Research Article pubs.acs.org/synthbio
New Orthogonal Transcriptional Switches Derived from Tet Repressor Homologues for Saccharomyces cerevisiae Regulated by 2,4-Diacetylphloroglucinol and Other Ligands Shigehito Ikushima†,‡ and Jef D. Boeke*,†,§ †
High Throughput Biology Center and Department of Molecular Biology and Genetics, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, United States ‡ Central Laboratories for Key Technologies, KIRIN Company Limited, Yokohama, Kanagawa 236-0004, Japan § Institute for Systems Genetics and Department of Biochemistry & Molecular Pharmacology, NYU Langone Medical Center, New York, New York 10016, United States S Supporting Information *
ABSTRACT: Here we describe the development of tightly regulated expression switches in yeast, by engineering distant homologues of Escherichia coli TetR, including the transcriptional regulator PhlF from Pseudomonas and others. Previous studies demonstrated that the PhlF protein bound its operator sequence (phlO) in the absence of 2,4-diacetylphloroglucinol (DAPG) but dissociated from phlO in the presence of DAPG. Thus, we developed a DAPG-Off system in which expression of a gene preceded by the phlO-embedded promoter was activated by a fusion of PhlF to a multimerized viral activator protein (VP16) domain in a DAPG-free environment but repressed when DAPG was added to growth medium. In addition, we constructed a DAPG-On system with the opposite behavior of the DAPG-Off system; i.e., DAPG triggers the expression of a reporter gene. Exposure of DAPG to yeast cells did not cause any serious deleterious effect on yeast physiology in terms of growth. Efforts to engineer additional Tet repressor homologues were partially successful and a known mammalian switch, the p-cumate switch based on CymR from Pseudomonas, was found to function in yeast. Orthogonality between the TetR (doxycycline), CamR (D-camphor), PhlF (DAPG), and CymR (p-cumate)-based Off switches was demonstrated by evaluating all 4 ligands against suitably engineered yeast strains. This study expands the toolbox of “On” and “Off” switches for yeast biotechnology. KEYWORDS: yeast, transcriptional switch, TetR homologue, PhlF, 2,4-diacetylphloroglucinol, CymR
T
Another option for regulated expression of genes of interest is to use a synthetic promoter comprised of functional units from other species. The Tet-Off and -On systems are among the most popular expression switches that take advantage of the synthetic promoter. The Tet system is originally from Escherichia coli, in which the transcriptional regulator TetR binds to its operator sequence (tetO) only in the absence of its ligands, such as tetracycline and doxycycline.6 Notably, the Tet system can be applied to various species, such as mammalian cells and yeast.7−9 With respect to the key component TetR, there are a vast number of TetR homologues in bacteria and metagenomic samples,6,10 some of which have well-known operators and ligands. Recently, it was reported that one of the TetR homologues Pseudomonas putida CamR was utilized for the development of the camphor-Off switch in yeast, analogous to the Tet-Off switch.11 Camphor, the ligand for CamR, prevents binding between CamR and its operator (camO),
he yeast Saccharomyces cerevisiae is the premiere eukaryote for biotechnology, and the first to be sequenced.1 More recently, the first synthetic eukaryotic chromosomes and chromosome fragments of S. cerevisiae chromosome synIXR, semi-synVIL, synIII were built through a synthetic yeast genome project, Sc2.0.2,3 The organism benefits from the powerful genetic tools available to reveal gene functions, such as various mutant libraries, including the gene knockout collection4 and the overexpression collection that utilizes the intrinsic GAL1 promoter (GAL1pr) as a means to individually express genes at a high level.5 However, the popular GAL1pr has some potential disadvantages because it (a) requires a high concentration of galactose to induce expression, (b) leads to slow growth relative to glucose medium, and moreover, (c) may affect fundamental metabolism in a manner unrelated to the overexpressed gene product. Furthermore, being able to regulate different pathways independently in the same cell requires a series of distinct orthogonal promoter systems, each activated or repressed by its own ligand. Thus, it is highly desirable to have a palette of diverse chemically regulated promoters. © XXXX American Chemical Society
Received: July 23, 2016
A
DOI: 10.1021/acssynbio.6b00205 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Research Article
ACS Synthetic Biology resulting in camphor-dependent expression of reporter genes under the control of the camO-containing promoter. Moreover, camphor was found to have little impact on yeast growth. On the other hand, an IPTG-On switch is available, and exploits another E. coli repressor, LacI, in yeast.12 Using this system, a reporter gene was activated only in the presence of the LacI ligand IPTG (Isopropyl β-D-1-thiogalactopyranoside). Similar to the research in yeast, TetR homologues have been developed as switches in heterologous organisms other than yeast. One of them is a 2,4-diacetylphloroglucinol (DAPG)based switch using phlF gene in bacteria and mammalian cells.13 The transcriptional repressor PhlF from Pseudomonas f luorescens and related species, known to be a distant homologue of TetR, regulates expression of the DAPG biosynthetic gene phlA in a DAPG-dependent manner.14−16 Besides, other TetR homologues, namely EthR and CymR, have been applied as expression switches in heterologous organisms other than yeast.17−20 On the basis of the above literature, we engineered TetR homologues to develop novel expression switches in yeast, and the effort yielded well-behaved new switches that depend on DAPG (both off and on) and p-cumate (off). In particular, DAPG showed little effect of DAPG on yeast growth at working concentrations for the system. This article describes the possibility and challenges of developing additional ligand regulated TetR homologue-based expression switches in yeast.
■
RESULTS AND DISCUSSION Construction of a PhlF-Based Transcriptional Regulator and a phlF Operator-Embedded Promoter for the DAPG-Off System. One of the TetR homologues, a PhlFbased transcriptional activator, named phlTA, was constructed by fusing Pseudomonas PhlF (GenBank AAF20928.1) to three tandem repeats of a VP16 transcriptional activation domain derived from herpes simplex virus Type 1.21 Here, the CMVpr from human cytomegalovirus was used to drive the appropriate level of phlTA expression. The promoter used for phlFdependent expression of a reporter gene was built by embedding seven repeats of the phlF operator sequence (phlO) between the alcohol dehydrogenase ADH1 terminator and a CYC1 (cytochrome c) promoter from which the endogenous UAS (upstream activating sequence) had been removed. The resulting promoter was named phlPr, the architecture of which was analogous to a promoter used in yeast Tet- and Camphor-Off systems.7,11 The unit of the phlF operator used was 5′-TATGTATGATACGAAACGTACCGTATCGTTAAGGTAGCGT.14 The PhlF-derived transcriptional activator, phlTA, should bind phlPr to activate transcription of a reporter gene only in the absence of DAPG, the ligand of PhlF, and DAPG ligand binding is predicted to eliminate reporter expression in the presence of DAPG (Figure 1A). Performance of the DAPG-Off Switch with a GFP Reporter. The performance of the DAPG-Off system was examined using GFP as a reporter. A yeast transformant, DapGTA (SIY1001), which had phlTA and the phlPr-gf p reporter, was constructed by integrating plasmid pSIB918 in BY4741 (Tables 1 and 2). The DapG-TA strain showed significant expression of GFP in the absence of DAPG, unlike control strain BY4741 (Figure 1B). In addition, the GFP fluorescence of the DapG-TA was higher than that of the BY4741 control strain (background) in the presence of 12-μM DAPG, but decreased to the same level as BY4741 at 48-μM DAPG (Figure 1B−D). These data indicated that the expression of the
Figure 1. Characteristics of the DAPG-Off switch. (A) Schematic diagram of DAPG (PhlF)-OFF system using GFP as a reporter. The transactivator PhlTA, consisting of PhlF and VP16 binds to the phlO (phlF operator) region of promoter phlPr (= ADH1tr-phlO-CYC1pr) in the absence of DAPG. This results in steady expression of gf p. (B− D) Flow cytometric analyses in which FITC-A shows the intensity of GFP fluorescence. Strain BY4741 is wild type lacking a gf p gene, and DapG-TA is a BY4741-based strain that carries gf p gene under control of the DAPG-switch. (B) BY4741 in SC (broken line) and Strain DapG-TA in SC (solid line). (C) DapG-TA in SC and with 12 μM (solid line) and without DAPG (broken line). (D) DapG-TA in SC and with (solid line) and without 48 μM of DAPG (broken line). The broken lines in (C) and (D) are the same. (E) Time course of GFP fluorescence. The y-axis is the mean fluorescence values out of 10 000 counts. Red circles and blue squares represent DapG-TA cells grown in the absence or presence of 48-μM DAPG, respectively. Green triangles show BY4741 grown without DAPG. The plotted values are averages from four independent experiments, and the error bars reflect standard deviations that are not visible because of their small size.
reporter GFP was regulated in a DAPG-dependent manner, consistent with predictions. Furthermore, the DapG-TA strain was then used to evaluate the kinetics of the DAPG-Off switch. The intensity of GFP showed an increase over a 19-h period in the absence of DAPG, whereas the fluorescence reduced to background levels over 14 h of culture in the presence of 48 μM DAPG (Figure 1E). This duration of GFP expression is consistent with a half-life of GFP protein in yeast (around 7 h) and suggests transcriptional shutoff is rapid. Moreover, in terms of overall promoter strength, the GFP fluorescence of DapGTA at 19 h in SC is approximately 13% of the intensity a B
DOI: 10.1021/acssynbio.6b00205 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Research Article
ACS Synthetic Biology Table 1. Plasmids Used in This Study plasmid
origin
description
pSIB055a pSIB604a pLM270a pSIB233b pSIB230 pSIB270 pSIB024 pSIB918
AV AV AV AV AV AV AV pSIB604
pSIB927 pSIB883 pSIB337 pSIB833 pSIB924 pSIB921 pSIB726 pSIB170 pSIB145 pSIB084 pSIB133 pSIB220 pSIB166 pSIB222 pSIB454 pSIB750 pSIB531 pSIB431 pSIB503 pSIB803 pSIB470
pSIB918 pSIB230 pSIB233 pSIB230 pSIB230 pSIB270 pLM270 pSIB055 pSIB024 pSIB055 pSIB024 pSIB024 pSIB055 pSIB024 pSIB230 pSIB233 pSIB233 pSIB230 pSIB233 pSIB230 pSIB233
camr, HIS3, integrative (targetChVI), rfp ampr, LEU2, integrative (YKL162c), rf p ampr, 2 μ, LEU2, rf p ampr, KlURA3, centromeric/integrative (YKL162c), rf p ampr, Sphis5, centromeric/integrative (targetChVI), rfp ampr, LEU2, integrative (YKL162c), rf p ampr, kanMX/URA3, centromeric, rfp ampr, LEU2, integrative (YKL162c), phlPr (=ADH1tr-phlF operator-CYC1pr)-rfp (BsmBI, overhang of AATG/TGAG)-GSH1tr, CMVprphlTA (=phlF-VP16)-STR1tr ampr, LEU2, integrative (YKL162c), phlPr (=ADH1tr-phlF operator-CYC1pr)-gfp-GSH1tr, CMVpr-phlTA (=phlF-VP16)-STR1tr ampr, Sphis5, centromeric/integrative (targetChVI), phlPr (=ADH1tr-phlF operator-CYC1pr)-ADE2-GSH1tr ampr, KlURA3, centromeric/integrative (YKL162c), CMVpr-phlTA (=phlF-VP16)-STR1tr ampr, Sphis5, centromeric/integrative (targetChVI), ADHphO1 (=ADH1pr-phlF operator single)-ADE2-GSH1tr ampr, Sphis5, centromeric/integrative (targetChVI), ADHphO2 (=ADH1pr-phlF operator double)-ADE2-GSH1tr ampr, LEU2, integrative (YKL162c), TDH1pr-NLS-phlF-STR1tr ampr, LEU2, 2 μ, TDH1pr-NLS-phlF-STR1tr camr, HIS3, integrative (targetChVI), varPr (=ADH1tr-varR operator-CYC1pr)-gfp-GSH1tr ampr, kanMX/URA3, centromeric, CMVpr-varTA (=varR-VP16)-STR1tr camr, HIS3, integrative (targetChVI), lmrPr (=ADH1tr-lmrA/yxaF operator-CYC1pr)-gfp-GSH1tr ampr, kanMX/URA3, centromeric, CMVpr-lmrTAv1 (=lmrA-VP16)-STR1tr ampr, kanMX/URA3, centromeric, CMVpr-lmrTAv2 (=NLS-lmrA-VP16)-STR1tr camr, HIS3, integrative (targetChVI), icaPr (=ADH1tr-icaR operator-CYC1pr)-gf p-GSH1tr ampr, kanMX/URA3, centromeric, CMVpr-icaTA (=icaR-VP16)-STR1tr ampr, Sphis5, centromeric/integrative (targetChVI), ethPr (=ADH1tr-ethR operator-CYC1pr)-gfp-GSH1tr ampr, KlURA3, centromeric/integrative (YKL162c), CMVpr-ethTA(=NLS-ethR-VP16)-STR1tr ampr, KlURA3, centromeric/integrative (YKL162c), CMVpr-yxaTA (=NLS-yxaF-VP16-NLS)-STR1tr ampr, Sphis5, centromeric/integrative (targetChVI), dhaPr (=ADH1tr-dhaR operator-CYC1pr)-gfp-GSH1tr ampr, KlURA3, centromeric/integrative (YKL162c), CMVpr-dhaTA(=dhaR-VP16-NLS)-STR1tr ampr, Sphis5, centromeric/integrative (targetChVI), cymPr (=ADH1tr-cymR operator-CYC1pr)-gfp-GSH1tr ampr, KlURA3, centromeric/integrative (YKL162c), CMVpr-cymTA(=NLS-cymR-VP16)-STR1tr
a Lab stock. bIkushima et al. (2015).11 The other plasmids were constructed in this study (see Methods). Abbreviations: AV, acceptor vector; targetChVI, an intergenic region between GAT1/YFL021w and PAU5/YFL020c; camr, chloramphenicol resistant gene; ampr, ampicillin resistant gene; KlURA3, Kluyveromyces lactis URA3; Sphis5, Schizosaccharomyces pombe his5.
TDH1pr-gf p and 8-fold higher than KEX2pr-gf p (data not shown). Thus, the DAPG-Off switch should be useful to regulate gene expression for practical, middle-strength expression. With regards to effects of DAPG on growth, this study showed that there was little difference in the number of colonies formed in three media types: (a) SC with 24 -μM (5μg/mL) DAPG; (b) SC with 48-μM (10-μg/mL) DAPG; (c) SC without DAPG (Figure 2). However, previous work suggests that 10-μg/mL DAPG did not inhibit growth of BY4741,22 whereas cells of this background did show sensitivity to higher concentrations.23 DAPG-Off System with an ADE2 Reporter. A second reporter gene was used to further assess the performance of the DAPG-Off switch. Here, we examined whether the ADE2 gene under the control of phlPr complements the adenineauxotrophy of strain BY11204 in a DAPG-dependent manner (Figure 3). The BY11204-based yeast transformant phlA-EmV (phlA Empty vector), which had the phlPr-ADE2 reporter gene but not phlTA, showed solid growth on SC medium, but failed to grow in SC−Ade medium, irrespective of DAPG concentration. On the other hand, the phlA-TA strain, harboring both phlPr-ADE2 and phlTA showed proliferation in a DAPG-free SC−Ade medium. In contrast, the strain did not grow on SC−Ade medium containing 24 μM DAPG. Similarly to the GFP reporter (Figure 1B−E), the DAPG-Off
switch enabled very tight regulation of the reporter gene phlPrADE2. Moreover, no revertants appeared on SC−Ade agar plates on plating of 2.3 × 105 cells, consistent with a genetically stable DAPG-Off system. Construction of Off-Switches Using Other TetR Homologues. This study assessed other TetR homologues’ ligands and operators previously reported (Table 3): varR,24 lmrA,25,26 icaR,27 yxaF,25,26 dhaR,28 ethR,19 and cymR.17,18,20 The scheme to evaluate the switch candidates was similar to the DAPG-Off switch. A transcriptional activation domain of VP16 was added to the TetR homologues (transactivator), and operator sequences of them were interposed between the ADH1 terminator and UAS-less CYC1 promoter, followed by the gf p reporter. First, it was observed that all strains which had only the gf p reporter did not express GFP (data not shown); the strains were then transformed with plasmids to express the corresponding transactivators and expression was evaluated. Streptomyces virginiae antibiotic resistance regulator VarR tagged with VP16 induced strong GFP expression both in the absence and presence of the ligand virginiamycin S. This result suggests the hybrid transactivator is active, but virginiamycin may not be stably taken up in yeast cells. On the other hand, expressing a transactivator based on LmrA and VP16 gave rise to no gf p activity in the presence or absence of ligand. Since the fusion protein must enter the nucleus for expression in yeast, a nuclear localization signal (NLS) from SV4029 was added to C
DOI: 10.1021/acssynbio.6b00205 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Research Article
ACS Synthetic Biology Table 2. Yeast Strains Used in This Study strain BY4741a DapG-TA
another name SIY1001
BY11204a BY-ADE phlA-TA
SIY0979 SIY0987
phlA-EmV
SIY0990
varG-TA
SIY0155
lmr/yxaGlmrTAv1 lmr/yxaGlmrTAv2 icaG-TA
SIY0083
SIY0261
ethG-TA
SIY0743
lmr/yxaGyxaTA dhaG-TA
SIY0050
cymG-TA
SIY0809
SIY0256
SIY0525
a
BY4742 TetOffGb
SIY0555
camG-TAb
SIY0733
AphO1−2 μPhlF AphO1−2 μEmv AphO2−2 μPhlF AphO2−2 μEmv
SIY1018 SIY1016 SIY1026 SIY1024
genotype MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 BY4741 ykl162c::pSIB927 (LEU2, phlPr-gfp, phlTA) MATa leu2Δ1 his3Δ200 lys2Δ0 ura3−167 met15Δ0 ade2Δ::hisG BY11204 ade2Δ::hisG::ADE2 BY11204 targetChVI::pSIB883 (Sphis5, phlPrADE2) ykl162c::pSIB337 (KlURA3, phlTA) BY11204 targetChVI::pSIB883 (Sphis5, phlPrADE2) ykl162c::pSIB233 (KlURA3) BY4741 targetChVI::pSIB170 (HIS3, varPr-gf p) pSIB145 (kanMX/URA3, CEN, varTA) BY4741 targetChVI::pSIB084 (HIS3, lmr/yxaPrgfp) pSIB133 (kanMX/URA3, CEN, lmrTAv1) BY4741 targetChVI::pSIB084 (HIS3, lmr/yxaPrgfp) pSIB220 (kanMX/URA3, CEN, lmrTAv2) BY4741 targetChVI::pSIB166 (HIS3, icaPr-gf p) pSIB222 (kanMX/URA3, CEN, icaTA) BY4741 targetChVI::pSIB454 (Sphis5, ethPr-gfp) ykl162c::pSIB750 (KlURA3, ethTA) BY4741 targetChVI::pSIB084 (HIS3, lmr/yxaPrgfp) ykl162c::pSIB531(KlURA3+, yxaTA) BY4741 targetChVI::pSIB431 (Sphis5, dhaPr-gfp) ykl162c::pSIB503 (KlURA3, dhaTA) BY4741 targetChVI::pSIB803 (Sphis5, cymPrgfp) ykl162c::pSIB470 (KlURA3, cymTA) MATa his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 BY4742 targetChVI::pSIB527 (Sphis5, tetPr-gfp, tTA) BY4741 targetChVI::pSIB426 (Sphis5, camPrgfp) ykl162c::pSIB619 (KlURA3, camTA) BY11204 targetChVI::pSIB833 (Sphis5, ADHphO1-ADE2) pSIB726 (2 μ, LEU2, phlF) BY11204 targetChVI::pSIB833 (Sphis5, ADHphO1-ADE2) pLM270 (2 μ, LEU2) BY11204 targetChVI::pSIB924 (Sphis5, ADHphO2-ADE2) pSIB726 (2 μ, LEU2, phlF) BY11204 targetChVI::pSIB924 (Sphis5, ADHphO2-ADE2) pLM270 (2 μ, LEU2)
Figure 3. Evaluation of the DAPG-Off system using the ADE2 gene (CDS) as a reporter. Cells were cultured for 2 days at 30 °C in SC (A), SC−Ade (B), SC with 24 μM of DAPG (C), and SC−Ade with 24-μM DAPG (D). Cells were diluted 10-fold stepwise across each row.
solid ligand-independent GFP fluorescence with gentamicin and 2-benzyl acetate, respectively. EthR was previously reported as a useful switch in mammalian cells,19 but we were unable to achieve tight regulation of the switch in yeast. The reason behind residual gf p expression in the presence of the ligands remains unclear, but the amount of ligand able to penetrate yeast cell envelopes may not be sufficient to thoroughly prevent transactivator from binding to the operators. Potentially the use of pdr5 mutants or other drug-sensitized strains might confer responsiveness to such switches. By contrast, YxaF and DhaR did not confer detectable GFP expression even in the absence of their ligands, even though a NLS was appended. Possible reasons are that either amount of the transactivator expression, or alternatively, the affinity between the transactivators and the operator sequences chosen might be insufficient to induce reporter expression. Finally, CymR, a repressor involved in the p-cymene catabolic pathway in Pseudomonas putida did result in the expected expression profile of the relevant GFP reporter with p-cumate. Thus, we obtained one additional off-switch for yeast; the strain with the appropriate reporter and activator is called CymG-TA. Orthogonality of the Yeast Off-Switches. A series of switches anticipated for use together must be evaluated for orthogonality to maximize their utility. Thereby, we evaluated four switches of the Tet-Off, Camphor-Off, DAPG-Off, and Cumate-Off systems. When four strains that contained the switches independently were cultured in the absence and presence of the four ligands (doxycycline, camphor, DAPG, cumate), the intensity of reporter GFP fluorescence decreased to the background level only in the presence of the appropriate ligands, whereas in the presence of the inappropriate ligands, a strong GFP signal was observed, similar to that observed in the absence of any ligands (Figure 4). An exception to this trend was that cells with the Tet or Cam system showed lowered GFP fluorescence in the DAPG medium. Thus, DAPG may have slightly reduced orthogonality, but the GFP signal can also certainly be affected by other factors, such as growth phase (Figure 1E). In short, the results suggest that the four switches could be useful to construct complex biological circuits in which multiple reporter genes are regulated separately in a single strain. Indeed, our earlier work shows this to be the case
a
Agmon et al. (2015).31 bIkushima et al. (2015).11 The other strains were constructed in this study.
Figure 2. Effects of DAPG on plating efficiency of BY4741. Yeast strain BY4741 overnight culture in SC medium was diluted 25 000fold, and 100 μL was spread on SC, and SC containing 24-μM or 48 μM of DAPG. The number of colonies formed was counted after 2 days. The values were means and standard deviations calculated from three experiments.
LmrTA, resulting in strong expression of GFP; however as in the case of VarR-TA, it was not ligand (quercetin)-responsive. Differently from TetR and PhlF in the Tet- and DAPG-Off systems, these results show that some TetR homologues require an NLS in order to activate transcription while others do not. The TetR homologues IcaR and EthR also showed D
DOI: 10.1021/acssynbio.6b00205 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Research Article
ACS Synthetic Biology Table 3. Yeast Off-Switch Candidates Evaluated in the Study
expression of GFP switch candidate (strain)
TetR homologue (accession)
NLS
operator
Var-Off (varG-TA)
VarR (BAB32408)
w/o
varR operatora
Lmr-Offv1 (lmr/yxaGlmrTAv1) Lmr-Offv2 (lmr/yxaGlmrTAv2) IcaR-Off (icaG-TA)
LmrA (NP_388150) LmrA (NP_388150) IcaR (AAN17770.1) EthR (NP_218372)
w/o
N-end
lmrA/yxaF operatorb lmrA/yxaF operatorb icaR operatorc
N-end
ethR operatord lmrA/yxaF operatorb dhaR operatore cymR operatorf
Eth-Off (ethG-TA)
N-end
Yxa-Off (lmr/yxaGyxaTA) Dha-Off (dhaG-TA)
YxaF (BAA21585) DhaR (CAB65288)
N,Cends N-end
Cumate-Off (cymGTA)
CymR (AAB62296)
N-end
species
drug (concentration)
w/o drug
with drug
Streptomyces virginiae Bacillus subtilis
Virginiamycin S1 (2 mM)
On
On
Quercetin, Fisetin, Coumesterol
Off
ND
Bacillus subtilis
Quercetin (0.13 μM), Fisetin (0.19 μM), Coumesterol (0.22 μM) Gentamicin (10 mM)
On
On
On
On
2-Benzyl acetate (0.01%)
On
On
Quercetin, Fisetin, Coumesterol)
Off
ND
1-Chlorobutane
Off
ND
p-Cumate (150 μM)
On
Off
Staphylococcus epidermidis Mycobacterium tuberculosis Bacillus subtilis Mycobacterium sp. GP1 Pseudomonas putida
a
TGTCACTTGTACATCGTATAACTCTCATATACGTTGTAGAACAGTTC (4 repeats). b CTTTCTCCTACAATTATATAGAACGGTCTAGACAAATGAATGATAATATATAGACTGGTCTAAATTGGAGGAAGCGATA (3 repeats). cACAACCTAACTAACGAAAGGTAGGTGAA (6 repeats). dGTGTCGATAGTGTCGACATCTCGTTGACGGCCTCGACATTACGTTGATAGCGTGG (5 repeats). eAAGATGACCGGTCACCTT (7 repeats). fAAGAAAGAAACAAACCAACCTGTCTGTATTATCTC (6 repeats). Abbreviations: ND, Not determined.
downstream of ADH1pr, since there was an 8-fold difference in reversion frequency between the two strains. These results suggest that the DAPG-On system is useful for regulating expression of a gene of interest with the opposite logic of the DAPG-Off system. Perspectives. Expression switches that can be regulated with small compounds are widely used in biology-related studies. The Tet-Off and -On systems are among the most popular switches because of their advantages, e.g., tight regulation and ease of handling, but the number of such ligand regulated switches is very limited. Thus, more and better switches would enable more options to control gene expression. From this, the study assessed seven TetR homologues to develop transcription switches in yeast, resulting in new switches based on two TetR homologues, PhlF and CymR. They were named DAPG-Off, DAPG-On, and CumateOff switches in which DAPG or p-cumate prevented or triggered the expression of a reporter gene such as gf p and ADE2 at a concentration. The Cumate-Off switch should be further evaluated for reversion and performance with an auxotrophic reporter. However, most importantly, the novel two switches showed robust orthogonality to other useful switches such as the Tet- and camphor switches. These switches expand the repertoire of regulated gene expression in yeast (Table 4). On the other hand, this study did not yield controllable switches in the case of five other TetR homologues including EthR, which has been shown to work as a switch in mammalian cells. Thus, not all TetR homologues are directly applicable for use as a high performing expression switch in yeast. In the development of the DAPG-On switch, we speculated that a DAPG-On switch could be constructed by mutating phlTA, fusion of PhlF and triple repeats of VP16, because the transactivators of the Tet-On and Cumate-On switches (named rev-tTA) could be isolated from multiple missense mutants of the transactivators used in the Tet-Off and Cumate-Off systems, VP16-tethered TetR or CymR, respectively. In fact, it was confirmed that the Tet-On switch a transactivator based on the 5-amino acid residue TetR variant named rtTA-M29
for the Tet and Cam systems independently regulated in the same strain.11 Construction of Two Components for the DAPG-On System. We also attempted to develop On-switches that make it possible to induce expression of a gene of interest by ligand treatment. In particular, we developed a DAPG-On system based on the native transcriptional regulator and a phlOcontaining promoter. Here, a single and double repeat of phlO sequences were embedded downstream of the ADH1 promoter (ADH1pr) to build ADHphlO1 and ADHphlO2, leading to constitutive reporter expression in the absence of the transcriptional regulator. The two promoters were analogous in design to the ADHi promoter, which carries a single copy of the lac operator downstream of the ADH1pr,12 We then constructed a transcriptional regulator consisting of NLS and PhlF. This is expected to bind to the ADH1phlO promoter and sterically block transcription. It was expected that the reporter gene would express only in the presence of DAPG and the NLS-PhlF protein (Figure 5). DAPG-On System with an ADE2 Reporter. The performance of the DAPG-On system was assessed using ADE2 as a reporter in the ade2ΔBY11204 strain. When PhlF was not expressed in a strain that had the ADHphlOx-ADE2 cassette, the strain, named AphOx-2 μEmV, grew in adeninedeficient medium irrespective of DAPG addition as well as in adenine-containing medium (Figure 6). On the other hand, strain AphOx-2 μPhlF, which carried multiple copies of PhlF in addition to the ADHphlOx-ADE2 cassette, hardly grew at all on DAPG-free SC−Ade medium, consistent with binding of PhlF to phlO preventing expression of the ADHphlOx-driven ADE2 gene. However, both strains AphOx-2 μPhlF showed vigorous growth on a SC−Ade medium in the presence of 5 μM DAPG. These results suggest that DAPG released PhlF from the phlO region and led to expression of ADE2. With regard to the genetic stability of the DAPG-On system, the reversion frequencies to adenine-prototrophic (Ade+) clones were 9.4 × 10−6 and 1.2 × 10−6 for strains AphO1−2 μPhlF and AphO2−2 μPhlF respectively. It might be possible to enhance the stability further by increasing the copy number of phlO E
DOI: 10.1021/acssynbio.6b00205 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Research Article
ACS Synthetic Biology
Figure 4. Evaluation of four orthogonal systems (the Tet-Off, Camphor-Off, DAPG-Off, and Cumate-Off switches). The gf p gene was used as a reporter, and fluorescence was evaluated in SC medium, SC with 25-μM doxycycline, SC with 25-μM D-camphor, SC with 48-μM DAPG, and SC with 150-μM p-cumate across each column.
However, we were unable to isolate such a mutant with opposite behavior to the DAPG-Off system. In this study, we adopted another way to develop the DAPG-On system in which the binding of PhlF to the operator could sterically prevent the transcription of a reporter gene, resulting in relatively tight regulation of the ADE2 reporter (Figure 6). This strategy could be effective for developing additional Onswitches in yeast. As an alternative strategy, it might be more promising to look for other sources to construct a Compound-On switch. Notably, in natural environments, there is another type of TetR homologues that bind to an operator preferentially in the presence of a specific ligand. Those proteins could be made use of as a kind of “natural” rev-tTA. At present, a lot of quorumsensing (QS) molecules that function as transcriptional regulators are known.30 Interestingly, the binding of a TetR homologue, such as LuxR and TraR, to an operator sequence is triggered with a QS molecule. So far, we have not obtained a functional switch using the QS-related transactivators, but it
Figure 5. Schematic diagram of the DAPG-On switch using the ADE2 gene as a reporter (Abbreviation: phlO, phlF operator sequence).
showed doxycycline-dependent GFP expression in the opposite manner to the Tet-Off system in yeast (data not shown). F
DOI: 10.1021/acssynbio.6b00205 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Research Article
ACS Synthetic Biology
might be possible to construct a QS molecule-On switch from a number of QS-related TetR homologues. We hope that more and more transcriptional switches will be developed using TetR homologues as a great tool in biotechnology.
■
METHODS
Media. Yeast strains were cultured in YPD or SD-based medium supplemented with needed nutrients. SC is a fully supplemented medium of SD, and SC lacking three components, such as leucine, histidine, and adenine, is referred to as SC−Leu−His−Ade. The following drugs added to yeast media were purchased from Santa Cruz Biotechnology (Dallas, TX); 2,4-diacetylphloroglucinol (DAPG), coumesterol, and gentamicin. The drugs virginiamycin S1, quercetin, 2-benzyl acetate, D-camphor, and G418, were bought from SigmaAldrich (St. Louis, MO). Doxycycline, p-cumate (p-isopropylbenzoate), and fisetin were purchased from Clontech laboratories (Mountain View, CA), System Biosciences
Figure 6. Spot analysis using the ADE2 reporter under control of the DAPG-On system. Cells were cultured for 1 day at 30 °C in SC−Leu− His (A), SC−Leu−His−Ade (B), SC−Leu−His with 24-μM DAPG (C), and SC−Leu−His−Ade with 24-μM DAPG (D). The cells were diluted 10-fold stepwise across each row.
Table 4. Useful On and Off Switch Reagents for End Usersa plasmid
yGG-use
DAPG-Off system pSIB918 AV
restriction enzyme site (overhang of top/end-sides)
description
pSIB289 pSIB153
ampr, LEU2, integrative (YKL162c), phlPr (=ADH1tr-phlF operator-CYC1pr)-rfp-GSH1tr, CMVprphlTA (=phlF-VP16)-STR1tr kanr, phlTA (=phlF-VP16) kanr, phlPr (=ADH1tr-phlF operator-CYC1pr)
pSIB009 pSIB022
ampr, Sphis5, integrative (targetChVI), CMVpr-tTA(=tetR-VP16)-STR1tr, tetPr (=ADH1tr-tetR operator-CYC1pr)-rfp-GSH1tr ampr, tTA (=tetR-VP16) kanr, tetOPr (=ADH1tr-tetO operator-CYC1pr)
pSIB477 pSIB396
ampr, KlURA3, integrative (HO), TDH1pr-camTA (=camR-VP16-NLS)-STR1tr, camPr (=ADH1trcamR operator-CYC1pr)-rf p-SOL3tr kanr, camTA (=camR-VP16-NLS) kanr, camPr (=ADH1tr-camR operator-CYC1pr)
BsmBI (AATG/TGAG) BsaI (CAGT/AATG)
kanr, cymTA (=NLS-cymR-VP16) kanr, cymPr (=ADH1tr-cymR operator-CYC1pr)
BsaI (AATG/TGAG) BsaI (CAGT/AATG)
kanr, NLS-phlF kanr, ADHphO2 (=ADH1pr-phlF operator double)
BsaI (AATG/TGAG) BsaI (CAGT/AATG)
ampr, Sphis5, integrative (targetChVI), CMVpr-rtTA(=mutated tetR-VP16)-STR1tr, tetPr (=ADH1tr-tetR operator-CYC1pr)-rf p-GSH1tr ampr, rtTA (=muated tetR-VP16) −
BsmBI (AATG/TGAG)
kanr, kanr, kanr, kanr, kanr,
BsaI BsaI BsaI BsaI BsaI
Transactivator Promoter with operator Tet-Off system pSIB498 AV Transactivator Promoter with operator Camphor-Off system pSIB859 AV Transactivator Promoter with operator Cumate-Off system pSIB665 Transactivator pSIB795 Promoter with operator DAPG-On system pSIB199 Transactivator pSIB916 Promoter with operator Tet-On system pSIB499 AV pSIB010 pSIB022 Common pSIB027 pSIB237 pSIB031 pSIB206 pSIB639
Transactivator See above (TetOff) parts for yGG Promoter Promoter Terminator Terminator Terminator
TDH1 promoter (=TDH1pr) CMV promoter (mutated to be BsmBI-free) (=CMVpr) GSH1 terminator (=GSH1pr) STR1 terminator (mutated to be BsmBI-free) (=STR1tr) SOL3 terminator (=SOL3tr)
BsmBI (AATG/TGAG) BsmBI (AATG/TGAG) BsaI (CAGT/AATG)
BsmBI (AATG/TGAG) BsaI (AATG/TGAG) BsaI (CAGT/AATG)
BsmBI (AATG/TGAG)
BsaI (AATG/TGAG) −
(CAGT/AATG) (CAGT/AATG) (TGAG/TTTT) (TGAG/TTTT) (TGAG/TTTT)
a
Plasmids except for pSIB918 were not listed in Table 1, but details on the plasmids are described in the Supporting Information. Abbreviations: AV, acceptor vector; targetChVI, an intergenic region between GAT1/YFL021w and PAU5/YFL020c; ampr, ampicillin resistant gene; kanrr, kanamycin resistant gene. G
DOI: 10.1021/acssynbio.6b00205 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Research Article
ACS Synthetic Biology
Two other sets of plasmids were constructed. One set has a promoter corresponding to each of the tetR-homologues’ operator in a minimal promoter fragment fused to gf p as a reporter. The other is a group of vectors that constitutively express a transactivator consisting of the TetR homologue and VP16 (see Results and Discussion). The DNA sequences for TetR homologues were codon-optimized using GeneDesign33 for expression in yeast. Yeast Strains. Yeast strains are listed in Table 2. Strain BYADE was constructed by transforming ade2-deficient BY11204 with a PCR fragment containing the wild-type ADE2 amplified with primers SI-589 (5′-TCCACAATCAATTGCGAGAAGC) and SI-590 (5′-CATTTGTTGGAGGAAAGTTGTCC) using BY4741 genomic DNA as template, followed by selection of an adenine prototrophic phenotype. The other transformations to integrate the expression cassettes were conducted using DNA fragments prepared from the aforementioned pSIB-series of plasmids, previously digested with NotI. Flow Cytometry. Cellular fluorescence from GFP was determined by flow-cytometric analysis with a previously described method.11
(Mountain View, CA), and Fisher Scientific (Pittsburgh, PA), respectively. Escherichia coli cells were grown in Luria Broth (LB) medium. Carbenicillin (Sigma-Aldrich), kanamycin (SigmaAldrich), chloramphenicol (Sigma-Aldrich), or zeocin (Life Technologies, Carlsbad, CA) were used to select bacterial strains that had drug-resistant genes at final concentrations of 75, 50, 20, and 25 μg/mL respectively. Agar was added to 2% for Petri plates. Plasmids. The TOP10 strain of E. coli (F− mcrAΔ(mrrhsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(araleu) 7697 galUgalKrpsL (StrR) endA1 nupG) was used for the construction and amplification of plasmids. In this study, plasmids were constructed with previously described methods.11,31,32 The yeast GoldenGate (yGG) assembly method enabled “one-pot” plasmid construction because restriction enzymes and DNA ligase could be combined in a single reaction. The Type IIS restriction enzymes BsaI and BsmBI, were used to yield nonpalindromic sticky ends that ligate with one another in a predetermined order and directionality. The standard overhangs flanked by outward facing BsaI sites of the rf p gene were CAGT or TTTT in acceptor vectors unless otherwise described.31 Plasmids used in the study are shown in Table 1. In addition to yGG plasmids of pSIB055, pSIB604, pLM270, and pSIB233, 11,31 three yGG acceptor vectors were newly constructed as follows. Vectors pSIB230 and pSIB270 are convertible plasmids that can be used as either a centromeric plasmid or an integrative plasmid directed into yeast chromosomes VI or XI. Each has a yeast selection marker of KlURA3 and LEU2, respectively. Plasmid pSIB024 is a centromeric acceptor vector that confers phenotypes of uracil prototrophy (URA3) and resistance to G418. In the yGG assembly, the plasmids above were used with the following yGG components: two promoters, TDH1pr and CMVpr from human cytomegalovirus; three coding sequences (CDS), gf p, ADE2, and the rf p gene that turned the host E. coli cells bright red; two terminators, STR1tr and GSH1tr. All these parts were described previously.11 In particular, a specialized acceptor vector pSIB918, which is “yGG-ready” for putting any gene under the control of the DAPG-Off system (see Results and Discussion) in an integrated state at YKL162c gene with a single transformation, was constructed as follows. First, the rfp gene in the acceptor vector pSIB604 was replaced with the CMVpr, phlTA CDS, and the STR1tr. The resultant plasmid harbored a pair of BsmBI sites at the 5′-side of the CMVpr part to accommodate a second transcription unit cassette, and three DNA fragments, phlPr, rf p, and GSH1tr were ligated in the BsmBI gap to generate pSIB918. Plasmid pSIB927 was built by replacing rf p of pSIB918 with the gf p gene. A plasmid, pSIB883 was constructed by inserting phlPr, ADE2, and GSH1tr in yGG acceptor vector pSIB230. In order to build pSIB337, the rf p gene in pSIB233 was replaced with the CMVpr, CDS for phlTA, and the STR1tr. The three parts, a promoter ADHphlO1, ADE2, and GSH1tr, were cloned as a transcription unit into pSIB230 to yield pSIB833. A related plasmid, pSIB924, contains the promoter ADHphlO2 instead of ADHphlO1 of pSIB833. The 2 μ plasmid pSIB628 was used as an acceptor vector to build pSIB726, harboring a transcriptional unit consisting of TDH1pr, a nuclear localization signal (NLS)-fused PhlF and the STR1tr.
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssynbio.6b00205. Additional description of plasmids listed in Table 4 (PDF)
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. ORCID
Jef D. Boeke: 0000-0001-5322-4946 Author Contributions
S.I and J.D.B. designed the experiments. S.I. contributed the experimental data. S.I. and J.D.B. wrote the manuscript. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We thank Brynne Stanton, Alec Nielsen, Christopher Voigt and Boeke Lab members for valuable discussions and plasmids. This study was financially supported by the DARPA CLIO program (Contract no. N66001-12-C-4020).
■
ABBREVIATIONS Yeast GoldenGate, yGG; DAPG, 2,4-diacetylphloroglucinol; phlO, phlF operator sequence; NLS, nuclear localization signal; UAS, upstream activating sequence
■
REFERENCES
(1) Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W., Dujon, B., Feldmann, H., Galibert, F., Hoheisel, J. D., Jacq, C., Johnston, M., Louis, E. J., Mewes, H. W., Murakami, Y., Philippsen, P., Tettelin, H., and Oliver, S. G. (1996) Life with 6000 genes. Science 274, 546−567. (2) Annaluru, N., Muller, H., Mitchell, L. A., Ramalingam, S., Stracquadanio, G., Richardson, S. M., Dymond, J. S., Kuang, Z., Scheifele, L. Z., Cooper, E. M., Cai, Y., Zeller, K., Agmon, N., Han, J. S., Hadjithomas, M., Tullman, J., Caravelli, K., Cirelli, K., Guo, Z., London, V., Yeluru, A., Murugan, S., Kandavelou, K., Agier, N., Fischer, G., Yang, K., Martin, J. A., Bilgel, M., Bohutski, P., Boulier, K.
H
DOI: 10.1021/acssynbio.6b00205 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Research Article
ACS Synthetic Biology M., Capaldo, B. J., Chang, J., Charoen, K., Choi, W. J., Deng, P., DiCarlo, J. E., Doong, J., Dunn, J., Feinberg, J. I., Fernandez, C., Floria, C. E., Gladowski, D., Hadidi, P., Ishizuka, I., Jabbari, J., Lau, C. Y., Lee, P. A., Li, S., Lin, D., Linder, M. E., Ling, J., Liu, J., Liu, J., London, M., Ma, H., Mao, J., McDade, J. E., McMillan, A., Moore, A. M., Oh, W. C., Ouyang, Y., Patel, R., Paul, M., Paulsen, L. C., Qiu, J., Rhee, A., Rubashkin, M. G., Soh, I. Y., Sotuyo, N. E., Srinivas, V., Suarez, A., Wong, A., Wong, R., Xie, W. R., Xu, Y., Yu, A. T., Koszul, R., Bader, J. S., Boeke, J. D., and Chandrasegaran, S. (2014) Total synthesis of a functional designer eukaryotic chromosome. Science 344, 55−58. (3) Dymond, J. S., Richardson, S. M., Coombes, C. E., Babatz, T., Muller, H., Annaluru, N., Blake, W. J., Schwerzmann, J. W., Dai, J., Lindstrom, D. L., Boeke, A. C., Gottschling, D. E., Chandrasegaran, S., Bader, J. S., and Boeke, J. D. (2011) Synthetic chromosome arms function in yeast and generate phenotypic diversity by design. Nature 477, 471−476. (4) Giaever, G., Chu, A. M., Ni, L., Connelly, C., Riles, L., Veronneau, S., Dow, S., Lucau-Danila, A., Anderson, K., Andre, B., Arkin, A. P., Astromoff, A., El-Bakkoury, M., Bangham, R., Benito, R., Brachat, S., Campanaro, S., Curtiss, M., Davis, K., Deutschbauer, A., Entian, K. D., Flaherty, P., Foury, F., Garfinkel, D. J., Gerstein, M., Gotte, D., Guldener, U., Hegemann, J. H., Hempel, S., Herman, Z., Jaramillo, D. F., Kelly, D. E., Kelly, S. L., Kotter, P., LaBonte, D., Lamb, D. C., Lan, N., Liang, H., Liao, H., Liu, L., Luo, C., Lussier, M., Mao, R., Menard, P., Ooi, S. L., Revuelta, J. L., Roberts, C. J., Rose, M., RossMacdonald, P., Scherens, B., Schimmack, G., Shafer, B., Shoemaker, D. D., Sookhai-Mahadeo, S., Storms, R. K., Strathern, J. N., Valle, G., Voet, M., Volckaert, G., Wang, C. Y., Ward, T. R., Wilhelmy, J., Winzeler, E. A., Yang, Y., Yen, G., Youngman, E., Yu, K., Bussey, H., Boeke, J. D., Snyder, M., Philippsen, P., Davis, R. W., and Johnston, M. (2002) Functional profiling of the Saccharomyces cerevisiae genome. Nature 418, 387−391. (5) Gelperin, D. M., White, M. A., Wilkinson, M. L., Kon, Y., Kung, L. A., Wise, K. J., Lopez-Hoyo, N., Jiang, L., Piccirillo, S., Yu, H., Gerstein, M., Dumont, M. E., Phizicky, E. M., Snyder, M., and Grayhack, E. J. (2005) Biochemical and genetic analysis of the yeast proteome with a movable ORF collection. Genes Dev. 19, 2816−2826. (6) Ramos, J. L., Martinez-Bueno, M., Molina-Henares, A. J., Teran, W., Watanabe, K., Zhang, X., Gallegos, M. T., Brennan, R., and Tobes, R. (2005) The TetR family of transcriptional repressors. Microbiol. Mol. Biol. Rev. 69, 326−356. (7) Gari, E., Piedrafita, L., Aldea, M., and Herrero, E. (1997) A set of vectors with a tetracycline-regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae. Yeast 13, 837−848. (8) Lewandoski, M. (2001) Conditional control of gene expression in the mouse. Nat. Rev. Genet. 2, 743−755. (9) Urlinger, S., Baron, U., Thellmann, M., Hasan, M. T., Bujard, H., and Hillen, W. (2000) Exploring the sequence space for tetracyclinedependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc. Natl. Acad. Sci. U. S. A. 97, 7963−7968. (10) Stanton, B. C., Nielsen, A. A., Tamsir, A., Clancy, K., Peterson, T., and Voigt, C. A. (2014) Genomic mining of prokaryotic repressors for orthogonal logic gates. Nat. Chem. Biol. 10, 99−105. (11) Ikushima, S., Zhao, Y., and Boeke, J. D. (2015) Development of a tightly controlled Off switch for Saccharomyces cerevisiae regulated by camphor, a low-cost natural product. G3: Genes, Genomes, Genet. 5, 1983−1990. (12) Grilly, C., Stricker, J., Pang, W. L., Bennett, M. R., and Hasty, J. (2007) A synthetic gene network for tuning protein degradation in Saccharomyces cerevisiae. Mol. Syst. Biol. 3, 127. (13) Stanton, B. C., Siciliano, V., Ghodasara, A., Wroblewska, L., Clancy, K., Trefzer, A. C., Chesnut, J. D., Weiss, R., and Voigt, C. A. (2014) Systematic transfer of prokaryotic sensors and circuits to mammalian cells. ACS Synth. Biol. 3, 880−891. (14) Abbas, A., Morrissey, J. P., Marquez, P. C., Sheehan, M. M., Delany, I. R., and O’Gara, F. (2002) Characterization of interactions between the transcriptional repressor PhlF and its binding site at the phlA promoter in Pseudomonas f luorescens F113. J. Bacteriol. 184, 3008−3016.
(15) Ramette, A., Frapolli, M., Fischer-Le Saux, M., Gruffaz, C., Meyer, J. M., Defago, G., Sutra, L., and Moenne-Loccoz, Y. (2011) Pseudomonas protegens sp. nov., widespread plant-protecting bacteria producing the biocontrol compounds 2,4-diacetylphloroglucinol and pyoluteorin. Syst. Appl. Microbiol. 34, 180−188. (16) Schnider-Keel, U., Seematter, A., Maurhofer, M., Blumer, C., Duffy, B., Gigot-Bonnefoy, C., Reimmann, C., Notz, R., Defago, G., Haas, D., and Keel, C. (2000) Autoinduction of 2,4-diacetylphloroglucinol biosynthesis in the biocontrol agent Pseudomonas f luorescens CHA0 and repression by the bacterial metabolites salicylate and pyoluteorin. J. Bacteriol. 182, 1215−1225. (17) Eaton, R. W. (1997) p-Cymene catabolic pathway in Pseudomonas putida F1: cloning and characterization of DNA encoding conversion of p-cymene to p-cumate. J. Bacteriol. 179, 3171−3180. (18) Mullick, A., Xu, Y., Warren, R., Koutroumanis, M., Guilbault, C., Broussau, S., Malenfant, F., Bourget, L., Lamoureux, L., Lo, R., Caron, A. W., Pilotte, A., and Massie, B. (2006) The cumate gene-switch: a system for regulated expression in mammalian cells. BMC Biotechnol. 6, 43. (19) Weber, W., Schoenmakers, R., Keller, B., Gitzinger, M., Grau, T., Daoud-El Baba, M., Sander, P., and Fussenegger, M. (2008) A synthetic mammalian gene circuit reveals antituberculosis compounds. Proc. Natl. Acad. Sci. U. S. A. 105, 9994−9998. (20) Kaczmarczyk, A., Vorholt, J. A., and Francez-Charlot, A. (2013) Cumate-inducible gene expression system for sphingomonads and other Alphaproteobacteria. Appl. Environ. Microbiol. 79, 6795−6802. (21) Baron, U., Gossen, M., and Bujard, H. (1997) Tetracyclinecontrolled transcription in eukaryotes: novel transactivators with graded transactivation potential. Nucleic Acids Res. 25, 2723−2729. (22) Kwak, Y. S., Han, S., Thomashow, L. S., Rice, J. T., Paulitz, T. C., Kim, D., and Weller, D. M. (2011) Saccharomyces cerevisiae genomewide mutant screen for sensitivity to 2,4-diacetylphloroglucinol, an antibiotic produced by Pseudomonas f luorescens. Appl. Environ. Microbiol. 77, 1770−1776. (23) Troppens, D. M., Dmitriev, R. I., Papkovsky, D. B., O’Gara, F., and Morrissey, J. P. (2013) Genome-wide investigation of cellular targets and mode of action of the antifungal bacterial metabolite 2,4diacetylphloroglucinol in Saccharomyces cerevisiae. FEMS Yeast Res. 13, 322−334. (24) Namwat, W., Lee, C. K., Kinoshita, H., Yamada, Y., and Nihira, T. (2001) Identification of the varR gene as a transcriptional regulator of virginiamycin S resistance in Streptomyces virginiae. J. Bacteriol. 183, 2025−2031. (25) Yoshida, K., Ohki, Y. H., Murata, M., Kinehara, M., Matsuoka, H., Satomura, T., Ohki, R., Kumano, M., Yamane, K., and Fujita, Y. (2004) Bacillus subtilis LmrA is a repressor of the lmrAB and yxaGH operons: identification of its binding site and functional analysis of lmrB and yxaGH. J. Bacteriol. 186, 5640−5648. (26) Hirooka, K., Kunikane, S., Matsuoka, H., Yoshida, K., Kumamoto, K., Tojo, S., and Fujita, Y. (2007) Dual regulation of the Bacillus subtilis regulon comprising the lmrAB and yxaGH operons and yxaF gene by two transcriptional repressors, LmrA and YxaF, in response to flavonoids. J. Bacteriol. 189, 5170−5182. (27) Jeng, W. Y., Ko, T. P., Liu, C. I., Guo, R. T., Liu, C. L., Shr, H. L., and Wang, A. H. (2008) Crystal structure of IcaR, a repressor of the TetR family implicated in biofilm formation in Staphylococcus epidermidis. Nucleic Acids Res. 36, 1567−1577. (28) Poelarends, G. J., Kulakov, L. A., Larkin, M. J., van Hylckama Vlieg, J. E., and Janssen, D. B. (2000) Roles of horizontal gene transfer and gene integration in evolution of 1,3-dichloropropene- and 1,2dibromoethane-degradative pathways. J. Bacteriol. 182, 2191−2199. (29) Kalderon, D., Roberts, B. L., Richardson, W. D., and Smith, A. E. (1984) A short amino acid sequence able to specify nuclear location. Cell 39, 499−509. (30) Safari, M., Amache, R., Esmaeilishirazifard, E., and Keshavarz, T. (2014) Microbial metabolism of quorum-sensing molecules acylhomoserine lactones, gamma-heptalactone and other lactones. Appl. Microbiol. Biotechnol. 98, 3401−3412. I
DOI: 10.1021/acssynbio.6b00205 ACS Synth. Biol. XXXX, XXX, XXX−XXX
Research Article
ACS Synthetic Biology (31) Agmon, N., Mitchell, L. A., Cai, Y., Ikushima, S., Chuang, J., Zheng, A., Choi, W. J., Martin, J. A., Caravelli, K., Stracquadanio, G., and Boeke, J. D. (2015) Yeast Golden Gate (yGG) for the Efficient Assembly of S. cerevisiae Transcription Units. ACS Synth. Biol. 4, 853− 859. (32) Mitchell, L. A., Cai, Y., Taylor, M., Noronha, A. M., Chuang, J., Dai, L., and Boeke, J. D. (2013) Multichange isothermal mutagenesis: a new strategy for multiple site-directed mutations in plasmid DNA. ACS Synth. Biol. 2, 473−477. (33) Richardson, S. M., Wheelan, S. J., Yarrington, R. M., and Boeke, J. D. (2006) GeneDesign: rapid, automated design of multikilobase synthetic genes. Genome Res. 16, 550−556.
J
DOI: 10.1021/acssynbio.6b00205 ACS Synth. Biol. XXXX, XXX, XXX−XXX
