Novel Colorimetric Aptasensor for Zearalenone ... - ACS Publications

Subscriber access provided by UNIV OF YORK

Biological and Medical Applications of Materials and Interfaces

A novel colorimetric aptasensor for zearalenone detection based on nontarget-induced aptamer walker, gold nanoparticles and exonuclease-assisted recycling amplification Seyed Mohammad Taghdisi, Noor Mohammad Danesh, Mohammad Ramezani, Ahmad Sarreshtehdar Emrani, and Khalil Abnous ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b02349 • Publication Date (Web): 22 Mar 2018 Downloaded from http://pubs.acs.org on March 22, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

A novel colorimetric aptasensor for zearalenone detection based on nontargetinduced aptamer walker, gold nanoparticles and exonuclease-assisted recycling amplification Seyed Mohammad Taghdisia,b,¥, Noor Mohammad Daneshc,¥, Mohammad Ramezanid, Ahmad Sarreshtehdar Emranie, Khalil Abnousd,f,*

a

Targeted Drug Delivery Research Center, Pharmaceutical Technology Institute, Mashhad

University of Medical Sciences, Mashhad, Iran. b

Department of Pharmaceutical Biotechnology, School of Pharmacy, Mashhad University of

Medical Sciences, Mashhad, Iran c

Research Institute of Sciences and New Technology, Mashhad, Iran.

d

Pharmaceutical Research Center, Pharmaceutical Technology Institute, Mashhad University of

Medical Sciences, Mashhad, Iran. e

Cardiovascular Research Center, Faculty of Medicine, Mashhad University of Medical

Sciences, Mashhad, Iran f

Department of Medicinal Chemistry, School of Pharmacy, Mashhad University of Medical

Sciences, Mashhad, Iran ¥

These authors contributed equally to the work.

* Corresponding author: Prof. Khalil Abnous ([email protected]), Tel.: +98 513 1801535, Fax.: +98 513 882 3251

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Zearalenone (ZEN) toxicity is a significant risk for human beings. Thus, it is of high importance to develop sensitive, precise and inexpensive analytical methods for ZEN detection, especially in human serum. Here, a colorimetric aptasensor is presented for determination of ZEN based on nontarget-induced aptamer walker, catalytic reaction of gold nanoparticles (AuNPs), exonuclease III (Exo III) as signal amplifier and 4-nitrophenol as colorimetric agent. Low amount of ZEN requirement and signal amplification are some of the distinct advantages of the proposed aptasensor. In the absence of ZEN, the aptamer (Apt) starts walking on the AuNPs surface with the help of Exo III and binds to multiple complementary strands of aptamer (CSs), leading to change of sample color from yellow to colorless. Upon addition of ZEN, both Apt and CS exist as single-stranded DNAs (ssDNAs) on the surface of AuNPs, resulting in less access of 4-nitrophenol to the surface of AuNPs and less catalytic performance of AuNPs. In this situation, the color of sample remains yellow (the color of 4-nitrophenol). The presented aptasensor was capable to detect ZEN in a wide linear dynamic range, 20-80000 ng/L, with a detection limit of 10 ng/L. The prepared sensing strategy was successfully used for ZEN determination in human serum sample. Keywords: Aptamer walker; Zearalenone; gold nanoparticles; Exonuclease III; Sensor


Page 2 of 28

Page 3 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. Introduction Zearalenone (ZEN), a kind of resorcylic acid lactone, is a secondary metabolite produced by several Fusarium species.1,

2

ZEN has low acute toxicity in most

species and its LD50 in rats and chickens is more than 2 g/kg body weight.3 However, ZEN can be found in most of grain crops, including rice and wheat.4 Chronic exposure to ZEN can cause severe adverse effects, such as neurotoxicity, carcinogenicity and immunotoxicity.1, 5 Also, ZEN as a mycoestrogen can impair reproduction.6, 7 So, innovation in the design of analytical techniques for detection of ZEN is vitally important. Traditional methods for ZEN quantification include, liquid chromatography-mass spectrometry (LC-MS), immunochemical approaches, gas chromatography and high-performance liquid chromatography (HPLC). The majority of these analytical methods need complicated sample handling procedures and sophisticated instruments.8-10 Aptamers have been broadly applied as recognition probes for various targets with high

sensitivity

and

selectivity.11

Aptamers

are

short

single-chained

oligonucleotides isolated by a method known as systematic evolution of ligands by exponential enrichment (SELEX).12-13 They provide outstanding features over antibodies, due to their easy chemical synthesis, satisfactory stability, long-time storage and inexpensive production.14-16 ACS Paragon Plus Environment


Among different analytical strategies, aptamer-based colorimetric sensor has been widely used for routine analysis, owing to its convenience of visual observation, simplicity and real-time analysis.17-18 AuNPs are considered as the ideal nanoparticles for colorimetric analysis, due to their high extinction coefficient in the visible region, strong dependent optical characteristics and catalytic activity.19-21 Recently, an electrochemical binding-induced DNA walker sensor was introduced for recognition of thrombin.22 Signal amplification and high sensitivity were advantages of the mentioned electrochemical sensor. However, needing electrochemical workstation and split aptamers or two different aptamers for a target limits the application of this sensor, especially for other targets. Moreover, in the mentioned study, walking strand DNA and one of the aptamers existed in one sequence, which could influence the affinity of the aptamer. In this study, a colorimetric aptasensor was proposed for determination of ZEN based on nontarget-induced aptamer walker, exonuclease III (Exo III) and optical properties of AuNPs. The proposed sensing strategy exploits the catalytic performance of AuNPs, high sensitivity and low amount of target requirement of aptamer walker and Exo III-assisted signal amplification. Furthermore, the designed colorimetric aptasensor requires only one aptamer without addition of any sequence to it which can preserve the high affinity of aptamer towards its target.


Page 4 of 28

Page 5 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2. Materials and methods 2.1. The

Reagents zearalenone

aptamer

(Apt),23

5’-Thiol-

AGCAGCACAGAGGTCAGATGTCATCTATCTATGGTACATTACTATCTG TAATGTGATATGCCTATGCGTGCTACCGTGAA-3’,

and

its

partial

complementary sequence (CS), 5’-Thiol-TTTACGGTAGCACGCATAGGCAT3’, were synthesized by Bioneer (South Korea) (complementary sections have been shown with the same color). Ochratoxin A (OTA), sodium borohydride (NaBH4), aflatoxin B1 (AFB1), sodium citrate, human serum, aflatoxin M1 (AFM1), zearalenone (ZEN), 4-nitrophenol, Tris(2-carboxyethyl) phosphine hydrochloride (TCEP), vomitoxin (DON) and Gold (III) chloride trihydrate (HAuCl4) were purchased from Sigma-Aldrich (USA). Exonuclease III (Exo III) was obtained from Thermo Fisher Scientific (USA) 2.2.

Synthesis of water resuspended AuNPs

The water resuspended AuNPs were prepared by citrate reduction procedure according to our previous reports.24-25 The AuNPs amount was measured using extinction coefficient of 2.7 × 10

8

M-1 cm-1 at 520 nm. The appearance and the

size of AuNPs were evaluated by Transmission Electron Microscopy (TEM) (CM120, Philips, Netherland) and dynamic light scattering (Malvern, UK). The AuNPs solution was kept at 4°C in the dark. ACS Paragon Plus Environment


2.3.

Preparation of Apt-CS-modified AuNPs

The Apt and CS were first treated with 10 mM TCEP buffer (10 mM TCEP, 10 mM Tris-HCl, 1 mM EDTA, 50 mM NaCl, pH 7.4) for 1 h at 23°C, separately. The treated CS was added into the AuNPs solution to obtain final concentration of 0.1 µM for CS. After 12 h, the treated Apt (0.03 µM final concentration) was added to the above mixture for 12 h at 23°C. The mixture was kept at 4°C in the dark. 2.4.

Colorimetric detection of ZEN

The ZEN detection was carried out in a mixture containing 50 µL ZEN (0-150 µg/L), 10 µL Apt-CS-modified AuNPs (the AuNPs concentration was 4 nM) and 30 µL phosphate buffer saline (PBS, 2 mM, pH 7.4). The mixtures were incubated for 45 min at 23°C. Afterwards, 8 U Exo III was incubated with the each mixture for 60 min at 37°C. Then, the mixtures were treated with 40 µL 4nitrophenol (20 mM) and 40 µL NaBH4 (1.2 M) for 7 min at 23°C. Next, the absorbance (400 nm) of each mixture was recorded by a Synergy H4 microplate reader (BioTek, USA). 2.5.

Aptasensor selectivity

To determine the specificity of the aptasensor towards ZEN, other toxins such as OTA, AFM1, AFB1, and DON were examined for their interferences with the


Page 6 of 28

Page 7 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


colorimetric signal. The amount of each toxin was 80 µg/L and the incubation time was 45 min. 2.6.

Determination of ZEN in human serum sample

Firstly, various concentrations of ZEN (0-120 µg/L) were spiked into human serum samples. Thereafter, the samples (100 µL) were treated with 3 volumes of acetone/water (4:1) for 3 h at -20°C, followed by centrifugation at 14500 g for 10 min at 4°C. After that, 90 µL of each supernatant was collected for ZEN detection by the aptasensor.



3. Results and discussion 3.1.

ZEN detection principle

The detection method of the colorimetric aptasensor relies on the nontargetinduced aptamer walker, catalytic reaction of AuNPs, 4-nitrophenol as colorimetric probe and Exo III-aided CS degradation and signal amplification. Exo III is an enzyme which can specifically digest the 3’-terminus of doublestranded DNAs (dsDNAs).26-27 Schematic illustration of ZEN detection is displayed in Scheme 1. In the absence of ZEN, the Apt and its CS are into close proximity and hybridized with each other. With the introduction of Exo III, CS is degraded from its 3’-terminus, while Apt remains intact because of its Exo III-resistant 3’ overhanging terminus. The long arm of Apt allows it to walk and bind to another CS and the procedure continues, leading to unmask most of the AuNPs surface and the size of modified AuNPs was 16.9 ± 0.8 nm (Fig. S1(a)). So, 4-nitrophenol can easily reach the exposed surface of AuNPs and be reduced to 4-aminophenol by the surface of AuNPs (Fig. S2), resulting in the color change of environment from yellow to colorless.


Page 8 of 28

Page 9 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Upon addition of ZEN, Apt interacts with ZEN and is dissociated from its CS, owing to the stronger binding affinities of aptamers towards their targets.28-29 The resulted Apt/ZEN complex and CS, as ssDNAs on the surface of AuNPs, are resistant to Exo III digestion. In this situation, the size of modified AuNPs was 19.1 ± 1.2 nm (Fig. S1(b)). So, less amounts of 4-nitrophenol reach the AuNPs surface because of the steric hindrance of Apt/ZEN complex and intact CS on the surface of AuNPs. So, the environment color remains yellow. 3.2.

Characterization of AuNPs

Physical characterization of AuNPs by dynamic light scattering showed an average nanoparticle size of 15.2 ± 0.5 nm (Fig. S3(a)). Also, the results of TEM verified that the AuNPs were uniform in shape and size (Fig. S3(b)). 3.3.

Optimization of experimental conditions

The approch of 4-nitrophenol to the surface of AuNPs is crucial for the high sensitivity of the aptasensor when there is no target in the environment and it depends on the full function of Exo III for digestion of CS in the dsDNA structure (Apt/CS). In order to explore the optimum value of Exo III, different amounts of Exo III (0-15 U) were added to the mixture of Apt-CS-modified AuNPs, for 60 min at 37°C, followed by the incubation with 4-nitrophenol and NaBH4. According to the experimental principle, the absorbance (400 nm) is



reduced gradually with the increasing of the concentration of Exo III (in the absence of target). Results of experiment (Fig. 1(a)) showed that the optimum level of Exo III was 8 U. In this sensor, the colorimetric signal is also based on the reduction of 4nitrophenol to 4-aminophenol by the AuNPs surface. Therefore, it is vital to confirm the optimum time of reduction of 4-nitrophenol in the absence of target in which the 4-nitrophenol reaches more to the AuNPs surface compared to the presence of ZEN. 4-nitrophenol and NaBH4 were transferred to the mixture containing Exo III-treated Apt-CS-modified AuNPs and incubated for different times (0-12 min). The colorimetric signal was reduced with the reduction of 4nitrophenol by the AuNPs surface. As displayed in Fig. 1(b), the optimum incubation time of 4-nitrophenol was 7 min. Also, the ratio of Apt/CS captured on the surface of AuNPs could significantly affect the performance of the proposed aptasensor. In order to find the optimum ratio of Apt/CS, various ratios of Apt/CS were immobilized on the AuNPs surface, followed by the introduction of Exo III and 4-nitrophenol (Fig. 1(c)). Based on the experiment results, the minimum absorbance was observed when the ratio of Apt/CS was 3/10. When the ratio of Apt/CS was 1/10 more absorbance was observed, because the amount of Apt on the surface of AuNPs was not enough for hybridization with CS and digestion by Exo III, leading to


Page 10 of 28

Page 11 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


more remained intact CS on the surface of AuNPs. Also, when the ratio of Apt/CS was 5/10 more absorbance was detected, due to high concentration of Apt on the surface of AuNPs which acted as an obstacle for approaching of 4nitrophenol to the AuNPs surface. So, the ratio of 3/10 (Apt/CS) was adopted for the next experiments. 3.4.

Characterization of Apt-CS-modified AuNPs and the function of the aptasensor

The modification of AuNPs with Apt and CS was investigated by agarose gel electrophoresis (2.5 %). As displayed in Fig. 2(a), the band of CS-modified AuNPs (Fig. 2(a), lane 3) migrated less than the band of free CS (Fig. 2(a), lane 2), confirming the immobilization of CS on the AuNPs surface via Au-S bond. Following the addition of Apt to the CS-modified AuNPs, the mobility of the band of Apt was retarded (Fig. 2(a), lane 4), showing the immobilization of Apt on the surface of AuNPs. Optical measurement was applied to verify the performance of the sensing platform. The results showed when 4-nitrophenol and NaBH4 were mixed with the Apt-CS-modified AuNPs treated with ZEN and Exo III, the color of environment was yellow (Fig. 2(b), red curve), confirming the presence of Apt/ZEN complex and CS on the AuNPs surface, lack of walking of Apt on the surface of AuNPs and so, lack of reduction of 4-nitrophenol by AuNPs. Without ACS Paragon Plus Environment


introducing of ZEN, the environment color changed from yellow to colorless (Fig. 2(b), blue curve), following the addition of 4-nitrophenol and NaBH4 to Apt-CS-modified AuNPs treated with Exo III, verifying the digestion of CSs on the surface of AuNPs by Exo III due to the formation of dsDNA structure (Apt/CS) on the surface of AuNPs through walking of the Apt and high access of 4-nitrophenol, as a colorimetric agent, to the AuNPs surface. 3.5.

Aptasensor sensitivity

The colorimetric aptasensor was applied for sensitive quantification of ZEN (Fig. 3(a)). As displayed in Fig. 3(b), there is a linear fitting between the log concentration of ZEN and the relative colorimetric signal, in a dynamic range from 20 ng/L to 80000 ng/L. The limit of detection (LOD) for ZEN was 10 ng/L (S/N=3). The sensitivity of the aptasensor for ZEN detection was significantly enhanced compared with most of other analytical techniques which have been listed in Table S1.1, 8, 23, 30 Also, the designed aptasensor had a wider linear range relative to the most of these approaches. Among these analytical techniques, the electrochemical indirect competitive immunoassay1 showed better LOD and linear range compared to our aptasensor. However, this method needed 3.5 h analysis time and 2 kinds of antibodies, leading to increase of the cost of analytical method. While, the analysis


Page 12 of 28

Page 13 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


time of our aptasensor was less than 2 h and the sensing agent was aptaemr, leading to decrease of the cost of sensing platform. 3.6.

Specificity of the aptasensor

The selectivity of sensor is an important criterion for its operational capability. The selectivity of the presented aptasensor was evaluated by incubation of the aptasensor with different toxins, including OTA, AFM1, AFB1, and DON. All the concentrations of interferents were 80 µg/L. As depicted in Fig. 3(c), none of these interferents could induce great changes of the relative colorimetric signal, verifying that the aptasensor has high specificity for ZEN detection. 3.7.

Real sample analysis

In order to investigate the practical utility of the proposed aptasensor, the aptasensor response in a complex system like human serum was measured (Fig. 4). The sensing platform exhibited a low detection limit of 40 ng/L for ZEN in human serum, which is much lower than the LD50 of ZEN in most species. The results verified the practicality of the colorimetric analytical method for determination of ZEN in serum. Furthermore, the feasibility of the aptasensor was estimated in the spiked human serum using recovery assay. The recoveries for ZEN in spiked serum samples were in the range of 95-103% with relative standard deviations (RSDs) equal or less



than 7.1% (Table 1), exhibiting that the presented analytical technique could be applied to accurately detect ZEN concentration in biological sample.

4. Conclusion In conclusion, we demonstrated a colorimetric aptasensor for ZEN detection based on nontarget-induced aptamer walker, Exo III and AuNPs. The developed aptasensor showed excellent selectivity towards ZEN. The aptasensor significantly improved the ZEN detection sensitivity relative to other sensing platforms with a LOD of 10 ng/L. Such excellent sensing performance can be attributed to the Exo III-assisted signal amplification and prohibition of the aptamer walker in the presence of ZEN. The application of the aptasensor for detection of ZEN in serum sample further proved its reliability. All these characteristics indicate that the designed aptasensor is a promising analytical technique for detection of ZEN. Conflict of interest The authors declare that there are no conflicts of interest in regard to this study.


Page 14 of 28

Page 15 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Acknowledgment Financial support of this study was provided by Mashhad University of Medical Sciences. Supporting Information Reaction scheme of 4-nitrophenol; Size of synthesized AuNPs; TEM image of synthesized AuNPs; Comparison of the present work with other reported zearalenone sensing platforms. References (1) Xu, W.; Qing, Y.; Chen, S.; Chen, J.; Qin, Z.; Qiu, J. F.; Li, C. R. Electrochemical indirect competitive immunoassay for ultrasensitive detection of zearalenone based on a glassy carbon electrode modified with carboxylated multi-walled carbon nanotubes and chitosan. Microchimica Acta 2017, 184 (9), 3339-3347. (2) Liu, L.; Chao, Y.; Cao, W.; Wang, Y.; Luo, C.; Pang, X.; Fan, D.; Wei, Q. A label-free amperometric immunosensor for detection of zearalenone based on trimetallic Au-core/AgPtshell nanorattles and mesoporous carbon. Analytica Chimica Acta 2014, 847, 29-36. (3) Pitt, J. I. Chapter 30 - Mycotoxins A2 - Morris, J. Glenn. In Foodborne Infections and Intoxications (Fourth Edition); Potter, M. E., Ed.; Academic Press: San Diego, 2013; pp 409418. (4) Ji, F.; Mokoena, M. P.; Zhao, H.; Olaniran, A. O.; Shi, J. Development of an immunochromatographic strip test for the rapid detection of zearalenone in wheat from Jiangsu province, China. PLoS ONE 2017, 12 (5), e0175282. (5) Riberi, W. I.; Tarditto, L. V.; Zon, M. A.; Arévalo, F. J.; Fernández, H. Development of an electrochemical immunosensor to determine zearalenone in maize using carbon screen printed electrodes modified with multi-walled carbon nanotubes/polyethyleneimine dispersions. Sensors and Actuators, B: Chemical 2018, 254, 1271-1277. (6) Jarošová, B.; Javůrek, J.; Adamovský, O.; Hilscherová, K. Phytoestrogens and mycoestrogens in surface waters — Their sources, occurrence, and potential contribution to estrogenic activity. Environment International 2015, 81, 26-44. (7) Schwartz, P.; Thorpe, K. L.; Bucheli, T. D.; Wettstein, F. E.; Burkhardt-Holm, P. Short-term exposure to the environmentally relevant estrogenic mycotoxin zearalenone impairs reproduction in fish. Science of The Total Environment 2010, 409 (2), 326-333. (8) Afzali, D.; Fathirad, F. Determination of zearalenone with a glassy carbon electrode modified with nanocomposite consisting of palladium nanoparticles and a conductive polymeric ionic liquid. Microchimica Acta 2016, 183 (9), 2633-2638.



(9) Zhan, S.; Huang, X.; Chen, R.; Li, J.; Xiong, Y. Novel fluorescent ELISA for the sensitive detection of zearalenone based on H2O2-sensitive quantum dots for signal transduction. Talanta 2016, 158, 51-56. (10) Zhao, F.; Shen, Q.; Wang, H.; Han, X.; Yang, Z. Development of a rapid magnetic beadbased immunoassay for sensitive detection of zearalenone. Food Control 2017, 79, 227-233. (11) Sun, C.; Sun, R.; Chen, Y.; Tong, Y.; Zhu, J.; Bai, H.; Zhang, S.; Zheng, H.; Ye, H. Utilization of aptamer-functionalized magnetic beads for highly accurate fluorescent detection of mercury (II) in environment and food. Sensors and Actuators B: Chemical 2018, 255 (Part 1), 775-780. (12) Um, J. E.; Park, J. T.; Nam, B. Y.; Lee, J. P.; Jung, J. H.; Kim, Y.; Kim, S.; Park, J.; Wu, M.; Han, S. H.; Yoo, T. H.; Kang, S. W. Periostin-binding DNA aptamer treatment attenuates renal fibrosis under diabetic conditions. Scientific Reports 2017, 7 (1), 8490. (13) Mo, L.; Li, J.; Liu, Q.; Qiu, L.; Tan, W. Nucleic acid-functionalized transition metal nanosheets for biosensing applications. Biosensors and Bioelectronics 2017, 89 (Part 1), 201211. (14) Abnous, K.; Danesh, N. M.; Alibolandi, M.; Ramezani, M.; Sarreshtehdar Emrani, A.; Zolfaghari, R.; Taghdisi, S. M. A new amplified π-shape electrochemical aptasensor for ultrasensitive detection of aflatoxin B1. Biosensors and Bioelectronics 2017, 94, 374-379. (15) Figueroa-Miranda, G.; Feng, L.; Shiu, S. C.-C.; Dirkzwager, R. M.; Cheung, Y.-W.; Tanner, J. A.; Schöning, M. J.; Offenhäusser, A.; Mayer, D. Aptamer-based electrochemical biosensor for highly sensitive and selective malaria detection with adjustable dynamic response range and reusability. Sensors and Actuators B: Chemical 2018, 255 (Part 1), 235-243. (16) Verdian, A. Apta-nanosensors for detection and quantitative determination of acetamiprid – A pesticide residue in food and environment. Talanta 2018, 176 (Supplement C), 456-464. (17) Abnous, K.; Danesh, N. M.; Ramezani, M.; Emrani, A. S.; Taghdisi, S. M. A novel colorimetric sandwich aptasensor based on an indirect competitive enzyme-free method for ultrasensitive detection of chloramphenicol. Biosensors and Bioelectronics 2016, 78 (Supplement C), 80-86. (18) Gao, Z.; Qiu, Z.; Lu, M.; Shu, J.; Tang, D. Hybridization chain reaction-based colorimetric aptasensor of adenosine 5′-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes. Biosensors and Bioelectronics 2017, 89 (Part 2), 1006-1012. (19) Taghdisi, S. M.; Danesh, N. M.; Lavaee, P.; Emrani, A. S.; Ramezani, M.; Abnous, K. A novel colorimetric triple-helix molecular switch aptasensor based on peroxidase-like activity of gold nanoparticles for ultrasensitive detection of lead(II). RSC Advances 2015, 5 (54), 4350843514. (20) Mao, Y.; Fan, T.; Gysbers, R.; Tan, Y.; Liu, F.; Lin, S.; Jiang, Y. A simple and sensitive aptasensor for colorimetric detection of adenosine triphosphate based on unmodified gold nanoparticles. Talanta 2017, 168, 279-285. (21) Chen, Z.; Tan, L.; Hu, L.; Zhang, Y.; Wang, S.; Lv, F. Real Colorimetric Thrombin Aptasensor by Masking Surfaces of Catalytically Active Gold Nanoparticles. ACS Applied Materials and Interfaces 2016, 8 (1), 102-108. (22) Ji, Y.; Zhang, L.; Zhu, L.; Lei, J.; Wu, J.; Ju, H. Binding-induced DNA walker for signal amplification in highly selective electrochemical detection of protein. Biosensors and Bioelectronics 2017, 96, 201-205. (23) Yugender Goud, K.; Hayat, A.; Satyanarayana, M.; Sunil Kumar, V.; Catanante, G.; Vengatajalabathy Gobi, K.; Marty, J. L. Aptamer-based zearalenone assay based on the use of a


Page 16 of 28

Page 17 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fluorescein label and a functional graphene oxide as a quencher. Microchimica Acta 2017, 184 (11), 4401-4408. (24) Abnous, K.; Danesh, N. M.; Ramezani, M.; Alibolandi, M.; Lavaee, P.; Taghdisi, S. M. Aptamer based fluorometric acetamiprid assay using three kinds of nanoparticles for powerful signal amplification. Microchimica Acta 2017, 184 (1), 81-90. (25) Lavaee, P.; Danesh, N. M.; Ramezani, M.; Abnous, K.; Taghdisi, S. M. Colorimetric aptamer based assay for the determination of fluoroquinolones by triggering the reductioncatalyzing activity of gold nanoparticles. Microchimica Acta 2017, 184 (7), 2039-2045. (26) Yu, L.; Lan, W.; Xu, H.; Chen, H.; Bai, L.; Wang, W. Label-free detection of Hg2+ based on Hg2+-triggered toehold binding, Exonuclease III assisted target recycling and hybridization chain reaction. Sensors and Actuators B: Chemical 2017, 248 (Supplement C), 411-418. (27) Lu, L.; Su, H.; Li, F. Ultrasensitive Homogeneous Electrochemical Detection of Transcription Factor by Coupled Isothermal Cleavage Reaction and Cycling Amplification Based on Exonuclease III. Analytical Chemistry 2017, 89 (16), 8328-8334. (28) Ma, C.; Liu, H.; Zhang, L.; Li, H.; Yan, M.; Song, X.; Yu, J. Multiplexed aptasensor for simultaneous detection of carcinoembryonic antigen and mucin-1 based on metal ion electrochemical labels and Ru(NH3)63+ electronic wires. Biosensors and Bioelectronics 2018, 99 (Supplement C), 8-13. (29) Zhao, M.; Wang, P.; Guo, Y.; Wang, L.; Luo, F.; Qiu, B.; Guo, L.; Su, X.; Lin, Z.; Chen, G. Detection of aflatoxin B1 in food samples based on target-responsive aptamer-cross-linked hydrogel using a handheld pH meter as readout. Talanta 2018, 176, 34-39. (30) Wang, X.; He, Q.; Xu, Y.; Liu, X.; Shu, M.; Tu, Z.; Li, Y.; Wang, W.; Cao, D. Antiidiotypic VHH phage display-mediated immuno-PCR for ultrasensitive determination of mycotoxin zearalenone in cereals. Talanta 2016, 147, 410-415.


ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

AuNPs

Aptamer

Complementary strand

Zearalenone Exonuclease ACS Paragon Plus Environment III

Page 18 of 28

4-nitrophenol

4-aminophenol

NaBH4

Page 19 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47


Scheme 1. Representation of the colorimetric aptasensor for the detection of ZEN based on Exo III-assisted aptamer walker and catalytic reaction of AuNPs.



a)

b)


Page 20 of 28

Page 21 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


c)

Fig. 1. Optimum of the concentration of Exo III (a), the incubation time of 4-nitrophenol (b) and the ratio of Apt/CS (c) (n = 4).



1 2 3 4 a)

b)

Fig. 2. Confirmation of the formation and the function of the developed sensing method. (a) Evaluation of Apt-CS-modified AuNPs formation using agarose gel electrophoresis (2.5%). Lane 1: Apt, Lane 2: CS, Lane 3: CS-modified AuNPs, Lane 4: Apt-CS-modified AuNPs. (b) Absorbance spectra of the presented aptasensor in the absence (blue curve) and presence of ZEN (red curve).


Page 22 of 28

Page 23 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


a)

b)



c)

Fig. 3. (a) Absorbance spectra of the aptasensor in the presence of increasing concentrations of ZEN (0-150000 ng/L from bottom to top). (b) Calibration curve of the ZEN aptasensor. A0 and A are the absorbance at 400 nm before and after addition of various concentrations of ZEN, respectively. (c) The relative responses of the aptasensor towards ZEN and other toxins (the concentration of each toxin was 80 µg/L). A0 and A are the absorbance at 400 nm before and after addition of each toxin, respectively (n = 4).


Page 24 of 28

Page 25 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


a)

b)

Fig. 4. (a) Absorbance spectra of the aptasensor in the presence of increasing concentrations of ZEN (0-120000 ng/L from bottom to top) in serum. (b) Calibration curve of the ZEN aptasensor in serum. A0 and A are the absorbance at 400 nm before and after addition of various concentrations of ZEN, respectively (n = 4).



Page 26 of 28

Table 1. Recovery of ZEN from spiked human serum samples (n = 4). Data are mean ± relative RSD.

Serum

Added

Found

Recovery (%)

samples

ZEN (µg/L)

(µg/L)

1

2.0

1.9

95

7.1

2

15.0

15.2

101.3

6.4

3

60.0

61.8

103

2.6


RSD (%, n = 4)

Page 27 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1. Representation of the colorimetric aptasensor for the detection of ZEN based on Exo III-assisted aptamer walker and catalytic reaction of AuNPs. Fig. 1. Optimum of the concentration of Exo III (a), the incubation time of 4-nitrophenol (b) and the ratio of Apt/CS (c) (n = 4). Fig. 2. Confirmation of the formation and the function of the developed sensing method. (a) Evaluation of Apt-CS-modified AuNPs formation using agarose gel electrophoresis (2.5%). Lane 1: Apt, Lane 2: CS, Lane 3: CS-modified AuNPs, Lane 4: Apt-CS-modified AuNPs. (b) Absorbance spectra of the presented aptasensor in the absence (blue curve) and presence of ZEN (red curve). Fig. 3. (a) Absorbance spectra of the aptasensor in the presence of increasing concentrations of ZEN (0-150000 ng/L from bottom to top). (b) Calibration curve of the ZEN aptasensor. A0 and A are the absorbance at 400 nm before and after addition of various concentrations of ZEN, respectively. (c) The relative responses of the aptasensor towards ZEN and other toxins (the concentration of each toxin was 80 µg/L). A0 and A are the absorbance at 400 nm before and after addition of each toxin, respectively (n = 4). Fig. 4. (a) Absorbance spectra of the aptasensor in the presence of increasing concentrations of ZEN (0-120000 ng/L from bottom to top) in serum. (b) Calibration curve of the ZEN aptasensor in serum. A0 and A are the absorbance at 400 nm before and after addition of various concentrations of ZEN, respectively (n = 4). Table 1. Recovery of ZEN from spiked human serum samples (n=4). Data are mean ± relative RSD.




Page 28 of 28

Novel Colorimetric Aptasensor for Zearalenone ... - ACS Publications

Recommend Documents