Photoinduced Oligomerization of Arabidopsis thaliana Phototropin 2

Subscriber access provided by MONASH UNIVERSITY

Article

Photo-Induced Oligomerization of Arabidopsis Thaliana Phototropin 2 LOV1 Yusuke Nakasone, Yuki Kawaguchi, Sam-Geun Kong, Masamitsu Wada, and Masahide Terazima J. Phys. Chem. B, Just Accepted Manuscript • DOI: 10.1021/jp509448b • Publication Date (Web): 21 Nov 2014 Downloaded from http://pubs.acs.org on November 25, 2014

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

The Journal of Physical Chemistry B is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The Journal of Physical Chemistry

Photo-Induced Oligomerization of Arabidopsis thaliana Phototropin 2 LOV1

Yusuke Nakasone,† Yuki Kawaguchi,† Sam-Geun Kong,‡ Masamitsu Wada,‡ and Masahide Terazima†*

†

Department of Chemistry, Graduate School of Science, Kyoto University, Kyoto 606-8502,

Japan ‡

Department of Biology, Faculty of Sciences, Kyushu University, Fukuoka 812-8581, Japan

correspondence: Masahide Terazima Tel: +81-75-753-4026 e-mail: [email protected]

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: Phototropins are blue-light sensitive photoreceptor proteins in plants. Phototropins consist of two LOV (light, oxygen and voltage sensor) domains (LOV1 and LOV2) that undergo photochemical reactions. Although the photochemical reaction of the LOV2 domain has been investigated extensively, the reaction of the LOV1 domain remains unresolved. In this study, the reactions of the Arabidopsis phototropin 2 LOV1 (phot2LOV1) domain were revealed by the transient grating (TG) method. The TG signal showed a significant diffusion coefficient (D) change upon photoexcitation. This change was sensitive to the protein concentration and the observation time range. These observations were explained by assuming that there are reactive and non-reactive forms, and the fraction of these species is concentration dependent. From the concentration dependence of the dynamics, the monomer was found to form a dimer; however, the dimer does not exhibit an observable reaction. In the dark state, both species were in equilibrium and are not distinguishable spectroscopically. For the LOV1 domain with the hinge domain, the reaction scheme was the same as the LOV1 domain sample, but the D change was affected by the presence of the hinge region. This observation suggests that the hinge region undergoes a conformational change during the photoreaction.


Page 2 of 55

Page 3 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Phototropins are blue-light sensitive photoreceptor proteins in plants and green microalgae,1 and are involved in phototropism, chloroplast movement and stomata opening in plants.1-6 Higher plants such as Arabidopsis thaliana have two isoforms of phototropin (phot): phot1 and phot2.4, 7 These phots comprise two N-terminal blue-light sensitive domains, LOV1 and LOV2 (LOV = light, oxygen, and voltage sensor), a serine-threonine kinase domain in the C-terminal region and a linker domain that connects the LOV2 and the kinase domain. The LOV1 and LOV2 domains each non-covalently bind a flavin mononucleotide (FMN) molecule as a cofactor for the blue-light absorption and initiation of the photo-cyclic response.8 In the photo-cycle, photoexcited FMN undergoes FMN-C4a-cysteinyl adduct formation with an adjacent cysteine residue of the LOV domain, which slowly recovers on a minute timescale back to the non-covalently bound receptor-state situation in the dark.9-14 The biological roles of the LOV1 and LOV2 domains have been investigated and are known to be very different. The LOV2 domain regulates the kinase activity mainly,15-17 whereas the LOV1 domain has been considered to control the light sensitivity of phototropin.16,18 To understand the molecular mechanisms of the kinase activation and the different roles of the two LOV domains, the photochemistry of the LOV domains has to be



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

elucidated. Currently, the reaction of the LOV2 domain (including LOV2-linker) has been studied extensively. Photoexcitation of the phot2LOV2-linker has been shown to lead to the linker domain dissociating from the LOV2 domain within 140 µs and the linker helix is unfolded with a time constant of 2 ms upon photoexcitation.19,20 The dissociation and subsequent unfolding are important steps for kinase activation and are conserved in the phot1LOV2-linker with slight differences in the time constant (300 µs and 1 ms for dissociation and unfolding, respectively).21 In addition to the reaction of the linker helix, the importance of the A’ α-helix, which locates to the N-terminal side of the LOV2 domain, has recently been proposed by biochemical and biophysical studies.22-25 TG measurements showed that the A’ α-helix unfolded upon photoexcitation of the LOV2 domain with a time constant of 12 ms.26 This reaction may also be involved in the regulation of the kinase activity. Contrary to the extensive studies on the LOV2 domains, the photochemistry of the LOV1 domain has not been fully shown. The characteristic absorption spectrum change indicates that the initial photoreaction, adduct formation, is the same as that of the LOV2 domain.27 One major difference reported is that the LOV1 and LOV2 domains differ in their oligomeric states. For example, LOV2 exists as the monomer at a relatively low concentration (< 40 µM),28, 29 whereas phot1LOV1 and phot2LOV1 exist as dimers, indicating that LOV1


Page 4 of 55

Page 5 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


probably acts as a dimerization site.30-33 The observation that the reaction quantum yields of the phot1LOV1 and phot2LOV1 are less than those of LOV2 domains indicates that the photoreaction of the LOV1 domain may not be relevant for its biological function.34 Indeed, light sensitivity control was observed even when the reaction of the phot2LOV1 domain was blocked by replacing the cysteine, which forms a covalent bond with the chromophore, to alanine.16 The mechanism of adjusting the light sensitivity has been suggested for phot of Chlamydomonas reinhardtii (Cr-phot) in terms of controlling the recovery rate of the LOV2 domain by LOV1,18 because the photosensitivity is clearly correlated with the lifetime of the active state of LOV2.35 However, a previous study on phot1LOV1 from Arabidopsis showed that the LOV1 domain exists as a dimer in the dark, as reported previously, and photoexcitation of the dimer results in the formation of a transient tetramer.36 It has been suggested that the formation of a higher oligomer species would create a crowded condition around the LOV2-kinase and such a state may contribute to the suppression of the efficiency of light induced dissociation of the LOV2 from the kinase, and subsequently, attenuate the light sensitivity of phototropin. In the case of the phot1LOV1 domain from Arabidopsis; however, the quantum yield of the adduct formation (0.035) was much less than those of other LOV domains (0.13−0.35) and the biological importance of this reaction was rather



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

unconvincing because of the low accumulation of the lit state under physiological light conditions.34 Conversely, the phot2LOV1 from Arabidopsis has a relatively higher reaction yield (0.13) and its physiological importance has been reported in a biological study, i.e., the hypocotyl phototropic response is partially mediated by the phot2LOV1 domain in Arabidopsis.37 Therefore, the investigation of the reaction of phot2LOV1 should provide deeper insight into the role of the LOV1 domain. In any case, to understand the molecular mechanism of the photochemical reaction of phot, it is essential to show the reaction of each component of phot. The photochemistry of the phot1LOV2, phot2LOV2 and phot1LOV1 domains has been reported in detail so far.19,28,36 The reaction of phot2LOV1 has not been clarified at all. In this study, we investigated the reaction dynamics of the phot2LOV1 domain (phot2LOV1) (without the hinge region) and with the hinge region (phot2LOV1-H), where the hinge is located between the LOV1 and LOV2 domains.

2. EXPERIMENTAL SECTION 2.1. Sample preparation. Phot2LOV1 (residues R116−R242) and phot2LOV1-H (residues R116R−N276) from Arabidopsis thaliana phot2 cDNA were prepared using the


Page 6 of 55

Page 7 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


polymerase chain reaction (PCR) with the specific primer sets (P2_346fw/EcoRI : AAGAATTCGCCTTCCCTAGAGTATCCCAG,

P2_726rv*/SalI

:

AAGTCGACTCACCCTTCTGTGTATTTGCT,

P2_828rv*/SalI

:

AAGTCGACTCACACAACCTCTGTGATGGA). The PCR fragments were cut with the restriction enzymes, EcoRI and SalI and ligated between EcoRI and SalI sites of the plasmid (GE healthcare). The resulting plasmids were used to prepare recombinant proteins. The recombinant proteins were overexpressed as fusion proteins with glutathione S-transferase (GST) using Escherichia coli strain BL21(DE3)pLysS (Novagen) and the appropriate expression vector. The E. coli strains were grown at 37 °C in Luria-Bertani (LB) medium supplemented with ampicillin at 50 mg/L until the culture reached an OD600 of and

protein

overexpression

was

induced

by

the

addition

of

isopropyl

β-D-1-thiogalactopyranoside to a final concentration of 0.5 mM. The cells were incubated for further 12 h at 25 °C. The harvested cells were suspended in phosphate-buffered saline (PBS) containing 1% Triton X-100 and protease inhibitor cocktail (Nacalai tesque), and disrupted by sonication. After centrifugation at 20,000 g, 4 °C for 20 min, the supernatant (40 ml) was with 800 µl of slurry of Glutathione Sepharose 4B (GE healthcare) and the solution was incubated on a rotary shaker for 2 h at 6 °C. The Glutathione Sepharose 4B beads absorbing



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

recombinant proteins were washed several times with PBS containing 1% Triton X-100 and finally with the PreScission cleavage buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 1% Triton X-100) at 25 °C. The recombinant proteins were eluted after PreScission protease treatment on the column for 16 h at 6 °C. The recombinant proteins were further purified by gel filtration with a Superdex 200 10/300 HR column and a buffer solution containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA using an ÄKTA Explorer (GE healthcare). The eluted proteins in the main peak showed single bands on SDS-PAGE stained with Coomassie Brilliant Blue) and were used for experiments. 2.2. Measurements. The experimental setup for the TG measurements was similar to that reported previously.28,38 A laser pulse from a XeCl excimer laser (Lambda Physik, Compex102) -pumped dye laser (Lumomics, HyperDye 300; 465 nm) was used as an light source and a CW diode laser (Crysta Laser, 835 nm) as a probe light source. Generally, signals were averaged by a digital oscilloscope (Tektronix, TDS-7104) to improve the signal-to-noise ratio. The repetition rate of the excitation was usually 0.02 Hz. The laser for the excitation was set to be weak enough (< 10 µJ pulse–1) to not excite the photoexcited protein twice by the laser pulse. The q2 values at each experimental setup were determined the decay rate of the thermal grating signal of the calorimetric reference (aqueous solution of


Page 8 of 55

Page 9 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


bromocresol purple). All measurements were carried out at room temperature. Size-exclusion chromatography (SEC) measurements were performed using an ÄKTA purifier system with a Superdex 200 5/150 GL column (GE healthcare). The following size markers were used: 290 kDa, glutamate dehydrogenase (yeast); 142 kDa, lactate dehydrogenase (pig heart); 67 kDa, enolase (yeast); 32 kDa, myokinase (yeast). The apparent molecular weight of the sample was determined from the calibration curve.

3. PRINCIPLE AND ANALYSIS The principle of the TG method has been described previously.28, 29, 38-40 Briefly, there are two dominant contributions to the TG signal: the thermal grating due to the thermal energy from photoexcited molecules, and the species grating component due to the depletion of the reactant and the product molecules including any transient species. The TG signal intensity as a function of time is given by

ITG (t) = α{δnth (t) + δnP (t) − δnR (t)}2 ,

(1)

where α is a constant and δnth is the thermal grating component, which decays with a rate constant of Dthq2 (Dth: thermal diffusivity, q: grating wavenumber). The other terms, δnP(t) and δnR(t), are the refractive index changes due to the product and the reactant, respectively.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 55

The amplitudes of the species grating become weaker as the spatial modulations of the refractive indices become uniform, which are accomplished by the molecular translational diffusion. If the reaction completes in a fast time range (faster than the observation time window) and the molecular diffusion coefficient (D) is time-independent, the time profile of the species grating signal is expressed as

I TG (t) = α{δnP exp(−DP q2t) − δnR exp(−DR q2t)}2 ,

(2)

where DR and DP are the diffusion coefficients of the reactant and the product, respectively. Furthermore, δnR (> 0) and δnP (> 0) are, respectively, the initial refractive index changes due to the presence of the reactant and the product. If D of the reactant and the product are the same (DR = DP), the above equation is reduced to a single exponential function:

I TG (t) = α{(δnP − δnR ) exp(−DR q2t)}2 .

(3)

If the reaction occurs and D changes within the observation time window, the time-profile should be analyzed by taking into account this change. As an example, for a reaction of hν k R → I → P

R, I, P and k represent the reactant, an initial product (intermediate), the final product and the rate constant of the change, respectively, the time dependencies of δnP(t) and δnR(t) are given


Page 11 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


by

δnR (t) = δnR exp(−DRq2t) δnP (t ) = δnI exp{ − ( DI q 2 + k )t} + δnP

k [exp{ − ( DI q 2 + k )t} − exp( − DP q 2 t )] 2 ( DP − D I ) q − k

(4)

where δnI and DI are the refractive index change due to the creation of the I species and the diffusion coefficient of the intermediate, respectively.

4. RESULTS 4.1. phot2LOV1 domain 4.1.1. TG signal. A typical TG signal after photoexcitation of phot2LOV1 in the buffer at a concentration of 270 µM and at a grating wavenumber q2 = 5.3 × 1010 m−2 is shown in Fig. 1(a).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. (a) A typical TG signal (red broken line) of phot2LOV1 at 270 µM and q2 = 5.3 × 1010 m−2. The best fitted curve to the observed TG signal by eq. (1) and (4) is shown by the blue solid line. (b) The q2-dependence of the TG signals (broken lines) of phot2LOV1 at q2 of 7.1 × 1011 (blue), 4.1 × 1011 (cyan), 2.1 × 1011 (green), 1.3 × 1011 (yellow), 2.7 × 1010 (brown) and 2.4 × 1010 m−2 (red). The best fitted curves to the observed TG signal are shown by the solid lines.

The TG signal rose within our instrumental response (~20 ns) and exhibited 12 ACS Paragon Plus Environment

Page 12 of 55

Page 13 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


rise-decay features twice in the time range of 1 µs−1 s. The profile looks similar to those observed for phot1LOV1 and LOV2 samples.19,36,39 The initial decay-rise component and the subsequent decay component (298 K (or 303 K for phot2LOV1-H) should represent the diffusion signal of the monomer. Using this signal, the fraction of the monomer reaction (f1) can be determined from the observed signals at various temperatures by fitting with eq. 5. From the determined f1 and f2, we calculated the equilibrium constant K between the monomer and the dimer for each temperature measurement (K = [D]/[M]2). Figure 7(a) and



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(b) show the plots of ln K against the temperature for phot2LOV1 and phot2LOV1-H, respectively.

Figure 7. Temperature dependence of the monomer–dimer equilibrium constant (K) of (a) phot2LOV1 and (b) phot2LOV1-H are shown by the squares. The best fitted line by the linear function is shown by the solid line.

From the slope of the plot and the intercept with the ordinate, the differences of the enthalpy (∆H) and the entropy (∆S) between the monomer and dimer were determined to be 34 ACS Paragon Plus Environment

Page 34 of 55

Page 35 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


152 ± 13 kJ (mol of dimer)−1 and 462 ± 36 J (mol of dimer K)−1 for phot2LOV1 and 137 ± 10 kJ (mol of dimer)−1 and 398 ± 30 J (mol of dimer K)−1 for phot2LOV1-H, respectively. These results indicate that the dimeric form is energetically more stable than the monomeric form for both phot2LOV1 and phot2LOV1-H. When the temperature is increased, the dimer tends to dissociate into the monomer because of the increase of the entropic contribution to the Gibbs energy. When the hinge region is included, the dimeric form is marginally destabilized enthalpically, indicating that there are steric hindrances that weaken the interaction due to the presence of the hinge region. With increasing temperature, the entropic contribution increases more steeply for phot2LOV1 than for phot2LOV1-H and the population of the monomeric form becomes more dominant for phot2LOV1 at room temperature. To show the mechanism of the dimerization, we examined the salt effect on the equilibria between monomer and dimer (Fig. 8(a) for phot2LOV1, and 8(b) for phot2LOV1-H).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 8. (a) and (b) are salt concentration dependences of the TG signals of phot2LOV1 and phot2LOV1-H, respectively. Red and blue dotted lines are observed TG signals under low (140 mM) and high (1 M) salt concentrations, respectively. Best fitted curves by the bi-exponential function are shown as solid lines.

When the salt concentration was increased from 140 mM to 1 M, the intensity of the diffusion signal decreased, indicating that the fraction of monomer in the dark state decreased at the high salt concentration. The obtained signals can be fitted by eq. 5 and the fraction of 36 ACS Paragon Plus Environment

Page 36 of 55

Page 37 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the monomer was found to drop by 61% for phot2LOV1 and 48% for phot2LOV1-H upon the increase in salt concentration. This salt dependence indicates that the dimeric form is stabilized by hydrophobic interactions between two monomers. Light induced dimerization may be caused by the additional exposure of hydrophobic residues associated with the conformational change of the LOV1 domain.

5. DISCUSSION In this study, we investigated the reaction dynamics of phot2LOV1 and phot2LOV1-H primarily using the TG method. The reaction scheme of phot2LOV1 proposed by this study is illustrated in Fig. 9.

Figure 9. Schematic illustration of the photoreaction of phot2LOV1.

The effect of the hinge region to the reaction scheme is negligible. The rate of dimer formation was also independent of the presence of the hinge region; 17 ms for phot2LOV1 37 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

and 20 ms for phot2LOV1-H at 50 µM. However, a comparison of the TG signals, e.g., Fig. 1(a) with Fig. 5(a) shows that the diffusion signal intensity relative to the species grating signal intensity before the diffusion signal (t = ~1 ms) is larger for phot2LOV1-H than for phot2LOV1. The diffusion signal intensity represents the magnitude of the diffusion coefficient change and the amount of contribution of the monomer-dimer association reaction. Even under a relatively high temperature and a low protein concentration, where the monomer population is dominant for both phot2LOV1 and phot2LOV1-H (Fig. SI-4 and SI-5), the TG signal of phot2LOV1-H still showed a stronger diffusion peak when compared with the data of phot2LOV1. These results indicate that the hinge region undergoes a conformational change and contributes to the D-change. Very recently, a molecular dynamics simulation has shown that the LOV1-Jα (Jα is the helical structure located in the hinge region) interacts with LOV2 and this interaction changed in the light state for phototropin from Chlamydomonas reinhardtii (Cr-phot).47 During the interaction change, the Jα helix of the LOV1 domain was postulated to unfold, as observed for LOV2-Jα.47 We found in this study that the conformational change of the hinge region was induced upon photoexcitation; although, this change was not detected by conventional CD measurements. The conformational change in this study may be relevant to the interaction change between the LOV1 and LOV2 found by


Page 38 of 55

Page 39 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the simulation study. The physiological importance of the photoreaction of phot2LOV1 is based on the fact that LOV1 partially mediates hypocotyl phototropic responses of Arabidopsis thaliana; although, the LOV2 domain is necessary for the full activity of phot2.37 This may imply that the LOV1 domain directly interacts with the kinase domain or the LOV1 domain regulates the kinase activity indirectly via perturbing the LOV2-kinase interaction in a light dependent manner. The former possibility seems not to be plausible, because the pull-down assay of the GST-kinase domain with the isolated LOV1 domain did not show specific interaction between LOV1 and kinase both under dark and light conditions.16 Hence, the regulation of the phototropic response via LOV1 is likely to be achieved through an indirect interaction with the kinase domain. The observed conformational change of the hinge region may influence the interaction between the LOV2 and kinase domains, which leads to the activation of the kinase. Recently, it has been reported that the construct contains only N-terminal region of Cr-phot (LOV1+LOV2) regulates eyespot size and phototaxis of Chlamydomonas reinhardtii in light dependent manner, suggesting that the light sensing domains fulfill an independent signaling function in the cell aside from activation of the kinase domain.48 This might be achieved by interaction with other proteins and it has been shown that inactivation of LOV1



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

domain (C57S) partially lost the regulation.48 If the signaling of the LOV domains in Arabidopsis thaliana also have multiple pathways via interacting with other proteins in the cell, the light induced dimerization of the LOV1 domain and the structural change of the hinge region observed in this study are possibly included in the signaling processes as well as in the attenuation of phot activity. Previously, it was proposed that the role of the LOV1 domain may be the dimerization site for the full-length phototropin. In our study, however, it was found that phot2LOV1 exists as the monomer at low concentrations and high temperature conditions, whereas the phot1LOV1 exist as a stable dimer over a wide range of concentrations. Crystallographic analysis has shown that the dimeric form of phot1LOV1 was stabilized tightly by the disulfide bridge between Cys261 residues in addition to other interactions, such as hydrophobic interactions, hydrogen bonds and the hydration effect.32 Contrary to the tight binding of phot1LOV1, in the phot2LOV1 dimer, the hydrophobic interactions and hydrogen bonds at the subunit interface are the main networks that maintain dimer association,32 which are rather weak interactions, and subsequently, it is plausible that the dimer may dissociate into the monomer under various conditions. Our findings that the population of the monomeric form decreased with increasing salt concentration indicate that hydrophobic


Page 40 of 55

Page 41 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


interactions are the dominant force facilitating dimer formation. Previously, for examining the oligomeric state, crosslinking experiments were performed and it was reported that both phot1LOV1 and phot2LOV1 exhibited the dimeric state in both dark and light states.33 On the basis of this result, it was proposed that the LOV1 domain facilitates dimerization. This result seems to be inconsistent with our observations (monomer-dimer equilibrium in the dark and dimerization by light illumination). However, this discrepancy may be explained by considering the dynamic equilibrium between the dimer and the monomer as follows. When monomers form dimers at a certain time point, the dimer crosslinked and such crosslinked dimers cannot dissociate. This linking process should continue during the incubation time so that the dimer fraction tends to be dominant. Because the crosslinked dimer becomes dominant in the dark, the light induced dimerization event should not be observed. On the other hand, for the phototropin LOV1 domain from Chlamydomonas reinhardtii (Cr-photLOV1), the crosslinking experiment clearly showed two bands corresponding to the monomer and dimer, and the dimer population is found to increase significantly upon light illumination, which relaxes back to the initial ratio during incubation in the dark.49 Combined with the SEC measurement, it was concluded in this previous study



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

that there is an equilibrium between the dimer and a higher oligomer of Cr-photLOV1.49 This observation is consistent with our finding. The difference between these two crosslinking experiments may be explained by the different experimental conditions; i.e., in the latter case, the crosslinking experiments were performed using a very low sample concentration (3.3 nM) for a short incubation time (2 min) compared with the former work on phot2LOV1 (protein concentration: 1.57–25 µM, incubation time: 1h).33, 49 Under the latter experimental condition, the accumulation of the crosslinked dimer was not completed and the effect of light illumination can be detected as an increase of the fraction of higher oligomeric species. On the basis of these results and considerations, it should be noted that our TG measurement does not suffer from such ambiguity. What is the biological meaning of the light induced dimerization of LOV1? Matsuoka et al. suggested that the LOV1 acts as an attenuator of the photoactivation of the kinase domain, possibly by a stereochemical blocking of the interactions between the LOV2 domain and the kinase domain.16 The kinase activity has been suggested to be suppressed by the docking of the LOV2 domain onto the kinase domain, and light illumination of LOV2 leads to dissociation of this complex and therefore activation of the kinase. We consider that the formation of the LOV1 dimer may create a sterically hindered condition for the LOV2-kinase


Page 42 of 55

Page 43 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


dissociation, because the surrounding environment of the LOV2-kinase domains would be crowded by the dimerization. If so, light illumination of LOV1 may enhance the attenuating effect, because the number of dimers increases. However, the attenuating effect by LOV1 was observed similarly even when the photoreaction of the LOV1 domain was blocked by replacing the Cys that forms the covalent bond with the chromophore to Ala, indicating that the photoreaction of LOV1 may not be involved in the activity of the protein.16 The fact that only the monomer undergoes dimerization and the dimer does not show further association indicates that the dimerization site is the same for the dark-adapted dimer and light adapted dimer. Hence, it may be plausible that both dimers act as an attenuator in a similar fashion. In our study, we found that there is an equilibrium between monomer and dimer, which strongly depends on protein concentration, salt concentration and temperature. If the dimer form is already dominant in the dark, the light effect on the attenuation should be negligible, which can be a possible explanation for the previous report that the blocking of the reaction of LOV1 did not affect its function dramatically. Okajima et al. have suggested that adjusting the sensitivity may be regulated by a mechanism that the recovery rate of the LOV2 domain is modified by the existence of LOV1.18 In this study, phosphorylation activity of phototropin was clearly correlated with the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

lifetime of the active state of LOV2.35 When the LOV1 is truncated from the full-length construct of Cr-phot, the dark recovery rate of the LOV2 domain is accelerated, and subsequently, photosensitivity is attenuated.18 This effect was retained even when the reaction of the LOV1 domain is blocked. Therefore, it was suggested that the alteration of light sensitivity is possibly achieved by the modification of the duration of the signaling state in the neighbor LOV2 by structural interactions with LOV1.18 There is a possibility that the homo-dimerization of the LOV1 domain observed here corresponds to the interaction with the LOV2 domain in the intact protein.

6. CONCLUSION Temporal profiles of the TG signals of both samples were sensitive to the grating wavenumber (q2) as well as the concentration of the sample. The dependence on q2 was interpreted in terms of the temporal variation of the D-value of the photoproduct. Analyses of the concentration dependence of the TG signals showed that the time-dependent D-change of the photoproduct is interpreted as the dimerization process of the monomeric protein. In contrast to the LOV2-linker, only a minor secondary structure change was observed; however, this difference contributed to the D-change. Furthermore, it was found that both samples form


Page 44 of 55

Page 45 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


a dimer gradually with increasing concentrations in the dark state, and this dimer does not associate and/or dissociate upon light illumination. The equilibria between monomer and dimer were confirmed by gel chromatography. Additionally, the equilibrium constant was sensitive to the temperature of the sample solution. The dimer was stabilized as the temperature decreased. On the basis of these findings, we discuss the molecular mechanisms of the function of LOV1.

ASSOCIATED CONTENT Supporting information: TG signals of phot2LOV1 measured at various grating wavenumber, Recovery of CD intensity monitored at 222 nm, TG signals of

phot2LOV1-H measured at various grating wavenumber, Temperature

dependence of the TG signal of Phot2LOV1, Temperature dependence of the

TG signal of phot2LOV1-H. These materials are available free of charge via the Internet

at http://pubs.acs.org.

ACKNOWLEDGMENTS



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

This work was supported by a Grant-in-aid for Scientific Research on Innovative Areas (research in a proposed research area) (20107003) from the Ministry of Education, Culture, Sports, Science and Technology in Japan (to M.T.) and a Grant-in-aid for Scientific Research 25251033 (to M.W. and 25440140 to S.-G.K).


Page 46 of 55

Page 47 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES (1) Christie, J. M. Phototropin Blue-Light Receptors. Annu. Rev. Plant. Biol. 2007, 58, 21-45.

(2) Briggs, W. R.; Christie, J. M.; Salomon, M. Phototropins: A New Family of Flavin-Binding Blue

Light Receptors in Plants. Antioxid. Redox Signal. 2001, 3, 775-788.

(3) Briggs, W. R., et al The Phototropin Family of Photoreceptors. Plant Cell 2001, 13, 993-997.

(4) Briggs, W. R.; Christie, J. M. Phototropins 1 and 2: Versatile Plant Blue-Light Receptors. Trends

Plant Sci. 2002, 7, 204-210.

(5) Kagawa, T.; Sakai, T.; Suetsugu, N.; Oikawa, K.; Ishiguro, S.; Kato, T.; Tabata, S.; Okada, K.; Wada,

M. Arabidopsis NPL1: A Phototropin Homolog Controlling the Chloroplast High-Light

Avoidance Response. Science 2001, 291, 2138-2141.

(6) Kinoshita, T.; Doi, M.; Suetsugu, N.; Kagawa, T.; Wada, M.; Shimazaki, K. Phot1 and phot2

Mediate Blue Light Regulation of Stomatal Opening. Nature 2001, 414, 656-660.

(7) Sakai, T.; Kagawa, T.; Kasahara, M.; Swartz, T. E.; Christie, J. M.; Briggs, W. R.; Wada, M.; Okada,

K. Arabidopsis nph1 and npl1: Blue Light Receptors that Mediate both Phototropism and

Chloroplast Relocation. Proc. Natl. Acad. Sci. U. S. A. 2001, 98, 6969-6974.

(8) Christie, J. M.; Salomon, M.; Nozue, K.; Wada, M.; Briggs, W. R. LOV (Light, Oxygen, Or Voltage)

Domains of the Blue-Light Photoreceptor Phototropin (nph1): Binding Sites for the Chromophore



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Flavin Mononucleotide. Proc. Natl. Acad. Sci. U. S. A. 1999, 96, 8779-8783.

(9) Salomon, M.; Christie, J. M.; Knieb, E.; Lempert, U.; Briggs, W. R. Photochemical and Mutational

Analysis of the FMN-Binding Domains of the Plant Blue Light Receptor, Phototropin.

Biochemistry 2000, 39, 9401-9410.

(10) Salomon, M.; Eisenreich, W.; Durr, H.; Schleicher, E.; Knieb, E.; Massey, V.; Rudiger, W.; Muller,

F.; Bacher, A.; Richter, G. An Optomechanical Transducer in the Blue Light Receptor Phototropin

from Avena Sativa. Proc. Natl. Acad. Sci. U. S. A. 2001, 98, 12357-12361.

(11) Swartz, T. E.; Corchnoy, S. B.; Christie, J. M.; Lewis, J. W.; Szundi, I.; Briggs, W. R.; Bogomolni,

R. A. The Photocycle of a Flavin-Binding Domain of the Blue Light Photoreceptor Phototropin. J.

Biol. Chem. 2001, 276, 36493-36500.

(12) Kottke, T.; Heberle, J.; Hehn, D.; Dick, B.; Hegemann, P. Phot-LOV1: Photocycle of a Blue-Light

Receptor Domain from the Green Alga Chlamydomonas Reinhardtii. Biophys. J. 2003, 84,

1192-1201.

(13) Kennis, J. T.; Crosson, S.; Gauden, M.; van Stokkum, I. H.; Moffat, K.; van Grondelle, R. Primary

Reactions of the LOV2 Domain of Phototropin, a Plant Blue-Light Photoreceptor. Biochemistry

2003, 42, 3385-3392.

(14) Schleicher, E.; Kowalczyk, R. M.; Kay, C. W.; Hegemann, P.; Bacher, A.; Fischer, M.; Bittl, R.;


Page 48 of 55

Page 49 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Richter, G.; Weber, S. On the Reaction Mechanism of Adduct Formation in LOV Domains of the

Plant Blue-Light Receptor Phototropin. J. Am. Chem. Soc. 2004, 126, 11067-11076.

(15) Christie, J. M.; Swartz, T. E.; Bogomolni, R. A.; Briggs, W. R. Phototropin LOV Domains Exhibit

Distinct Roles in Regulating Photoreceptor Function. Plant J. 2002, 32, 205-219.

(16) Matsuoka, D.; Tokutomi, S. Blue Light-Regulated Molecular Switch of Ser/Thr Kinase in

Phototropin. Proc. Natl. Acad. Sci. U. S. A. 2005, 102, 13337-13342.

(17) Cho, H. Y.; Tseng, T. S.; Kaiserli, E.; Sullivan, S.; Christie, J. M.; Briggs, W. R. Physiological

Roles of the Light, Oxygen, Or Voltage Domains of Phototropin 1 and Phototropin 2 in

Arabidopsis. Plant Physiol. 2007, 143, 517-529.

(18) Okajima, K.; Aihara, Y.; Takayama, Y.; Nakajima, M.; Kashojiya, S.; Hikima, T.; Oroguchi, T.;

Kobayashi, A.; Sekiguchi, Y.; Yamamoto, M. et al. Light-Induced Conformational Changes of

LOV1 (Light Oxygen Voltage-Sensing Domain 1) and LOV2 Relative to the Kinase Domain and

Regulation of Kinase Activity in Chlamydomonas Phototropin. J. Biol. Chem. 2014, 289, 413-422.

(19) Eitoku, T.; Nakasone, Y.; Matsuoka, D.; Tokutomi, S.; Terazima, M. Conformational Dynamics of

Phototropin 2 LOV2 Domain with the Linker upon Photoexcitation. J. Am. Chem. Soc. 2005, 127,

13238-13244.

(20) Eitoku, T.; Nakasone, Y.; Zikihara, K.; Matsuoka, D.; Tokutomi, S.; Terazima, M. Photochemical



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Intermediates of Arabidopsis Phototropin 2 LOV Domains Associated with Conformational

Changes. J. Mol. Biol. 2007, 371, 1290-1303.

(21) Nakasone, Y.; Eitoku, T.; Matsuoka, D.; Tokutomi, S.; Terazima, M. Dynamics of Conformational

Changes of Arabidopsis Phototropin 1 LOV2 with the Linker Domain. J. Mol. Biol. 2007, 367,

432-442.

(22) Halavaty, A. S.; Moffat, K. N- and C-Terminal Flanking Regions Modulate Light-Induced Signal

Transduction in the LOV2 Domain of the Blue Light Sensor Phototropin 1 from Avena Sativa.

Biochemistry 2007, 46, 14001-14009.

(23) Aihara, Y.; Yamamoto, T.; Okajima, K.; Yamamoto, K.; Suzuki, T.; Tokutomi, S.; Tanaka, K.;

Nagatani, A. Mutations in N-Terminal Flanking Region of Blue Light-Sensing Light-Oxygen and

Voltage 2 (LOV2) Domain Disrupt its Repressive Activity on Kinase Domain in the

Chlamydomonas Phototropin. J. Biol. Chem. 2012, 287, 9901-9909.

(24) Zayner, J. P.; Antoniou, C.; Sosnick, T. R. The Amino-Terminal Helix Modulates Light-Activated

Conformational Changes in AsLOV2. J. Mol. Biol. 2012, 419, 61-74.

(25) Sharma, S.; Kharshiing, E.; Srinivas, A.; Zikihara, K.; Tokutomi, S.; Nagatani, A.; Fukayama, H.;

Bodanapu, R.; Behera, R. K.; Sreelakshmi, Y. et al. Dominant Mutation in the Light-Oxygen and

voltage2 Domain Vicinity Impairs phototropin1 Signaling in Tomato. Plant Physiol. 2014, 164,


Page 50 of 55

Page 51 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2030-2044.

(26) Takeda, K.; Nakasone, Y.; Zikihara, K.; Tokutomi, S.; Terazima, M. Dynamics of the

Amino-Terminal and Carboxyl-Terminal Helices of Arabidopsis Phototropin 1 LOV2 Studied by

the Transient Grating. J Phys Chem B 2013, 117, 15606-15613.

(27) Fedorov, R.; Schlichting, I.; Hartmann, E.; Domratcheva, T.; Fuhrmann, M.; Hegemann, P. Crystal

Structures and Molecular Mechanism of a Light-Induced Signaling Switch: The Phot-LOV1

Domain from Chlamydomonas Reinhardtii. Biophys. J. 2003, 84, 2474-2482.

(28) Nakasone, Y.; Eitoku, T.; Matsuoka, D.; Tokutomi, S.; Terazima, M. Kinetic Measurement of

Transient Dimerization and Dissociation Reactions of Arabidopsis Phototropin 1 LOV2 Domain.

Biophys. J. 2006, 91, 645-653.

(29) Nakasone, Y.; Eitoku, T.; Zikihara, K.; Matsuoka, D.; Tokutomi, S.; Terazima, M. Stability of

Dimer and Domain-Domain Interaction of Arabidopsis Phototropin 1 LOV2. J. Mol. Biol. 2008,

383, 904-913.

(30) Nakasako, M.; Iwata, T.; Matsuoka, D.; Tokutomi, S. Light-Induced Structural Changes of LOV

Domain-Containing Polypeptides from Arabidopsis Phototropin 1 and 2 Studied by Small-Angle

X-Ray Scattering. Biochemistry 2004, 43, 14881-14890.

(31) Salomon, M.; Lempert, U.; Rudiger, W. Dimerization of the Plant Photoreceptor Phototropin is



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Probably Mediated by the LOV1 Domain. FEBS Lett. 2004, 572, 8-10.

(32) Nakasako, M.; Zikihara, K.; Matsuoka, D.; Katsura, H.; Tokutomi, S. Structural Basis of the LOV1

Dimerization of Arabidopsis Phototropins 1 and 2. J. Mol. Biol. 2008, 381, 718-733.

(33) Katsura, H.; Zikihara, K.; Okajima, K.; Yoshihara, S.; Tokutomi, S. Oligomeric Structure of LOV

Domains in Arabidopsis Phototropin. FEBS Lett. 2009, 583, 526-530.

(34) Kasahara, M.; Swartz, T. E.; Olney, M. A.; Onodera, A.; Mochizuki, N.; Fukuzawa, H.; Asamizu,

E.; Tabata, S.; Kanegae, H.; Takano, M. et al. Photochemical Properties of the Flavin

Mononucleotide-Binding Domains of the Phototropins from Arabidopsis, Rice, and

Chlamydomonas Reinhardtii. Plant Physiol. 2002, 129, 762-773.

(35) Okajima, K.; Kashojiya, S.; Tokutomi, S. Photosensitivity of Kinase Activation by Blue Light

Involves the Lifetime of a Cysteinyl-Flavin Adduct Intermediate, S390, in the Photoreaction Cycle

of the LOV2 Domain in Phototropin, a Plant Blue Light Receptor. J. Biol. Chem. 2012, 287,

40972-40981.

(36) Nakasone, Y.; Zikihara, K.; Tokutomi, S.; Terazima, M. Photochemistry of Arabidopsis

Phototropin 1 LOV1: Transient Tetramerization. Photochem. Photobiol. Sci. 2013, 12, 1171-1179.

(37) Suetsugu, N.; Kong, S. G.; Kasahara, M.; Wada, M. Both LOV1 and LOV2 Domains of

phototropin2 Function as the Photosensory Domain for Hypocotyl Phototropic Responses in


Page 52 of 55

Page 53 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Arabidopsis Thaliana (Brassicaceae). Am. J. Bot. 2013, 100, 60-69.

(38) Terazima, M. Studies of Photo-Induced Protein Reactions by Spectrally Silent Reaction Dynamics

Detection Methods: Applications to the Photoreaction of the LOV2 Domain of Phototropin from

Arabidopsis Thaliana. Biochim. Biophys. Acta 2011, 1814, 1093-1105.

(39) Terazima, M. Diffusion Coefficients as a Monitor of Reaction Kinetics of Biological Molecules.

Phys. Chem. Chem. Phys. 2006, 8, 545-557.

(40) Terazima, M. Time-Dependent Intermolecular Interaction during Protein Reactions. Phys. Chem.

Chem. Phys. 2011, 13, 16928-16940.

(41) Arita, T.; Kajimoto, O.; Terazima, M.; Kimura, Y. Experimental Verification of the Smoluchowski

Theory for a Bimolecular Diffusion-Controlled Reaction in Liquid Phase. J. Chem. Phys. 2004,

120, 7071-7074.

(42) Cole, C.; Barber, J. D.; Barton, G. J. The Jpred 3 Secondary Structure Prediction Server. Nucleic

Acids Res. 2008, 36, W197-201.

(43) Corchnoy, S. B.; Swartz, T. E.; Lewis, J. W.; Szundi, I.; Briggs, W. R.; Bogomolni, R. A.

Intramolecular Proton Transfers and Structural Changes during the Photocycle of the LOV2

Domain of Phototropin 1. J. Biol. Chem. 2003, 278, 724-731.

(44) Chen, E.; Swartz, T. E.; Bogomolni, R. A.; Kliger, D. S. A LOV Story: The Signaling State of the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

phot1 LOV2 Photocycle Involves Chromophore-Triggered Protein Structure Relaxation, as Probed

by Far-UV Time-Resolved Optical Rotatory Dispersion Spectroscopy. Biochemistry 2007, 46,

4619-4624.

(45) Yamamoto, A.; Iwata, T.; Sato, Y.; Matsuoka, D.; Tokutomi, S.; Kandori, H. Light Signal

Transduction Pathway from Flavin Chromophore to the J Alpha Helix of Arabidopsis phototropin1.

Biophys. J. 2009, 96, 2771-2778.

(46) Alexandre, M. T.; van Grondelle, R.; Hellingwerf, K. J.; Kennis, J. T. Conformational

Heterogeneity and Propagation of Structural Changes in the LOV2/Jalpha Domain from Avena

Sativa Phototropin 1 as Recorded by Temperature-Dependent FTIR Spectroscopy. Biophys. J.

2009, 97, 238-247.

(47) Peter, E.; Dick, B.; Stambolic, I.; Baeurle, S. A. Exploring the Multiscale Signaling Behavior of

phototropin1 from Chlamydomonas Reinhardtii using a Full-Residue Space Kinetic Monte Carlo

Molecular Dynamics Technique. Proteins 2014, 82, 2018-2040.

(48) Trippens, J.; Greiner, A.; Schellwat, J.; Neukam, M.; Rottman, T.; Lu, Y.; Kateriya, S.; Hegemann,

P.; Kreimer, G. Phototropin Influence on Eyespot Development and Regulation of Phototactic

Behavior in Chlamydomonas reinhardtii. The Plant Cell 2012, 24, 4687-4702.

(49) Kutta, R. J.; Hofinger, E. S.; Preuss, H.; Bernhardt, G.; Dick, B. Blue-Light Induced Interaction of


Page 54 of 55

Page 55 of 55

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


LOV Domains from Chlamydomonas Reinhardtii. Chembiochem 2008, 9, 1931-1938.

Table of Contents


Photoinduced Oligomerization of Arabidopsis thaliana Phototropin 2

Recommend Documents