ARTICLE pubs.acs.org/jpr
Phosphoproteomic Analysis of Human Mesenchymal Stromal Cells during Osteogenic Differentiation Ting Lo,§ Chia-Feng Tsai,^,4 Yu-Ru V. Shih,§ Yi-Ting Wang,^,O,z Sheng-Chieh Lu,# Ting-Yi Sung,# Wen-Lian Hsu,# Yu-Ju Chen,*,^,4,z and Oscar K. Lee*,†,‡,§,|| Department of Medical Research and Education and ‡Department of Orthopaedics and Traumatology, Taipei Veterans General Hospital, Taipei, Taiwan § Institute of Clinical Medicine and Stem Cell Research Center, National Yang-Ming University, Taipei, Taiwan ^ Institute of Chemistry and Genomics Research Center, zChemical Biology and Molecular Biophysics Program, Taiwan International Graduate Program, Institute of Chemistry, and #Institute of Information Science, Academia Sinica, Taipei, Taiwan 4 Department of Chemistry and OInstitute of Biochemical Sciences, National Taiwan University, Taipei, Taiwan )
†
bS Supporting Information ABSTRACT: Human mesenchymal stromal cells (hMSCs) are promising candidates for cell therapy and tissue regeneration. Knowledge of the molecular mechanisms governing hMSC commitment into osteoblasts is critical to the development of therapeutic applications for human bone diseases. Because protein phosphorylation plays a critical role in signaling transduction network, the purpose of this study is to elucidate the phosphoproteomic changes in hMSCs during early osteogenic lineage commitment. hMSCs cultured in osteogenic induction medium for 0, 1, 3, and 7 days were analyzed by liquid chromatography tandem mass spectrometry (LC MS/MS). Surprisingly, we observed a dramatic loss of protein phosphorylation level after 1 day of osteogenic induction. Pathways analysis of these reduced phosphoproteins exhibited a high correlation with cell proliferation and protein synthesis pathways. During osteogenic differentiation, differentially expressed phosphoproteins demonstrated the dynamic alterations in cytoskeleton at the early stages of differentiation. The fidelity of our quantitative phosphoproteomic analyses were further confirmed by Western blot analyses, and the changes from protein expression or its phosphorylation level were distinguished. In addition, several ion channels and transcription factors with differentially expressed phosphorylation sites during osteogenic differentiation were identified and may serve as potentially unexplored transcriptional regulators of the osteogenic phenotype of hMSCs. Taken together, our results have demonstrated the dynamic changes in phosphoproteomic profiles of hMSCs during osteogenic differentiation and unraveled potential candidates mediating the osteogenic commitment of hMSCs. The findings in this study may also shed light on the development of new therapeutic targets for metabolic bone diseases such as osteoporosis and osteomalacia. KEYWORDS:
’ INTRODUCTION Human mesenchymal stromal cells (hMSCs) exist in various human tissues1 3 and possess multilineage differentiation capabilities to differentiate into various cell lineages, such as osteoblasts, chondrocytes, adipocytes, and hepotocytes, making them an attractive source for cell therapy and tissue regeneration.4,5 In particular, chemical induction formulas are well established for the differentiation of hMSCs into osteoblasts,6,7 and the process of osteogenic differentiation has been extensively studied. Differentiation of osteoblasts is known to be regulated by multiple extracellular signaling molecules that act through intracellular molecular pathways to promote the activation of signaling proteins and transcription factors.8 Signaling molecules such as r 2011 American Chemical Society
Wnt, bone morphogenetic protein (BMP), fibroblast growth factors, and hedgehog signaling pathways are involved in the regulation of specific transcription factors,9 including Runtrelated transcription factor 2 (Runx2), osterix, and activating transcription factor (ATF4), which mediate the transcription of osteoblast-related genes such as type I collagen (ColI), osteopontin (OPN), and osteocalcin (OCN) during different stages of maturation and are essential for the initiation and differentiation of hMSCs toward the osteogenic lineage.10 13 Received: May 20, 2011 Published: November 15, 2011 586
dx.doi.org/10.1021/pr200868p | J. Proteome Res. 2012, 11, 586–598
Journal of Proteome Research Advances in proteomic technology have made it a powerful tool to detect the changes of protein expression profile in target cells of interest. With regard to the demand of new therapeutic applications for metabolic bone diseases, it is imperative to gain more knowledge pertaining to the mechanism of hMSC commitment and differentiation into osteoblasts.14 Recently, several studies have focused on the proteomic profiles of MSCs undergoing osteogenesis using two-dimensional gel electrophoresis (2DE) followed by mass spectrometry (MS) analysis. However, the information of biomarkers demonstrating osteogenic differentiation in hMSCs is limited, because the identified proteins from 2DE are restricted to no more than 50 proteins,15 17 and the selected time points after 14 days of induction can identify only osteogenic markers rather than osteogenic mediators.18,19 A recent study using liquid chromatography tandem mass spectrometry (LC MS/MS) analysis has identified 410 differentially expressed secretory proteins during osteoblast differentiation of hMSCs and demonstrated the regulatory role of SPARC-related modular calcium-binding protein 1, an extracellular matrix protein.20 In addition, Bennett et al. has reported the differential proteomic profiles characterizing hMSCs, partially differentiated hMSCs, and human osteoblasts using 2D LC MS/MS analysis with 758 identified proteins.21 So far, there are a few studies investigating the proteomic changes during osteogenic differentiation of MSCs. However, information regarding the phosphoproteomic changes in MSCs during differentiation is lacking. Protein phosphorylation refers to the process that reversibly phosphorylates the serine/threonine and tyrosine residues of target proteins by specific kinases and phosphatases.22,23 Since the functions of many proteins are either activated or inactivated by phosphorylation, the understanding of status function relationship of phosphorylation is crucial for studying the intracellular signaling transduction network triggered by internal or external stimuli during differentiation. Progress in MS-based phosphoproteomic analysis and quantification methods has potentiated the identification of thousands to more than 20,000 phosphopeptides in one experiment.24 26 Furthermore, our previous works have demonstrated a simple label-free strategy that combined the pH/acid-controlled immobilized metal affinity chromatography (IMAC) protocol to enlarge the number of quantifiable phosphopeptides and the four-dimensional algorithm to elevate the site-specific quantitation accuracy.27,28 The purpose of this study is to take advantage of this label-free quantitative phosphoproteomic platform to systematically elucidate the dynamic changes of signal transduction in hMSCs during the early stage of osteogenic differentiation. Studies on phosphoproteomic changes of pluripotent human embryonic stem cells (hESCs) and their retinoic acid induced differentiated derivatives have advanced the understanding of ESC fate determination.26 Regarding studies on hMSCs, phosphoproteome of hMSCs has been reported using a sequential elution from IMAC (SIMAC) strategy,29 while titanium dioxide based phosphopeptide enrichment has been employed to obtain the phosphorylation profiles of plasma membrane proteins of hMSCs.30 Kratchmarova et al. has studied the effects of epidermal growth factor and platelet-derived growth factor on osteogenic conversion in hMSCs using MS-based proteomic analysis of antiphosphotyrosine immunoprecipitates.31 However, there is currently a lack of systemic investigations on the change in phosphoproteome of hMSCs during osteogenic differentiation. To the best of our knowledge, this is the first report utilizing such a phosphoproteomic approach to address the signaling dynamics
ARTICLE
and explore potential new markers that play a functional role during the osteogenic differentiation process in hMSCs.
’ MATERIALS AND METHODS Isolation, Maintenance, and Osteogenic Differentiation of hMSCs
hMSCs were isolated from human bone marrow as previous described with Institutional Review Board approval and informed consent.2 These cells were maintained in high glucose Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, St. Louis, MO) supplied with 10% fetal bovine serum (Invitrogen, Grand Island, NY), 10 ng/mL basic fibroblast growth factor (R&D systems, Inc., Minneapolis, MN), and 5 ng/mL epidermal growth factor (R&D systems, Inc.). For osteogenic induction, hMSCs were first seeded at 4000 cells/cm2, allowed to adhere for 24 h, and then changed to osteogenic induction medium consisting of Iscove’s modified Dulbecco’s medium (Sigma-Aldrich) supplemented with 0.1 μM dexamethasone (Sigma-Aldrich), 0.2 mM ascorbic acid (Sigma-Aldrich), and 10 mM β-glycerol phosphate (SigmaAldrich). Alkaline Phosphatase Staining and Alizarin Red S Staining
For evaluation of alkaline phosphatase activities, hMSCs after 1 week of osteogenic induction were fixed with 3.7% formaldehyde and stained with BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium; Sigma-Aldrich). For evaluation of mineralized matrix, hMSCs after 2 weeks of osteogenic induction were fixed with 3.7% formaldehyde and stained with 2%, pH 4.1 Alizarin Red S (Sigma-Aldrich) solution. RNA Extraction and Real-Time PCR Analysis
Total RNA was isolated from cells by RNAspin Mini (GE Healthecare, Buckinghamshire, U.K.) and treated with TURBO DNA-free (Ambion, Austin, TX) to remove contaminated DNA fraction followed by reverse transcription. Real-time polymerase chain reaction (PCR) was performed using 50 ng of cDNA on a StepOnePlus Real-Time System (Applied Biosystems, Mannheim, Germany) with TaqMan Fast Universal PCR Master Mix (Applied Biosystems, Foster city, CA). PCR conditions consisted of a 20-s activation of the master mix reagent at 95 C, followed by 40 cycles of 1 s at 95 C and 20 s at 60 C. Intron spanning primers specific for each gene were designed with corresponding probes from Universal ProbeLibrary (Roche Applied Sciences, Mannheim, Germany). The average threshold cycle (Ct) for each gene was normalized by TATA-binding protein. The primer sequences and probe numbers from Universal ProbeLibrary are as follows: Runx2 (forward, gtgcctaggcgcatttca; reverse, gctcttcttactgagagtggaagg; probe number, 29), periostin (forward, gaaccaaaaattaaagtgattgaagg; reverse, tgacttttgttagtgtgggtcct; probe number, 41), osteonectin (forward, gtgcagaggaaaccgaagag; reverse, tgtttgcagtggtggttctg; probe number, 77), type I collagen (forward, gggattccctggacctaaag; reverse, ggaacacctcgctctcca; probe number, 67), TATA-binding protein (forward, gctggcccatagtgatcttt; reverse, tccttgggttatcttcacacg; probe number, 3) Protein Extraction and Gel-Assisted Digestion
Total protein was obtained with cell lysis buffer (0.25 M Tris-HCl, pH 6.8, 1% SDS). Protein concentrations were determined with BCA Protein Assay Kit (Pierce, Rockford, IL). For LC MS/MS analysis, β-casein (Sigma-Aldrich) was added into cell lysate as internal standard phosphoprotein. Protein samples were subjected to gel-assisted digestion as previously described.32 Briefly, 587
dx.doi.org/10.1021/pr200868p |J. Proteome Res. 2012, 11, 586–598
Journal of Proteome Research
ARTICLE
protein samples were incorporated into a gel in Eppendorf directly. Twenty-five mM TEABC (triethylammonium bicarbonate; SigmaAldrich) containing 50% (v/v) ACN (HPLC-grade acetonitrile; Sigma-Aldrich) were used for the in-gel washing steps. The gel samples were dehydrated, vacuum-dried, and then digested with trypsin (protein/trypsin = 50:1, g/g) in 25 mM TEABC. Tryptic peptides were extracted with 5% (v/v) FA (formic acid; SigmaAldrich) in 50% (v/v) ACN and vacuum-dried at room temperature.
identified peptide that mention in this manuscript have been manually validated. Quantitative Analysis
Phosphopeptides were purified through IMAC (immobilized metal affinity chromatography) procedure as previously described.28,32 Briefly, peptide samples from trypsin digestion were reconstitute in loading buffer (6% (v/v) AA (acetic acid; Sigma-Aldrich), pH 3.0 adjusted by NaOH) and loaded into a pre-equilibrated IMAC column. Unbound peptides were removed by washing solution (75% (v/v) loading buffer and 25% (v/v) ACN). IMAC column was further equilibrated with loading buffer and then eluted with elution buffer (200 mM NH4H2PO4, pH 4.4). Eluted phosphopeptide samples were vacuum-dried for further LC MS/MS analysis.
Quantitative analysis of phosphopeptide was performed by IDEAL-Q software as previously described.28,36 Briefly, IDEAL-Q was used to sequentially process all peptides in each LC MS/ MS run, both identified and unidentified, to quantify as many peptides as possible. IDEAL-Q first predicted the retention time of identified peptide in its current run and then determined the peak cluster based on the predicted retention time. Therefore, the unidentified peptide can be detected and aligned according to these peak clusters with a similar peptide m/z (2-fold (log2fold change > 1) or 1) on day7 compared to day3 were determined by Ingenuity Pathway Analysis. The x-axis in panels b and c and the numbers next to the bar represent the log10(p value) of each canonical pathway calculated by Fisher’s exact test. Only the top 5 canonical pathways with the highest log10(p value) are shown.
sites after 1 day of osteogenic induction resulted from the effects of serum depletion in the osteogenic induction medium. Therefore, further studies focusing on the phosphoproteomic changes during differentiation should take into account the effects of serum depletion and should select the appropriate control time point to eliminate falsenegative interferences.
Figure 4b, where enzymes exhibited the largest proportion at 35% and transcription regulators were the second-ranked molecular functions at 18%. In addition, biological process annotation clustering of the differentially phosphorylated proteins was performed ,and several enriched biological processes are listed (Table 1 and Supplementary Table 3). The results indicated that the regulation of cytoskeleton organization, morphological changes, cell junction assembly, and protein transport may play important roles dominating early stage osteogenic commitment in hMSCs.
Phosphoproteomic Changes during Osteogenic Differentiation
Quantitative comparison of D1/D0, D3/D0, and D7/D0 was further performed to elucidate the phosphoproteomic changes in hMSCs during osteogenic differentiation (Supplementary Table 2). Differentially phosphorylated proteins during osteogenic differentiation were applied to IPA and DAVID analysis. The population of differentially phosphorylated proteins was defined as the number of total identified phosphoproteins excluding proteins that neither of its identified phosphorylation sites exhibited a >2-fold or
