buffer, pH 8.0. Compound 4, (dCTP-PEG-B)1-SA, was synthesized in a similar manner, using dCTP-PEG-B, however, instead of dUTPPEG-B. Synthesis of Compounds 5, 7, and 8. For the synthesis of compound 5, (dUTP-PEG-B)4-SA, 0.5 mg streptavidin was dissolved in 0.5 mL of 50 mM Tris-HCl, pH 8.0, and a 5-fold excess of dUTP-PEG-B (as 0.1 mM solution in 0.5 mL of 50 mM Tris-HCl buffer, pH 8.0) was added. The resulting solution was kept at room temperature for 1 h. After that, compound 5 was separated from compounds with lower molecular weight as described for compound 3. Compound 8, (dUTP-16-B)4-SA, was synthesized in a similar way to compound 5, but using dUTP-16-biotin instead of dUTPPEG-B. Compound 7, (dUTP-PEG-B)n-SA-PE, was synthesized in a similar way as described for compound 5: a solution of 0.2 mg SA-PE conjugate (streptavidin-R-phycoerythrin) was added to an excess of dUTP-PEG-B (as 0.1 mM solution in 0.2 mL of 50 mM Tris-HCl buffer, pH 8.0). The resulting mixture was kept at room temperature for 1 h. Thereafter, compound 7 was separated from compounds with lower molecular weight by repetitive ultrafiltration via Microcon MWCO 100 kDa filters according to the manufacturer’s instructions, using 50 mM Tris-HCl buffer, pH 8.0. R-phycoerythrin is a naturally occurring large fluorescent protein with a molecular weight of about 240 kDa. Therefore, the streptavidin-R-phycoerythrin conjugate has a size of more than 240 kDa. In this conjugate, some biotin binding sites may have been inactivated during coupling of PE to SA, or the access to the binding site may be hindered by PE. Therefore, (dNTP-PEG)n-SA-PE represents a mixture of compounds, where the number of dNTP-PEGmolecules per SA-PE can be in the range 1-4. Synthesis of Compound 6, (dUTP-PEG-B)4-SA-(PEGFluorescein). To obtain compounds with a ratio of 5 dye molecules to 1 nuc-macomolecule, compound 5 was subjected to additional labeling of SA by NHS-PEG-fluorescein according to the manufacturer’s recommendations. NHS-PEG-fluorescein was dissolved in DMSO (100 mg/mL), while 0.1 mg of compound 5 was dissolved in 100 µL of 50 mM phosphate buffer, pH 7.5. Labeling was conducted at room temperature by stepwise addition of the NHS-PEG-fluorescein solution to the compound 5 containing solution until a final NHS-PEGfluorescein concentration of 0.5 mM was reached. After labeling, compound 6 was separated from byproduct of the reaction by ultrafiltration with MWCO 50 kDa and repeated washes with 50 mM phosphate buffer, pH 7.5, until no more dye was detected in the waste wash. The colored substance with >50 kDa was collected. Calculation of the average number of fluorescent dye molecules per one molecule of streptavidin in compound 6 was conducted using the known starting amount of compound 5 and molar extinction coefficient for PEG-fluorescein (ε490 ) 80.000 M-1 cm-1 in a buffer solution, pH 9). It was concluded that, on average, compound 6 was labeled by five fluorescein molecules per molecule of compound 6. The labeled compound 6 was dissolved in 50 mM Tris-HCl buffer, pH 8.0, and stored at 4 °C until needed. Measurements of excitation and emission spectra were conducted in 50 mM Tris-HCl buffer pH 8.5 at RT. Solid-Phase Primer Extension Assay. To test m-Nucs in an enzymatic reaction, a solid-phase primer extension assay was chosen. Modified nucleotides were incorporated into the primer in a template-dependent reaction and, being attached to the solid phase, could be easily separated from the reaction mixture after

124 Bioconjugate Chem., Vol. 21, No. 1, 2010

Cherkasov et al.

Table 1. Oligonucleotides Used in the Study

a

no.

laboratory name

1 2 3 4

Primer T7-19 Primer T7-19-Cy3 Template Oligo 87 dT-48-3′-Biotin

3′ modification

5′ modification Cy3

biotin

sequence (from 5′to 3′)a TAATACGACTCACTATAGG TAATACGACTCACTATAGG (dA)50TCCTTAGTCCTATAGTGAGTCGTATTA (dT)48

Primer binding site of the template is underlined.

the incorporation reaction. After that, extended primers were separated by gel electrophoresis and visualized by detection of signals from the fluorescent labels coupled to the nucleic acid strands (fluorescently labeled primers or incorporated fluorescently labeled nucleotides). All DNA polymerases were tested in an incorporation buffer consisting of 50 mM Tris-HCl pH 8.0, 50 mM NaCl, 5 mM MgCl2, 10% glycerol, and 0.2 mM EDTA. The washing buffer for the magnetic beads was 50 mM Tris-HCl pH 8.0, 50 mM NaCl, 10% glycerol, and 0.2 mM EDTA. The stop-buffer used to terminate the enzymatic reaction consisted of 50 mM Tris-HCl pH 8.0, 50 mM NaCl, 10% glycerol, and 20 mM EDTA. Primer and template (Table 1) were annealed by incubation in incorporation buffer (0.2 mL, 1 µM each) at 80 °C for 2 min followed by cooling to RT for 10 min. The combinations of primer and template for each experiment are described in the Results section; the sequences are listed in Table 1. To prepare the solid phase with bound template-primer complex, an oligo dT48-3′-biotin-anchor was bound to streptavidin which was immobilized on paramagnetic beads, and the template-primer complex was bound to this anchor. The following protocol was used: Streptavidin beads (600 µL) were washed twice with washing buffer, then 5 µL of 100 µM oligo dT48-3′-biotin was added and incubated for 5 min at RT. After that, the beads were washed twice with washing buffer to remove unbound oligo dT48-3′-biotin. The anchor-containing magnetic beads were used immediately or stored at 4 °C for several weeks until use. The solution with annealed template primer was added to the anchor-containing beads and incubated for 5 min at 37 °C. Then, beads loaded with the template-primer pairs were rinsed with washing buffer, suspended in 100 µL of this buffer, and used immediately or stored in washing buffer at 4 °C for maximally one week. Immediately prior to use in the primerextension reaction, loaded beads were briefly rinsed with washing buffer containing 1 µM biotin to saturate all free biotin binding sites on the beads and twice with washing buffer to remove unbound biotin. For each primer extension reaction, 10 µL of the bead suspension was used. To conduct the primer extension reaction, beads with attached template-primer complexes were combined at room temperature with m-Nucs and other components of the reaction to yield a final volume of 19 µL per reaction. For the enzymatic reactions, dNTPs, commercially available modified nucleotides, or m-Nucs were used at final concentrations of 1 µM or higher as indicated. Each reaction was initiated by the addition of 1 µL of a particular polymerase (i.e., 5 units of Klenow Fragment (exo -) DNA polymerase, or 5 units of Taq DNA polymerase, or 2 units of Vent (exo-) DNA polymerase) and incubated at 37 °C for 15 min. The incorporation reaction was limited to the first two to five bases starting from the 3′-OH of the primer, because at least one dNTP necessary for further extension was omitted from the reaction. The reaction was stopped by addition of 200 µL of stop buffer. After that, the nucleic acid strands bound to the beads were washed several times to remove the unincorporated nucleotides. In the last step, the suspension of beads with bound nucleic acid strands was concentrated to a volume of 10 µL and loaded directly onto the vertical slab gel (10% polyacrylamide) or stored at 4 °C until analysis.

Electrophoretic Analysis. The primer extension products were analyzed on 10% polyacrylamide-bisacrylamide gels, prepared from 30% of the Bio-Rad stock solution (acrylamide/ bisacrylamide, 19.5:0.5% w/w). Gel electrophoresis was conducted at 120 V on a BioRad Miniprotean in 50 mM Tris-HCl Buffer pH 8.0 at 60 °C for 3 min and after that for 10 to 25 min at 40 °C. The 60 °C step served to dissociate the extended nucleic acid strands from the template and, hence, disconnect them from the magnetic beads. After the run, the gel was exposed to UV illumination, and fluorescence images were taken with a CCD camera. Signal intensities were compared using the software Bio-Profile Bio 1D (Vilber Lourmat GmbH). The signal from the extension product obtained from compound 6 was taken as a standard for comparison to other signals. Its relative fluorescent intensity was arbitrarily set to 5 fluorescence units according to the number of the fluorescein molecules bound to the single streptavidin molecule of compound 6.

RESULTS Synthesis. To evaluate substrate properties of m-Nucs, several different compounds were synthesized (synthetic schemes are shown in the Supporting Information Supplement 1, Figure 1). These nucleotide conjugates comprise differences in nucleotide moieties (dUTP or dCTP), composition and size of the macromolecular ligands (streptavidin, streptavidin-(PEG-fluorescein)5, streptavidin-phycoerythrin), and linker size. Since there was a potential for binding of more than one nucleotide moiety to one macromolecular ligand, compounds comprising one or several nucleotide moieties were synthesized. To synthesize the nucleotides modified with NHS-PEG-biotin (compounds 1 or 2, Table 2), the strategy of Giller et al. 2003 (19) for modification of dUTP-AA and dCTP-PA by Dye-NHS was adopted. We replaced Dye-NHS with a NHS-PEG-biotin derivative. The nucleotide analogues, dUTP-AA and dCTP-PA, contain a side chain at the 5 position of the pyrimidine base, allylamine in dUTP-AA, and propargylamine in dCTP-PA. Each side chain includes a primary amino group, which can be further modified. The coupling of NHS-PEG-biotin to the dUTP-AA and dCTP-PA was performed in an aqueous solution. The course of the reaction was followed by TLC analysis, and the products were subsequently purified by HPLC. TLC and UV-analysis indicated a successful modification of nucleotides (altered Rf and nonaltered UV absorption spectrum). As described for the nucleotide analogues dUTP-AA and dCTP-PA (19), the covalent binding of a given NHS-conjugated ligand (e.g., a dye) to the nucleotide occurs only at the primary amino group of the allylamine or propargylamine side chain. Accordingly, we assumed the structure depicted in Figure 1 for the new nucleotide analogues. To the best of our knowledge, this is the first time that coupling of such a long linker to a nucleotide moiety is described. Streptavidin has four binding sites for biotin and a potential to bind up to four dNTP-PEG-B molecules. To synthesize further derivatives carrying streptavidin or its modifications, compound 1 or 2 or commercially available dUTP-16-biotin was added to solutions containing streptavidin or its modifications, so that a range of compounds could be formed (Table 2). To account for the possible effects of multiple binding of dNTP-PEG-B or the presence of free biotin binding sites within



Figure 1. Structure of compounds 1 and 2. Table 2. Composition of Synthesized Compounds and Abbreviationsa compound no.

name

dNTP/SA ratio

nucleotide moiety

PEG-linker

macromolecular moiety

1 2 3 4 5 6 7 8

dUTP-PEG-B dCTP-PEG-B (dUTP-PEG-B)1-SA (dCTP-PEG-B)1-SA (dUTP-PEG-B)4-SA (dUTP-PEG-B)4-SA-(PEG-Fluor)5 (dUTP-PEG-B)n-SA-PE (dUTP-16-B)4-SA

1:1 1:1 4:1 4:1 n:1 4:1

dUTP dCTP dUTP dCTP dUTP dUTP dUTP dUTP

PEG5000 PEG5000 PEG5000 PEG5000 PEG5000 PEG5000 PEG5000 none

PEG PEG PEG/SA PEG/SA PEG/SA PEG/SA-PEG-Fluor PEG/SA-PE SA

a n ) 1, 2, 3 or 4. Abbreviations: Biotin is indicated as “B”, e.g., dUTP-PEG-B is dUTP-PEG-biotin; PEG-fluorescein is indicated as “PEG-Fluor”, streptavidin as “SA”, poly(ethylene glycol) as “PEG”, R-Phycoerythrin as “PE”.

one m-Nuc, we synthesized m-Nucs with ratios of 1:1 and 4:1 between dNTP-PEG-B and streptavidin. By setting up the reaction with equimolar amounts of compound 1 (or 2) and streptavidin, compounds 3 and 4 were synthesized. Approximately 25% of the available biotin binding sites were occupied by dUTP-PEG-B in compound 3 or by dCTP-PEG-B in compound 4, corresponding to a 1:1 ratio. The 4:1 ratio corresponds to the occupation of all four binding sites of streptavidin by dNTP-PEG-B moieties. To obtain the 4:1 ratio between dNTP-PEG-B and streptavidin (compound 5), we used saturating amounts of dUTP-PEG-B in the binding reaction. M-Nucs with and without fluorescent labels were synthesized. Compounds 3-5 and compound 8 contained no additional fluorescent dyes and therefore had no fluorescent signal properties in the visible spectrum. They were used in further steps to synthesize fluorescently labeled compound 6, and in enzymatic reactions to monitor the electrophoretic mobility of the extended nucleic acids or for testing different DNA polymerases. The fluorescently labeled compounds were synthesized in two ways. (1) The low molecular weight dye fluorescein was coupled to the streptavidin moiety of compound 5, resulting in compound 6. (2) A streptavidin-R-phycoerythrin conjugate was used in the coupling reaction, resulting in compound 7. The two ways represent general cases of the synthetic procedures to obtain m-Nucs: first, nonfluorescent m-Nucs are synthesized and thereafter modified by fluorescent dyes or, on the contrary, a large fluorescent structure is first assembled and then coupled to the dNTP moiety. When we generated the fluorescently labeled m-Nuc compound 6, we found that direct coupling of fluorescein to streptavidin resulted in a decrease of fluorescence from fluo-

rescein dyes (data not shown). This phenomen can be partially explained by self-quenching effects of fluorescein molecules if placed in close proximity to each other and by the influence of the streptavidin itself (20–22). Gruber et al. (20) circumvented the last phenomenon by introduction of a PEG spacer between fluorescein and streptavidin. Similar to their procedure, we used a commercially available fluorescein derivative containing a PEG spacer, NHS-PEG-fluorescein, to covalently bind fluorescein to compound 5. After chemical coupling and purification, a quantification of the number of coupled fluorescein molecules per one molecule of compound 6 was conducted using UV-vis spectroscopy. Knowing the amount of compound 5 in the reaction and measuring the absorption at 490 nm of compound 6, we calculated an average number of about 5 fluorescein molecules per molecule of compound 6. Excitation and emission spectra of compound 6 are shown in the Supporting Information Supplement 2, Figure 2. Substrate Properties of dUTP-PEG-B and (dUTPPEG-B)1-SA. DNA polymerase Klenow Fragment (exo-) was tested for its capacity to use the nucleotide analogues. For this purpose, we performed primer extension assays using natural dNTPs (dATP, dCTP), synthesized nucleotide analogues, Klenow fragment (exo-), and fluorescently labeled primer annealed to a template which was immobilized on magnetic beads. Incorporation of the nucleotides occurred in a single round of reactions. According to the template sequence, the order of the incorporation was A, C, T, A, A, and then stopped since dGTP was omitted from the reaction mix. In this series of experiments, dUTP-PEG-B or (dUTP-PEG-B)1-SA (compounds 1 and 3) replaced dTTP. A reaction mix containing (dUTP-PEG-B)1-SA but omitting the Klenow fragment (exo-) served as a negative


Figure 2. Fluorescent gel image of electrophoretically separated Cy3 labeled primer and extension products. Standard primer extension assays were performed using the Cy3-labeled primer T7-19-Cy3, the template oligo 87, dATP, dCTP, Klenow Fragment (exo-), adding or omitting the following components. Lane 1: with (dUTP-PEG-B)1-SA but without Klenow Fragment (exo-). Lane 2: with dUTP-PEG-B. Lane 3: as in lane 2 but strepavidin was added after the reaction and before electrophoresis. Lane 4: with (dUTP-PEG-B)1-SA. Lane 5: with (dUTPPEG-B)1-SA but EDTA added to suppress incorporation by the polymerase. Lane 6: with (dUTP-PEG-B)1-SA and 50 µM dTTP as a competitor. Lane 7: with (dUTP-PEG-B)1-SA but without dCTP, to test misincorporation. A: Extended primer after incorporation of dUTPPEG-biotin and subsequent binding of exogenous streptavidin (lane 3) or after incorporation of (dUTP-PEG-B)1-SA (lane 4). B: Extended primer after incorporation of dUTP-PEG-B in the absence of SA (lane 2). C: Extended primer after incorporation of five unmodified nucleotides ACTAA (lane 6). D: primer T7-19-Cy3 only (lane 1). Abbreviations for nucleotide conjugate structures: Streptavidin (SA), poly(ethylene glycol) (PEG), biotin (B).

control (Figure 2, lane 1). In the presence of polymerase, the primer was extended and dUTP-PEG-B incorporated, seen as a drastic shift in mobility (Figure 2, lane 2). The incorporation of dUTP-PEG-B was verified by incubation of the extended primer with saturating amounts of streptavidin before electrophoresis. This led to a further increase in molecular weight and electrophoretic retardation (Figure 2, lane 3). When (dUTPPEG-B)1-SA (which already contains streptavidin) was used instead of dUTP-PEG-B in the extension assay, the extended primer showed the same mobility in electrophoresis (Figure 2, lane 4). The result demonstrates that (dUTP-PEG-B)1-SA was indeed incorporated during the extension assay by Klenow fragment (exo-) DNA polymerase. Three more controls tested the correct enzymatic incorporation of (dUTP-PEG-B)1-SA into the growing DNA strand. When EDTA was added to suppress the Mg2+-dependent polymerase activity, no incorporation was detected (Figure 2, lane 5). Incorporation of (dUTP-PEG-B)1SA was outcompeted when dTTP (50 µM final concentration) was added to the extension reaction (Figure 2, lane 6). To test the ability of polymerase to discriminate complementary and noncomplementary base pairing of (dUTP-PEG-B)1-SA, the extension reaction was performed with dATP and (dUTP-PEGB)1-SA, but without dCTP and dGTP. In this reaction, for (dUTP-PEG-B)1-SA to be incorporated, the polymerase would have to incorporate it opposite the guanosine base, i.e., noncomplementary base, but no incorporation was seen (Figure 2, lane 7). Two other DNA polymerases, Taq and Vent (exo -), were also able to use compound 3 in the incorporation reaction (results not shown). In similar assays, compounds dCTP-PEG-B, (dCTPPEG-B)1-SA, and (dUTP-PEG-B)4-SA (compounds 2, 4, and 5) were tested and also found to be incorporated into the primer (results not shown). In contrast, (dUTP-16-B)4-SA (compound 8) was not incorporated at all. It contained a short linker between the nucleotide and streptavidin and, therefore, probably was not a suitable substrate for the Klenow fragment (exo-) DNA polymerase in the primer extension assay (Supporting Information Supplement 3, Figure 3, lanes 1 to 3). Two other DNA

Cherkasov et al.

Figure 3. Fluorescent gel image of electrophoretically separated Cy3 labeled primer and extension products with (dUTP-PEG-B)n-SA-PE. Standard primer extension assays were performed with Klenow fragment (exo-), “KF”, lanes 1 and 2; Taq Polymerase “Taq”, lanes 3 and 4; and Vent (exo-) Polymerase “Vent”, lanes 5 and 6. Controls contained EDTA to suppress the incorporation (lanes 2, 4, 6). A: extended primer after incorporation of (dUTP-PEG-B)n-SA-PE (lanes 1, 3, and 5). B: primer T7-19-Cy3 (lanes 2, 4, 6). Abbreviations for nucleotide conjugate structures: Streptavidin (SA), poly(ethylene glycol) (PEG), biotin (B), R-Phycoerythrin (PE).

polymerases, Taq and Vent (exo-), were also unable to use (dUTP-16-B)4-SA in the incorporation reaction (Supporting Information Supplement 3, Figure 3, lanes 4 to 9). The shift of electrophoretic mobility of strands extended by a single m-Nuc was considerable, compared to those extended by natural nucleotides (Figure 2). Upon incorporation of compound 1, the mobility of the extended oligonucleotide with the length of only 22 nucleotides corresponded to that of nucleic acid fragments with 100 to 150 nucleotides in length (Supporting Information Supplement 4, Figure 4, lane 2). After incorporation of the even larger compound 3, the mobility of the extended oligonucleotide corresponded to that of fragments with 500 to 700 nucleotides (Supporting Information Supplement 4, Figure 4, lane 3). The relative mobility of the molecules in the gel is influenced by charge, shape, and size of a molecule. All of them may have caused the mobility shift seen in m-Nuc extended oligonucleotides. Similar changes in mobility are known from the electophoretic mobility shift assays (EMSA) often used in the characterization of protein-nucleic acid interactions (23). Acceptance of m-Nucs with a Size of over 200 kDa. To test the influence of a ligand with an even larger size than that of streptavidin, a commercially available streptavidin-R-phycoerythrin conjugate (SA-PE) was used in the synthesis of a m-Nuc ((dUTP-PEG-B)n-SA-PE, compound 7). Standard primer extension assays were set up with (dUTP-PEG-B)n-SA-PE and Klenow fragment (exo-). The control reaction contained EDTA to suppress the Mg2+-dependent polymerase primer extension under exposure to UV illumination, fluorescent signals from Cy3 labeled primer as well as fluorescent signal from PE were used to detect the position of the reaction products. As shown in Figure 3, lane 1, (dUTP-PEG-B)n-SA-PE was successfully used as a substrate by Klenow Fragment (exo-) but not incorporated in the presence of EDTA (Figure 3, lane 2). Because (dUTP-PEG-B)n-SA-PE has its own strong fluorescence due to PE, the success of its incorporation by the Klenow fragment (exo-) was established by the appearance of a strong fluorescent signal in the top of the gel (lane 1, band A) and disappearance of the signal from the fluorescently labeled primer at the bottom of the gel (compare with lane 2, band B). This means the primer was consumed during the extension reaction. Acceptance of m-Nucs by Polymerases from Different Families. Because size, shape, and geometry of the polymerase itself, as well as differences in the nucleotide binding sites and enzymatic coupling rate may play a critical role in the acceptance of m-Nucs, two further polymerases, Taq polymerase (a member of the DNA polymerase family A), and Vent (exo-) polymerase (belonging to DNA polymerase family B) were


Figure 4. Signal intensities after primer extension with Fluorescein12-dUTP, Fluorescein-12-dCTP and (dUTP-PEG-B)4-SA-(PEG-Fluor)5. (A) Gel image of electrophoretically separated primers extended by fluorescently labeled nucleotides. Lane 1: Fluorescein-12-dCTP (dCTPFL). Lane 2: Fluorescein-12-dCTP and EDTA. Lane 3: Fluorescein12-dUTP (dUTP-FL). Lane 4: Fluorescein-12-dUTP and EDTA. Lane 5: (dUTP-PEG-B)4-SA-(PEG-Fluor)5. Lane 6: (dUTP-PEG-B)4-SA(PEG-Fluor)5 and EDTA. A: Extended primer after incorporation of (dUTP-PEG-B)4-SA-(PEG-Fluor)5. B: Extended primer after incorporation of Fluorescein-12-dCTP or Fluorescein-12-dUTP. (B) Relative fluorescence intensities of primer extension products from lanes 1, 3, and 5 in (A). Abbreviations for nucleotide conjugate structures: Streptavidin (SA), poly(ethylene glycol) (PEG), biotin (B), R-Phycoerythrin (PE), PEG-fluorescein (PEG-Fluor).

tested for their ability to use (dUTP-PEG-B)n-SA-PE (compound 7), the largest of all m-Nucs synthesized in this study. Standard primer extension assays were set up as described above. While most protocols recommend a temperature regime around 60-70 °C for optimal extension reaction by thermostable polymerases, it is known that Taq polymerase is active also at 37 °C (24). (dUTP-PEG-B)n-SA-PE contained protein (SA and PE). To avoid possible denaturation effects at elevated temperatures around 70 °C, the reactions were performed at 37 °C as for Klenow fragment (exo-). As a control for enzymatic incorporation, parallel reactions were set up with EDTA as described above. Both types of polymerases accepted (dUTPPEG-B)n-SA-PE as a substrate, as shown by the bright fluorescent bands at the top of the gel (Figure 3, lanes 3 and 5). The incorporation of (dUTP-PEG-B)n-SA-PE was suppressed by EDTA (Figure 3, lanes 4 and 6). The extent of primer consumption, however, differed between Taq and Vent (exo-) polymerases. While almost all primer was used up in the reaction with Taq, a fraction of the primer had not been extended in the reaction with Vent (exo-). The difference may by explained by a lower activity of Vent (exo-) polymerase at lower temperatures. We have not yet investigated this effect further. Comparison of Signal Intensities. To compare signal intensities of the new nucleotides with conventional fluorescein modified nucleotides, primer extension reactions were conducted with m-Nuc (dUTP-PEG-B)4-SA-(PEG-Fluorescein)5 (compound 6), which had been labeled with fluorescein, and


compared to extension reactions with commercially available Fluorescein-12-dUTP or Fluorescein-12-dCTP. The primer extension reactions were set up similarly to those described before with the exceptions that the primer used in these experiments was not labeled and specific combinations of nucleotides were used. The reaction mixes contained dATP and Fluorescein-12-dCTP (Figure 4A, lanes 1 and 2), dATP, dCTP, and Fluorescein-12-dUTP (Figure 4A, lanes 3 and 4), or dATP, dCTP, and (dUTP-PEG-B)4-SA-(PEG-Fluorescein)5 (Figure 4A, lanes 5 and 6). No fluorescent signal was observed in lanes with reactions containing EDTA (Figure 4A, lanes 2, 4, and 6), used as control to suppress enzymatic reaction. This means that wash steps were effective and no unspecific co-isolation of the fluorescently labeled nucleotides with magnetic beads occurred. As can be seen in Figure 4A, (dUTP-PEG-B)4-SA-(PEGFluorescein)5, as well as the commercially available fluorescently labeled nucleotides, was incorporated into the growing strand of DNA by the Klenow fragment (exo-). Due to the large size of the (dUTP-PEG-B)4-SA-(PEG-Fluorescein)5, the position of the fluorescent band was shifted toward the top of the gel (Figure 4A, lane 5) compared to the position of bands with the low molecular weight nucleotide analogues (Figure 4A, lanes 1 and 3). Since, according to the template sequence, only one fluorescently labeled nucleotide was incorporated in each growing DNA strand in the three primer extension reactions, the fluorescent signals were comparable. The signal intensity generated by incorporation of (dUTP-PEG-B)4-SA-(PEGFluorescein)5 (Figure 4B, lane 5) was about 7-fold stronger than the signal from Fluorescein-12-dCTP (Figure 4B, lane 1) and 15-fold stronger compared to the Fluorescein-12-dUTP signal (Figure 4B, lane 3). Besides this, we detected a difference in signal intensity between the two conventionally labeled nucleotides (Fluorescein-12-dCTP, lane 1, and Fluorescein-12-dUTP, lane 3) in this particular setting. Although we did not investigate this difference in detail, the signal heterogeneity between commercial dCTP and dUTP analogues may be explained by the remarkable sensitivity of fluorescein to the DNA microenvironment, particulary to the DNA sequence content (25, 26).

DISCUSSION The aim of this study was the synthesis and applicability testing of a novel kind of modified nucleotide which were labeled with several fluorescent dyes molecules per nucleotide. We describe here the design of such nucleotides and call them m-Nucs (for macromolecular nucleotides). The general structure comprises one or several nucleotide moieties, a large, macromolecular ligand labeled with dyes, and a macromolecular linear linker, which connects each nucleotide moiety with the macromolecular ligand. Using this new class of modified nucleotides in enzymatic incorporation reactions, signals from multiple dye molecules are obtained when only one nucleotide molecule is incorporated, thus considerably enhancing the signal strength of this nucleotide. For the construction of such nucleotides, several general aspects have to be taken into consideration. First, the individual dye molecules have to have sufficient distance from each other in order to achieve a strong fluorescent signal from each of them. To this end, dyes should be coupled to a larger structure, e.g., a polymer. In this study, streptavidin (SA) was used as a polymer and the dyes were coupled to its reactive surface groups via a PEG-linker. A second aspect refers to the fact that the large structure may impede the incorporation of nucleotides coupled to such macromolecular ligands. The solution found to overcome this limitation was a long hydrophilic linker, in this study, PEG, to separate the nucleotide moiety from the bulky streptavidin molecule. As a third aspect, the positioning of the linker on the


nucleotide itself is an important factor affecting the function of the nucleotide. Here, we used the 5-position of pyrimidines as acceptor sites for the linker, because its modifications are known to be tolerated by DNA polymerases (27, 28). Therefore, the pyrimidines 5-Allylamino-dUTP and 5-Propargylamino-dCTP were used by us as starting compounds to couple the PEGlinker to the nucleotide moiety. Once the m-Nucs were generated, their functionality had to be tested. Specifically, it had to be proven that coupling to a large molecule did not interfere with the substrate properties of the nucleotides during an incorporation reaction. Using dUTPPEG-B for a test, we showed that the modified nucleotides preserved their ability to be incorporated into the growing strand by the polymerases. This finding encouraged us to test whether a further modification, namely, coupling of either streptavidin modified by dyes or another even larger ligand like PE, would still result in conservation of substrate properties. In this paper, we demonstrate that this is indeed the case: the nucleotide moiety coupled to a macromolecular ligand via a long hydrophilic linker preserves its substrate properties. It can be incorporated into the growing nucleic acid chain by a number of DNA polymerases in a template-dependent manner. Therefore, such m-Nucs can be used in primer extension reactions. The ability to be incorporated proves that the nucleotide moiety preserves its accessibility to the nucleotide binding center of the polymerase. Usually, PEG-linkers influence the interaction of two compounds, providing a shielding effect that decreases the binding strength of a potential partner. Apparently, in the situation discussed here, PEG does not shield the nucleotide moiety, at least not completely, and allows an interaction between nucleotide and polymerase. Further, PEG apparently leaves sufficient mobility for the nucleotide moiety in the solution, thus preserving the substrate properties of a low molecular weight ligand. In contrast, a simple combination of a nucleotide carrying a convential short linker, dUTP-16-Biotin, with streptavidin led to an inhibition of incorporation of the nucleotide into the growing strand (Supporting Information, Supplement 3, Figure 3). We attribute this effect to steric hindrance by the large streptavidin molecule, brought about by the close proximity to the nucleotide moiety (linker length of only 16 atoms). This apparently repelled the polymerase and inhibited the polymerase-nucleotide interaction. The use of m-Nucs with a long linker and an increased number of dye molecules instead of conventionally labeled nucleotides with only short linker and one dye molecule offers several advantages. First, according to theoretical assumptions, the cumulative strength of fluorescent signal from m-Nuc should increase. This is supported by our findings that m-Nucs carrying multiple dye molecules indeed created increased fluorescent signal when compared to those from conventional fluorescently labeled nucleotides (see Figure 4). Second, because each fluorophore bound to m-Nuc can emit light independently from the others bound to the same m-Nuc, the effect of disturbing events such as blinking and bleaching, which lead to reduced visibility of a given dye molecule, should be minimized. Third, the long linker itself plays an important role by separating the fluorophores from the DNA strand. This feature is interesting because not only the pecularities of a single fluorophore introduce uncertanties in signal detection as discussed in the introduction, but also local DNA sequence content may have a strong influence on signal intensity of fluorophores. Several studies have analyzed those effects on commonly used fluorescent dyes like fluorescein, Cy3, and rhodamines, conjugated to the oligonucleotides via short linkers (25, 26, 29–34). Particularly, fluorescein is known to be sensitive to the local DNA sequence content (25, 26). We chose fluoresein as a fluorophore to label m-Nucs, in order to challenge the structure

Cherkasov et al.

of m-Nucs for such potentially detrimental effects. Indeed, there was a difference in fluorescent signal intensity even between incorporated commercial nucleotide analogues. The difference may be explained by quenching of fluorescence caused by DNA (see Figure 4). On the other hand, the fluorescence intensity of compound 6 exceeded the fluorescence of fluorescein modified dCTP and dUTP by more than five times, i.e., by a factor larger than a simple addition of fluorescence intensities of individual dyes would have predicted. We attribute this effect to the structure of m-Nucs. Apart from the number of dye molecules (e.g., in compound 6), the larger distance between the fluorophores in an incorporated m-Nuc and the nucleic acid strand may have contributed to the increase of fluorescence intensity. When placed in close proximity of a fluorochrome, guanosine bases are supposed to have a quenching effect on some commonly used fluorochromes (25, 33). Altogether, effects of the nucleic acid bases on the dye molecules of a particular incorporated m-Nuc may be minimized due to introduction of a long linker between the nucleotide moiety and the dyes, thus leading to a more uniform fluorescence and its independence from the sequence content. As pointed out in the Introduction, limitations in signal detection are one of the obstacles in the field of nanobiotechnology, especially in the field of DNA analysis on the single molecule level. We believe that m-Nucs may reveal a new perspective in this field. Until now, only a limited numbers of fluorophores, such as Rhodamine 6G, TAMRA, Cy3, Cy5, and several Alexa-dyes or Atto-dyes had sufficiently high quantum yields and stability for analyzing single fluorescent molecules in biological applications (2, 3, 6–8, 35). Because, within a m-Nuc, a large number of dyes can be coupled to the nucleotide, one can now use a larger variety of dyes of different nature and spectral properties. One particular application which may be considerably influenced by our novel m-Nucs, is single molecule nucleic acid sequencing. Here, the current technology deals with considerable limitations in part due to the use of conventionally labeled nucleotide structures including sequencing errors in the range 5-20% (17, 18). We anticipate that this error rate can be considerably decreased by the use of m-Nucs. Different additional requirements need to be met to use the m-Nucs for the sequencing at the single molecule level. In particular, it is desirable to have m-Nucs capable of supporting reversible termination for the sequencing by synthesis scheme and m-Nucs labeled with different fluorophores, e.g., with four different dyes corresponding to each nucleic base. To meet these requirements, we are presently adopting m-Nucs for reversible termination and sequencing reaction of nucleic acid strands (Cherkasov et al. manuscript in preparation).

ACKNOWLEDGMENT We thank Genovoxx GmbH for financial support and would like to thank the staff of Genovoxx GmbH for constructive discussions. We would also like to thank the reviewers of the manuscript for helpful criticism. Supporting Information Available: Additional related figures. This material is available free of charge via the Internet at http://pubs.acs.org.

LITERATURE CITED (1) Ha, T. (2001) Single-molecule fluorescence methods for the study of nucleic acids. Curr. Opin. Struct. Biol. 11, 287–92. (2) Joo, C., Balci, H., Ishitsuka, Y., Buranachai, C., and Ha, T. (2008) Advances in single-molecule fluorescence methods for molecular biology. Annu. ReV. Biochem. 77, 51–76.

Nucleotide Analogues with Enhanced Signal Properties (3) Roy, R., Hohng, S., and Ha, T. (2008) A practical guide to single-molecule FRET. Nat. Methods 5, 507–16. (4) Shi, J., Dertouzos, J., Gafni, A., and Steel, D. (2008) Application of single-molecule spectroscopy in studying enzyme kinetics and mechanism. Methods Enzymol. 450, 129–57. (5) Walter, N. G., Huang, C. Y., Manzo, A. J., and Sobhy, M. A. (2008) Do-it-yourself guide: how to use the modern singlemolecule toolkit. Nat. Methods 5, 475–89. (6) Weiss, S. (1999) Fluorescence spectroscopy of single biomolecules. Science 283, 1676–83. (7) Gensch, T., Bohmer, M., and Aramendia, P. F. (2005) Single molecule blinking and photobleaching separated by wide-field fluorescence microscopy. J. Phys. Chem. A 109, 6652–8. (8) Sabanayagam, C. R., Eid, J. S., and Meller, A. (2005) Long time scale blinking kinetics of cyanine fluorophores conjugated to DNA and its effect on Forster resonance energy transfer. J. Chem. Phys. 123, 224708. (9) Gupta, P. K. (2008) Single-molecule DNA sequencing technologies for future genomics research. Trends Biotechnol. 26, 602–11. (10) Marguerat, S., Wilhelm, B. T., and Bahler, J. (2008) Nextgeneration sequencing: applications beyond genomes. Biochem. Soc. Trans. 36, 1091–6. (11) Pettersson, E., Lundeberg, J., and Ahmadian, A. (2009) Generations of sequencing technologies. Genomics 93, 105–11. (12) Shendure, J., and Ji, H. (2008) Next-generation DNA sequencing. Nat. Biotechnol. 26, 1135–45. (13) Shendure, J. A., Porreca, G. J., and Church, G. M. (2008) Overview of DNA sequencing strategies. In Current Protocols in Molecular Biology; Chapter7, Unit 7 1, John Wiley & Sons, New York, NY. (14) Braslavsky, I., Hebert, B., Kartalov, E., and Quake, S. R. (2003) Sequence information can be obtained from single DNA molecules. Proc. Natl. Acad. Sci. U.S.A. 100, 3960–4. (15) Krieg, A., Ruckstuhl, T., and Seeger, S. (2006) Towards single-molecule DNA sequencing: assays with low nonspecific adsorption. Anal. Biochem. 349, 181–5. (16) Sauer, M., Angerer, B., Ankenbauer, W., Foldes-Papp, Z., Gobel, F., Han, K. T., Rigler, R., Schulz, A., Wolfrum, J., and Zander, C. (2001) Single molecule DNA sequencing in submicrometer channels: state of the art and future prospects. J. Biotechnol. 86, 181–201. (17) Eid, J., Fehr, A., Gray, J., Luong, K., Lyle, J., Otto, G., Peluso, P., Rank, D., Baybayan, P., Bettman, B., Bibillo, A., Bjornson, K., Chaudhuri, B., Christians, F., Cicero, R., Clark, S., Dalal, R., Dewinter, A., Dixon, J., Foquet, M., Gaertner, A., Hardenbol, P., Heiner, C., Hester, K., Holden, D., Kearns, G., Kong, X., Kuse, R., Lacroix, Y., Lin, S., Lundquist, P., Ma, C., Marks, P., Maxham, M., Murphy, D., Park, I., Pham, T., Phillips, M., Roy, J., Sebra, R., Shen, G., Sorenson, J., Tomaney, A., Travers, K., Trulson, M., Vieceli, J., Wegener, J., Wu, D., Yang, A., Zaccarin, D., Zhao, P., Zhong, F., Korlach, J., and Turner, S. (2009) Realtime DNA sequencing from single polymerase molecules. Science 323, 133–8. (18) Harris, T. D., Buzby, P. R., Babcock, H., Beer, E., Bowers, J., Braslavsky, I., Causey, M., Colonell, J., Dimeo, J., Efcavitch, J. W., Giladi, E., Gill, J., Healy, J., Jarosz, M., Lapen, D., Moulton, K., Quake, S. R., Steinmann, K., Thayer, E., Tyurina, A., Ward, R., Weiss, H., and Xie, Z. (2008) Single-molecule DNA sequencing of a viral genome. Science 320, 106–9. (19) Giller, G., Tasara, T., Angerer, B., Muhlegger, K., Amacker, M., and Winter, H. (2003) Incorporation of reporter moleculelabeled nucleotides by DNA polymerases. I. Chemical synthesis of various reporter group-labeled 2′-deoxyribonucleoside-5′triphosphates. Nucleic Acids Res. 31, 2630–5.

Bioconjugate Chem., Vol. 21, No. 1, 2010 129 (20) Gruber, H. J., Marek, M., Schindler, H., and Kaiser, K. (1997) Biotin-fluorophore conjugates with poly(ethylene glycol) spacers retain intense fluorescence after binding to avidin and streptavidin. Bioconjugate Chem. 8, 552–9. (21) Lakowicz, J. R., Malicka, J., Huang, J., Gryczynski, Z., and Gryczynski, I. (2004) Ultrabright fluorescein-labeled antibodies near silver metallic surfaces. Biopolymers 74, 467–75. (22) Marme, N., Knemeyer, J. P., Sauer, M., and Wolfrum, J. (2003) Inter- and intramolecular fluorescence quenching of organic dyes by tryptophan. Bioconjugate Chem. 14, 1133–9. (23) Hellman, L. M., and Fried, M. G. (2007) Electrophoretic mobility shift assay (EMSA) for detecting protein-nucleic acid interactions. Nat. Protoc. 2, 1849–61. (24) Kermekchiev, M. B., Tzekov, A., and Barnes, W. M. (2003) Cold-sensitive mutants of Taq DNA polymerase provide a hot start for PCR. Nucleic Acids Res. 31, 6139–47. (25) Nazarenko, I., Pires, R., Lowe, B., Obaidy, M., and Rashtchian, A. (2002) Effect of primary and secondary structure of oligodeoxyribonucleotides on the fluorescent properties of conjugated dyes. Nucleic Acids Res. 30, 2089–195. (26) Sjoback, R., Nygren, J., and Kubista, M. (1998) Characterization of fluorescein-oligonucleotide conjugates and measurement of local electrostatic potential. Biopolymers 46, 445–53. (27) Held, H. A., and Benner, S. A. (2002) Challenging artificial genetic systems: thymidine analogs with 5-position sulfur functionality. Nucleic Acids Res. 30, 3857–69. (28) Roychowdhury, A., Illangkoon, H., Hendrickson, C. L., and Benner, S. A. (2004) 2′-deoxycytidines carrying amino and thiol functionality: synthesis and incorporation by Vent (exo-) polymerase. Org. Lett. 6, 489–92. (29) Cuppoletti, A., Cho, Y., Park, J. S., Strassler, C., and Kool, E. T. (2005) Oligomeric fluorescent labels for DNA. Bioconjugate Chem. 16, 528–34. (30) Kurata, S., Kanagawa, T., Yamada, K., Torimura, M., Yokomaku, T., Kamagata, Y., and Kurane, R. (2001) Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY((R)) FL-labeled probe or primer. Nucleic Acids Res. 29, E34. (31) Neubauer, H., Gaiko, N., Berger, S., Schaffer, J., Eggeling, C., Tuma, J., Verdier, L., Seidel, C. A., Griesinger, C., and Volkmer, A. (2007) Orientational and dynamical heterogeneity of rhodamine 6G terminally attached to a DNA helix revealed by NMR and single-molecule fluorescence spectroscopy. J. Am. Chem. Soc. 129, 12746–55. (32) Sanborn, M. E., Connolly, B. K., Gurunathan, K., and Levitus, M. (2007) Fluorescence properties and photophysics of the sulfoindocyanine Cy3 linked covalently to DNA. J. Phys. Chem. B 111, 11064–74. (33) Torimura, M., Kurata, S., Yamada, K., Yokomaku, T., Kamagata, Y., Kanagawa, T., and Kurane, R. (2001) Fluorescencequenching phenomenon by photoinduced electron transfer between a fluorescent dye and a nucleotide base. Anal. Sci. 17, 155–60. (34) Vamosi, G., Gohlke, C., and Clegg, R. M. (1996) Fluorescence characteristics of 5-carboxytetramethylrhodamine linked covalently to the 5′ end of oligonucleotides: multiple conformers of single-stranded and double-stranded dye-DNA complexes. Biophys. J. 71, 972–94. (35) Luong, A. K., Gradinaru, C. C., Chandler, D. W., and Hayden, C. C. (2005) Simultaneous time- and wavelength-resolved fluorescence microscopy of single molecules. J. Phys. Chem. B 109, 15691–8. BC900364F

New Nucleotide Analogues with Enhanced Signal Properties

Recommend Documents