Polymeric Nanostructure Compiled with ... - ACS Publications

Subscriber access provided by Northern Illinois University

Article

Polymeric Nanostructure Compiled with Multifunctional Components to Exert Tumor-targeted Delivery of Antiangiogenic Gene for Tumor Growth Suppression Qixian Chen, Ruogu Qi, Xiyi Chen, Xi Yang, Xing Huang, Haihua Xiao, Xinhuan Wang, and Wenfei Dong ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b06782 • Publication Date (Web): 30 Aug 2016 Downloaded from http://pubs.acs.org on September 2, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Polymeric Nanostructure Compiled with Multifunctional Components to Exert Tumortargeted Delivery of Anti-angiogenic Gene for Tumor Growth Suppression Qixian Chen,a,b,†,* Ruogu Qi,c,† Xiyi Chen,d Xi Yang,e Xing Huang,f Haihua Xiao,c Xinhuan Wang,f Wenfei Dong,a,* aCAS

Key Laboratory of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering,

Suzhou 215163, China,

bDeparment

Cambridge, MA 02139, USA,

cState

of Chemistry, Massachusetts Institute of Technology Key Laboratory of Polymer Physics and Chemistry

Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022, China, dSchool

of Public Health, Dalian Medical University, No. 9 West Section Lvshun South Road, Dalian

116044, China, eDepartment of Neurosurgery, Renji Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200127, China, fDepartment of Urology, Zhongnan Hospital, Wuhan University, Wuhan 430071 China KEYWORDS: polyplex micelle; thermoresponsive; multi-layer; tumor vasculature targeting; tumor gene therapy

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 37

ABSTRACT: Nucleic acid-based therapy has emerged as a revolutionary methodology for treatment of the diseases related to protein dysfunction; however, lack of systemically-applicable synthetic delivery systems limits its current usage in local applications, particularly for DNA-based therapy with regarding to the poor bioavailability in the systemic administrations. To settle this obstacle, we compiled multiple chemistry-based strategies into manufacture of the gene delivery formulations to pursue improved tolerability of DNA to the enzymatic degradation in the biological milieu and prolonged retention in the systemic circulation. Here, we constructed a distinctive multilayered functional architecture: plasmid DNA (pDNA) was electrostatically complexed with cationic poly(lysine) (polyplex) as the interior pDNA reservoir, which was further crosslinked by redoxresponsive disulfide crosslinking to minimize the occurrence of polyplex disassembly through exchange change reaction with the biological charged components. Still, the pDNA reservoir was spatially protected by a sequential thermoresponsive poly(N-isopropylacrylamide) palisade as the intermediate barrier and a biocompatible hydrophilic poly(ethylene glycol) (PEG) shell with the aim of preventing the accessibility of the biological species, particular the nuclease degradation to the pDNA payload. Subsequent investigations validated the utilities of these strategies in accomplishing prolonged blood retention. In attempt for tumor therapy, ligand cyclic (Arg-Gly-Asp) peptide was attached at the distal end of PEG, validating prompted tumor-targeted delivery and gene expression of the loaded anti-angiogenic gene at the targeted tumor cells, accordingly exerting anti-angiogenesis of the tumors for abrogation of tumor growth. Together with its excellent safe profile, the proposed formulation suggests tempting utilities as practical-applicable gene delivery system for treatment of intractable diseases.


2

Page 3 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION The progressive advance in molecular biology and genomic science spurred identification of gene therapy as an intriguing therapeutic modality for disease treatment.1-4 Nevertheless, the primary obstacle restricting gene therapy from being a clinical available tool was due to lack of systemicallyapplicable delivery systems capable of addressing a range of extracellular and intracellular barriers. To realize the concept of gene therapy into broad systemic applications, the stabilities of gene delivery carriers in the blood circulation are of crucial importance to the ultimate therapeutic potency. Apparently, the prolonged systemic retention would benefit the bioavailability of the gene delivery carriers to the targeted site. In reality, to attain adequate longevity in the harsh biological environment, gene delivery carriers have to circumvent ensemble of predefined biological impairing, such as: enzymatic degradation, protein adsorption and opsonization, and reticuloendothelial (RES) clearance. Hence, gene delivery carriers with stealth surface characteristics are imperative for systemic circulation.5 To these requirements, a promising modality of polyplex micelle systems was developed based on self-assemble of block catiomers poly(ethylene glycol) (PEG)-polycation [e.g. poly(lysine): PLys]) and plasmid DNA (pDNA) through electrostatic interactions, the polycationic segment was capable of neutralizing the negative-charge of plasmid DNA (pDNA) and prompting the condensation of pDNA into a nanosized formation.6 On the other hand, the PEG segment in the diblock copolymer, acting as surface coating onto the condensed DNA complex core (PEGylation), is also important, enabling single pDNA packaged into nanosized core covered by the hydrophilic and biocompatible PEG shell.7 Benefited from this PEG shielding shell, non-specific interactions with biological components were diminished, accounting for improved biocompatibility in the biological condition.8 Nevertheless, systemic use of this system was still limited pertinent to its inadequate retention abilities in the blood circulation, which was further acknowledged to ascribe to insufficient colloidal stability of the merely electrostatically formulated systems, which was subjected to drastic premature dissociation in the kidney where


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 37

abundant anionic heparan sulfate is located at the glomerular basement membrane (GBM).9 Moreover, the inherent susceptibility of DNA to nuclease degradation was difficult to be fully resolved solely by PEGylation. As demonstrated previously, formation of PEG shell solely driven by electrostatic complexation is not feasible to achieve an adequate PEG crowdedness to exclude the accessibility of sub-10 nm biological compounds (e.g. DNase I: approximate 2 nm)10 despite the remarkable capacity of such degree of PEGylation in reducing accessibility of larger biological compounds (>10 nm), e.g. chondroitin sulfate or dextran sulfate.11 These drawbacks encourage further development of this PEGylated architecture for pursuit of improved retention in the blood circulation. Here, thiol groups were introduced into the cationic PLys segments with the aim of redox-responsive crosslinking the PLys/pDNA complex core to prevent premature structural disassembly from exchange reaction with charged biological structures or biological species. To manage the nucleases potentially translocating the PEG shell to execute pDNA degradation, intermediate hydrophobic palisade was proposed between external PEG shell and interior PLys/pDNA core as spatial barrier (Scheme 1). Ultimately, the constructed three-layered architecture was surface-installed with tumor-targeting cyclic RGD (Arg-Gly-Asp) peptide (cRGD) intended for promoting cRGD-integrin mediated tumor targeting and subsequent gene expression of the therapeutic genomic sequence at the targeted cells to pursue systemic treatment of intractable tumors.12

2. MATERIALS AND METHODS 2.1. Materials. α-methoxy-ω-amino-PEG (PEG) (Mw: 12 kDa) and α-acetal-ω-amino-PEG (acetal-PEG) (Mw: 12 kDa) were purchased from Laysan Bio Inc. (Arab, AL). Ethidium bromide solution, amine-functionalized poly(N-isopropyl acrylamide) (PNIPAM) (Mw: 5 kDa), PEI (branched, 25 kDa), heparan sulfate sodium salt from bovine kidney and DNase I were purchased from Sigma Aldrich China (Shanghai, China). Lipofectamine 2000 was


4

Page 5 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


purchased from Thermo Fisher Scientific Inc. (Cambridge, MA). N6-trifluoroacetyl-L-lysine N-carboxyanhydride [Lys(TFA)-NCA] was purchased from Carbosynth Limited (Berkshire, UK). Cyclo[RGDfK(C-ε-Acp)] (cRGD) peptide (ε-Acp: 6-aminocaproic acid) was purchased from Peptide Institute Inc. (Osaka, Japan). N-succinimidyl 3-(2-pyridyldithio)-propionate (SPDP) and slide-a-lyzer dialysis cassettes (MWCO = 10 kDa) were purchased from Thermo Scientific (Rockford, IL). pDNA were labeled with Cy5 using the Label IT® Tracker™ Intracellular Nucleic Acid Localization Kit obtained from Mirus Bio Corp. (Madison, WI) according to the manufacturer’s protocol. Dulbecco’s modified eagle’s medium (DMEM) and Dulbecco’s phosphate-buffered saline (DPBS) were purchased from Sigma-Aldrich Co. (Madison, WI). Fetal bovine serum (FBS) was purchased from Dainippon Sumitomo Parma Co., Ltd. (Osaka, Japan). Rat monoclonal antibody against mouse platelet endothelial cell adhesion molecule-1 (PECAM-1) was purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Alexa 647-conjugated (A21247) goat anti-rat was obtained from Invitrogen Molecular Probes (Eugene, OR). U87 cells [U-87 MG (ATCC® HTB-14™)] were obtained from the American Type Culture Collection (ATCC, Manassas, VA). Balb/c-nude mice (female, 5-weeks old) were purchased from Charles River Laboratories. All animal experimental procedures were performed in compliance with the Guidelines for Animal Experiment as stated by the Animal Committee of China Academy of Science. 2.2. Synthesis of PEG-PLys. Block copolymer PEG-PLys was synthesized according to a ring-opening polymerization approach as previously described.13 In brief, monomer of Lys(TFA)-NCA (161 mg, 600 μmol) was polymerized from the initiation of the ω-NH2 terminal group of MeO-PEG-NH2 (120 mg, 10 μmol) in anhydrous N,N-dimethylformamide (DMF) (10 mL). Following 24 h reaction at 25 °C under nitrogen atmosphere, the reaction


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 37

solution was transferred for precipitation in diethyl ether (500 mL) to obtain the product of PEG-PLys(TFA) (200 mg, yielding: 83%). The molecular weight distribution (Mw/Mn) of the yielded PEG-PLys(TFA) was determined to be 1.05 according to a gel permeation chromatography (GPC) equipped with TOSOH HLC-8220 calibrated based on varying Mw of commercial PEG standards. Furthermore, MeO-PEG-PLys(TFA) (200 mg, 8.3 μmol) was dissolved in methanol containing 1 N NaOH (5 mL) with the aim of remove protective TFA groups at 30 °C for overnight reaction. The reaction solution was transferred to dialysis with MWCO 12 kDa against 0.01 N HCl (three times) and ddH2O (three times). Ultimately, the product was obtained by lyophilization (167 mg, 8.0 μmol). The synthetic PLys segment was determined to be 55 based on the peak intensity ratio of the methylene protons of PEG [(CH2)2O, δ = 3.7 ppm] to the β, γ, and δ-methylene protons of lysine [(CH2)3, δ = 1.3–1.9 ppm] units from the captured 1H-NMR spectra. 2.3. Synthesis of acetal-PEG-PLys. Following a similar synthetic procedure, acetal-PEGPLys was synthesized.14 In brief, monomer of Lys(TFA)-NCA (161 mg, 600 μmol) was polymerized from the initiation of the ω-NH2 terminal group of acetal-PEG-NH2 (120 mg, 10 μmol) in anhydrous N,N-dimethylformamide (DMF) (10 mL). Following 24 h reaction at 25 °C under nitrogen atmosphere, the reaction solution was transferred for precipitation in diethyl ether (500 mL) to obtain the product of acetal-PEG-PLys(TFA) (203 mg, yielding: 84%). The molecular weight distribution (Mw/Mn) of the yielded acetal-PEG-PLys(TFA) was determined to be 1.06 according to a gel permeation chromatography (GPC) equipped with TOSOH HLC-8220 calibrated based on varying Mw of commercial PEG standards. Furthermore, acetal-PEG-PLys(TFA) (203 mg, 8.3 μmol) was dissolved in methanol containing 1 N NaOH (5 mL) with the aim of remove protective TFA groups at 30 °C for


6

Page 7 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


overnight reaction. The reaction solution was transferred to dialysis with MWCO 12 kDa against PBS buffer (pH: 7.3, three times) and ddH2O (three times). Ultimately, the product was obtained by lyophilization (160 mg, 7.6 μmol). The synthetic PLys segment was determined to be 53 based on the peak intensity ratio of the methylene protons of PEG [(CH2)2O, δ = 3.7 ppm] to the β, γ, and δ-methylene protons of lysine [(CH2)3, δ = 1.3–1.9 ppm] units from the captured 1H-NMR spectra. 2.4. Synthesis of Thiolated PEG-PLys [PEG-PLys(SH)]. Thiolated PEG-PLys(SH) were prepared by introducing the pyridyldithiopropionyl (PDP) groups into the side chain of lysine units of the PLys segment in PEG-PLys using the heterobifunctional reagent Nsuccinimidyl 3-(2-pyridyldithio) propionate (SPDP) (16.5 mg, 32 μmol) by following the procedure as previously described.15 In brief, PEG-PLys (100 mg, 4.8 μmol) was dissolved in N-methyl-2-pyrrolidone (NMP) (10 mL) supplemented with 5 wt% LiCl and reacted with predefined concentration of SPDP (16.5 mg, 32 μmol) in anhydrous NMP (1 mL) containing N,N-diisopropylethylamine (10 mol excess against SPDP) at room temperature. After 6 h reaction, the crude product was purified by precipitation into diethyl ether (300 mL). Furthermore, the precipitated product was dissolved in 0.01 N HCl (5 mL), dialyzed against the distilled water for 3 times, and lyophilized to obtain powder of PEG-PLys(PDP) product (86 mg,

3.9 μmol, and yielding: 81%). The introduction ratio of thiol groups was

determined from the 1H-NMR spectrum recorded in DCl containing D2O (pD = 2.4) at 25 °C by the peak intensity ratio of the β, γ, and δ-methylene protons of lysine [(CH2)3, δ = 1.3–1.9 ppm] to the pyridyl protons of the 3-(2-pyridyldithio) propionyl group (C5H4N, δ = 7.2–8.3 ppm). The degree of thiol group substitution was determined to be approximate 20%. PEGPLys(SH) was obtained by treating PEG-PLys(PDP) with dithiothreitol (DTT).


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 37

2.5. Synthesis of Thiolated acetal-PEG-PLys [acetal-PEG-PLys(SH)]. Block polymer acetal-PEG-PLys(PDP) was synthesized according to a similar synthetic procedure, which was further used for cRGD ligand conjugation. The introduction ratio of thiol groups was determined from the 1H-NMR spectrum recorded in DCl containing D2O (pD = 2.4) at 25 °C by the peak intensity ratio of the β, γ, and δ-methylene protons of lysine [(CH2)3, δ = 1.3–1.9 ppm] units to the pyridyl protons of the 3-(2-pyridyldithio) propionyl group (C5H4N, δ = 7.2–8.3 ppm). The degree of thiol group substitution was determined to be 18% by referring to the total units of PLys segment. The deprotective form of acetal-PEG-PLys(SH) could obtained under treatment of DTT for PEG-PLys(PDP). 2.6. Synthesis of cRGD-PEG-PLys(SH). The cyclo[RGDfK(C-ε-Acp)] (cRGD) peptide ligand was attached onto the α-terminal of acetal-PEG-PLys(SH) through formation of a thiazolidine ring between the N-terminal cysteine of the cRGD peptide and the aldehyde group from acetal-PEG-PLys following incubation at acidic pH (pH = 2).11 In brief, acetalPEG-PLys(SH) (40 mg, 1.9 μmol) was dissolved in 10 mM HEPES buffer (1.5 mL, pH 7.4), followed by pH adjustment by 0.01 N HCl to an ultimate pH 2.0 to yield aldehyde from the acetal group. Then, DTT-pretreated cRGD solution (15 mg, 16.2 μmol) was added to the aforementioned solution. The reaction was conducted at pH 4.5 by pH adjustment by 0.01 N NaOH. Following overnight stirring at 25 °C, the polymer solution was dialyzed against HEPES buffer (pH 7.4, three times), followed by ddH2O (three times). Eventually, the solution was collected and lyophilized to obtain cRGD-PEG-PLys(SH) (36 mg, 1.7 μmol, the yielding: 89%). The percentage of cRGD conjugation was determined by the integrated intensity ratio of benzyl protons (D-Phenyl alanine, f: D-Phe; δ = 7.3–7.4 ppm) of the cRGD


8

Page 9 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


peptide to the methylene protons of PEG (δ = 3.7 ppm) from the 1H-NMR spectra, and the conjugation ratio of cRGD was accordingly calculated to be 95%. 2.7. Synthesis of PNIAPM-PLys(SH). A similar approach to synthesize PEG-PLys(SH) was followed to prepare PNIPAM-PLys(SH). In brief, PNIAPM with the terminal functionalized NH2 group (55 mg, 10 μmol) acted as the macro-initiator for polymerization of the monomer NCALys(TFA) (161 mg, 600 μmol). The synthesized PNIPAM-PLys(TFA) was obtained by precipitation in diethyl ether (500 mL) and transferred to NaOH treatment (1 N) in methanol (5 mL) to remove protective TFA residues. Ultimately, PDP groups were introduced into the side chain of lysine units of the PLys segment in PEG-PLys using SPDP. The degree of thiol group substitution was determined to be approximate 20% by referring to the total units of PLys segment in the corresponding 1H-NMR spectra. 2.8. Preparation of Polyplex Micelles. The synthesized block copolymer powders were dissolved in 10 mM HEPES buffer (pH 7.4, 10 mM DTT) as the stock solutions. Aliquot of stock polymer solution was added to the pDNA solution (50 µg/mL) for complexation at an identical N/P of 1.5, followed by sequential dialysis in RNase-free PBS water (containing 0.1% DMSO) (three times) and RNase-free PBS (pH 7.3, three times) for disulfide crosslinking either at 25 °C or 37 °C. The final concentration of pDNA in all the samples was adjusted to 33.3 µg/mL unless noted. 2.9 Thermoresponsivity of PNIPAM in the Polyplex Micelles by 1H-NMR. The thermoresponsivity of PNIPAM within the polyplex micelles was investigated by 1H-NMR measurement. The peak area derived from the methyl protons on a side chain of PNIPAM (δ = 0.95−1.2 ppm) and that of PEG (δ = 3.5-3.9 ppm) was measured in D2O. The temperature was increased from 20 to 45 °C in a stepwise manner for 30 min incubation interval prior to each measurement. The thermoresponsive activity was expressed as the integrated ratio of the methyl protons from PEG to that of PNIPAM from 1H-NMR spectra as a function of incubation temperature.


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 37

2.10. Fluid AFM Characterization. AFM imaging of the polyplex micelle of PEG/PNIPAM-PLys(SH)/pBR322 pDNA was performed using a fluid AFM, Nanoscope IIIa (Veeco, USA) in tapping mode with standard silicon probes. Note that the polyplex micelle of PEG/PNIPAM-PLys(SH)/pBR322 pDNA was prepared at 25 °C. AFM measurement was conducted onto a thermal incubator preset at 25 °C or 37 °C. Imaging was conducted under aqueous conditions on a highly orientated pyrolytic graphite substrate. The obtained images were processed with flattening treatment to remove the background slope of the substrate surface. 2.11. In vitro Stability. Heparan sulfate and DNase I was dissolved in 10 mM HEPES (pH 7.4) buffer containing 25 mM MgSO4 as stock solution. Polyplex micelle containing CAG-LUC2 solution (18 μl) was fused with aliquot (2 μl) of stock solution at final heparan sulfate concentration of 40 mg/mL and DNase I concentration of 0.01 U/mL. The samples were allowed for reaction at 37 °C. The reaction was quenched at the pre-defined time point by transfering the reaction sample tubes to an ice bath and addition of saturated EDTA solution (5 μl) and DTT solution (5 μl), followed by overnight incubation at 4 °C. The remaining intact DNA was quantified by qRT-PCR measurement complemented with forward primer ‘TGCAAAAGATCCTCAACGTG’ and reverse primer ‘AATGGGAAGTCACGAAGGTG’ and normalized according to a calibration curve. 2.12. In vivo Stability. Polyplex micelles prepared from CAG-LUC2 were intravenous administered into the bloodstream of Balb/c nude mice. After appropriate time, the blood was collected, followed by centrifugation to create serum. The harvested serum was treated with mixture of trypsin, DTT and dextran sulfate to liberate pDNA from polyplex micelle. The remaining pDNA was purified by DNA purification kit, and quantified according to RT-PCR measurement with forward primer ‘TGCAAAAGATCCTCAACGTG’ and reverse primer ‘AATGGGAAGTCACGAAGGTG’ and normalized according to a calibration curve.


10

Page 11 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.13. Cellular Uptake. Cellular uptake efficiency was evaluated by Flow Cytometry (BD LSR II, BD, Franklin Lakes, NJ) measurement. Cy5-labeled pDNA was used to prepare diverse polyplex micelles. U87 cells were seeded on 6-well culture plates (100,000 cells/well) and incubated overnight in 2 mL DMEM containing 10% FBS in a humidified atmosphere with 5% CO2 at 37 °C. The medium was replaced with the fresh one after 24 h incubation, followed by addition of 150 µL polyplex micelle solution (33.3 µg pDNA/mL) into each well. After another 24 h incubation, the cells were washed 3 times with PBS to remove extracellular Cy5 fluorescence. Ultimately, the cells were detached by treatment of trypsin to create suspension in PBS for Flow Cytometry measurement. 2.14. In vitro Gene Expression. U87 cells were seeded on 24-well culture plates (20,000 cells/ well) and incubated overnight in 400 µL of DMEM containing 10% FBS in a humidified atmosphere with 5% CO2 at 37 °C. The medium was replaced with 400 µL fresh one, followed by addition of 30 µL polyplex micelle solution (1 µg CAG-LUC2 pDNA/well). The medium was exchanged with 400 µL fresh DMEM after 24 h incubation, followed by another 24 h incubation. The cells were washed with 400 µL PBS, and lysed in a 150 µL cell lysis buffer. The luciferase activity of the lysates was evaluated from the photoluminescence intensity using Mithras LB 940 (Berthold Technologies, USA). The obtained luciferase activity was further normalized against the corresponding amount of proteins in the lysates using a Micro BCATM Protein Assay Reagent Kit. 2.15. Tumor Accumulation. Balb/c nude mice were inoculated subcutaneously with injection of U87 cells (107 cells in 100 µL of PBS). Tumors were allowed to grow for 5 weeks before treatment. Mice bearing the tumors with similar volumes (~ 500 mm3) were randomly selected for each cohort (n = 9). To quantify the tumor accumulation efficiency of polyplex micelles, polyplex micelles containing Cy5-labeled pDNA were intravenously administered into the bloodstream of Balb/c


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 37

nude mice via the tail vein. Mice were sacrificed at 24 h post injection, and the tumor tissue was excised and homogenized in a cell passive lysis buffer. The lysis solution of the tumors was dispensed into 96-well opaque plate and the corresponding Cy5 fluorescence was measured by IVIS (Caliper Life Sciences, Hopkinton, MA). The results were expressed as the average radiant efficiency of Cy5 emission normalized by the weight of tumor tissue.

2.16. Tumor Suppression Efficacy. Balb/c nude mice were inoculated subcutaneously with U87 cells (107 cells in 100 µL of PBS). Tumors were allowed to grow for 2 weeks till proliferative phase, where the size of the tumors was approximately 75 mm3. Subsequently, each polyplex micelle solution (20 μg sFlt-1 pDNA/mouse) in 10 mM HEPES buffer (pH 7.4) with 150 mM NaCl was intravenously administered for 3 times to U87bearing Balb/c nude mice on days 0, 3 and 6 via the tail vein. Tumor size was measured every two or three days by a digital vernier caliper across its longest (a) and shortest diameters (b), and its volume (V) was calculated according to the following formula: V = 0.5ab2 Tumor progression was presented in term of the relative tumor volume (to day 0), n = 6. 2.17. sFlt-1 Expression in Tumors. Polyplex micelles containing sFlt-1 (20 μg) were intravenously administered into U87-inoculated Balb/c nude mice via the tail vein. Mice were sacrificed at 48 h after injection. The tumors were excised, embedded in O.C.T., frozen in dry-iced acetone with liquid nitrogen bath, and sectioned into 10 μm thick slices with a cryostat. Vascular endothelial cells (VECs) were immunostained using Rat antibodies anti-mouse PECAM-1 (BD Pharmingen, USA), followed by the staining with secondary anti-rat antibody of Alexa488. The expressed sFlt-1 were immunostained using Rabbit anti-human and mouse VEGFR1 (ab32152, Abcam China, Shanghai, China), followed by the staining with secondary anti-rabbit antibody of


12

Page 13 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Alexa594. The immunostained tumor cryo-sections were observed with Confocal Laser Scanning Microscopy (CLSM, Carl Zeiss, Germany). The sFlt-1 gene expression was quantified by sFlt-1 ELISA for the homogenized tumor tissue. 2.18. Vascular Density. Polyplex micelles containing sFlt-1 (20 μg of pDNA) were intravenously administered into U87-inoculated Balb/c nude mice though the tail vein on days 0 and 3. Mice were sacrificed on day 14. The tumors were excised, embedded in O.C.T., frozen in dry-iced acetone with liquid nitrogen bath, and sectioned into 10 μm thick slices with a cryostat. Vascular endothelial cells (VECs) were immunostained by rat monoclonal antibody antiplatelet endothelial cell adhesion molecule-1 (PECAM-1) (BD Pharmingen, Franklin Lakes, NJ), followed by the staining with secondary anti-rat antibody with Alexa Fluor 488-conjugation. The immunostained sections of the tumors were observed with CLSM. The vascular density of the tumors, an indicator of tumor antiangiogenesis, was quantified by measuring the percentage area of PECAM-1-positive pixels of tumor cryosection per image with 6 images per sample. 2.19. Systemic Toxicity. Polyplex micelles were intravenously administered into the tail vein of Balb/c nude mice (female, 7 week old) at the pDNA dosage of 20 μg/mouse. The blood was collected at pre-defined time post-injection from inferior vena cava and transferred for ELISA measurement to determine the plasma level of Interleukin-6 (IL-6), glutamate oxaloacetate transaminase (GOT), glutamic pyruvic transanminase (GPT), and lactate dehydrogenase (LDH) with DRI-CHEM 7000i (Fuji Film, Tokyo, Japan). 2.20. Statistic Analysis. The p values were determined by a Student's t-test using a two-tailed distribution and two-sample unequal variance with the T. Test function in Microsoft Excel. Here, the p values of less than 0.05 were considered as statistically significant. 3. RESULTS AND DISCUSSION


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 37

3.1. Prolong Systemic Retention for Bioavailability to the Targeted Site. In this work, a series of block copolymers were synthesized and their chemical descriptions were summarized in Table 1. PEG-PLys, PEG-PLys(SH), mixture of PEG-PLys(SH) and PNIPAM-PLys(SH) (molar ratio of 1:1) [referred as PEG/PNIPAM-PLys(SH) hereafter] and mixture of cRGD-PEG-PLys(SH) and PNIPAMPLys(SH) (molar ratio of 1:1) [referred as cRGD-PEG/PNIPAM-PLys(SH) hereafter] were used to complex with pDNA at N/P ratio of 1.5 (a relative stoichiometric ratio of 1.5 was selected with the aim of complete complexation of pDNA, but higher N/P ratios were avoided with respect to the well-acknowledged cationic-involved toxicities), where N/P ratio was defined as the molar ratio of the total primary amine groups of the polymers to the phosphate groups of pDNA. To pursue prolonged systemic retention, PEGylated polyplex was adopted as the platform to construct pDNA delivery systems. The control system of platform formulation, diblock copolymer PEG-PLys was used to complex with pDNA through electrostatic interactions. The opposite-charged PLys and pDNA could self-assemble into the interior compartment, spatially surrounded by the tethered biocompatible and hydrophilic PEG segments to present a distinctive core-shell architecture. Of note, as demonstrated previously, pDNA was condensed as DNA bundle (rod-shaped structure)7 rather than spherical structure due to the rigidity of DNA (persistence length: approximate 50 nm).16 To stabilize this formation, thiol groups was attempted to introduce into the side chain of PLys segments of PEG-PLys, where crosslinking of complex compartment could be achieved though intra- or inter- molecular disulfide linkage between thiol residues of PLys(SH). This crosslinking was reported to markedly increase the colloidal stabilities in the biological environment,17 particularly reducing occurrence of dissociation as a consequence of electrostatic exchange reaction with the charged species in the biological species, such as glycosaminoglycan. Consequently, premature direct exposure of the encapsulated DNA to enzymatic degradation in the extracellular milieu could be avoided, such as bloodstream (DNase: 0.01 U/mL). As claimed, despite the reduced accessibility of the biological compounds by virtue of PEGylation, drastic high PEG crowdedness


14

Page 15 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was postulated to exclude the accessibility of nucleases and subsequent degradation.11 Apparently, high PEG crowdedness is thermodynamic unfavorable with respect to restricted chain motion of PEG segments when confined in a limited corona. Solely electrostatic-based drive force should be not feasible to create an adequate PEG crowdedness.8 To manage this obstacle, we attempted to introduce an additional intermediate hydrophobic palisade between the PEG shell and the (PLysSH)/DNA interior. It could be anticipated that the hydrophobic palisade, due to its thermodynamic propensity to reduce the interfacial energy as possible, could contribute to a solid hydrophobic layer to curtail the attacking of the biological species to the encapsulated DNA. Moreover, learning form the previous work,18 hydrophobic interaction possibly appends an additional driving force to induce further collapse-down of pDNA and elicit an elevated PEG crowdedness, eventually resulting in improved stealth function of the PEG shell. Herein, mixture of PEG-PLys(PDP) and PNIPAMPLys(PDP) in DTT (10 mM) was used to complex with pDNA at 25 °C (below lower critical solution temperature of PNIPAM),19 followed by sequential dialysis in DMSO-containing PBS water and RNase-free PBS water for disulfide crosslinking. Given that the thermoresponsive character of PNIPAM induces hydrophilic-hydrophobic transformation upon a thermal gradient from 25 °C to 37 °C, the intermediate PNIPAM palisade is assumed to formulate upon incubation at elevated temperature, e.g. physiological 37 °C. To verify this assumption, temperature-dependent 1H-NMR measurement was conducted for the proposed polyplex formulation of PEG/PNIPAMPLys(SH)/pDNA, observing progressively decreased integrated intensity of PNIPAM segments relative to that of PEG along an elevated incubation temperature (Figure 1A). This declined intensity of PNIPAM in 1H-NMR spectra indicated the thermoresponsive dehydration of PNIPAM segments, consequently resulting in aggregation of PNIPAM chains and collapse-down as intermediate palisade onto the preformed PLys(SH)/pDNA complex core. Moreover, to verify the structural impact of collapse-down of PNIPAM, we characterized the morphologies of polyplex micelles prepared at 25 °C, but followed by subsequent incubation at 25 °C and 37 °C by fluid


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 37

atomic force microscopy (AFM). In agreement with the pioneering work,11 PEG/PNIPAM-PLys(SH) at 25 °C was observed as distinct rod-shaped structures with average length of 168 nm (Figure 1B, i), suggesting pDNA was packaged into DNA bundle through the scheme of regular folding of DNA strands. Distinct morphology transition to be a more condensed structures was observed for the same sample with extended incubation at 37 °C, presenting as distinctive ellipsoid nanoparticles, with average major length of 73 nm (Figure 1B, ii). This observation suggests our proposal of construction of intermediate hydrophobic PNIPAM barrier could be achieved. Most likely, PNIPAM could translocate from the initial shell component to deposit onto the PLys(SH)/pDNA core as the intermediate hydrophobic palisade by virtue of the thermoresponsive hydrophilic-hydrophobic transition of PNIPAM in response to the proposed thermal gradient (25-37 °C). Furthermore, we explored the utility of these strategies, by means of disulfide for improved structural stabilities and PNIPAM palisade for inhibited accessibilities of small biological species, in preventing DNA from enzymatic degradation. Herein, we evaluated the tolerability of DNA within diverse polyplex formulations under biological anionic specie of dextran sulfate and enzymatic specie of DNase I. The diverse polyplex formulations [PEG-PLys, PEG-PLys(SH) and PEG/PNIPAMPLys(SH)] was incubated in presence of heparan sulfate (40 mg/mL, mimicking the condition in GBM)20 and DNase (0.01 U/mL, mimicking the condition in bloodstream).21 The remaining intact pDNA post predefined incubation times was quantified by qRT-PCR measurement. In accordance to our speculations, DNA within PEG-PLys was observed to experience rapid degradation, merely approximate 20 % remained at 5 min post incubation and negligible pDNA was remained at 15 min post incubation (Figure 2A). As opposed to control polyplex micelle of PEG-PLys, both disulfide crosslinking and intermediate PNIPAM palisade approved their contribution in prolonging the survival of the encapsulated DNA. Particularly, PEG/PNIPAM-PLys(SH) exhibited compelling resistance to degradation, as evidenced by no marked DNA degradation despite 60 min post incubation (Figure 2A). Furthermore, in consistent with the in vitro results, the systemic retention


16

Page 17 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in the bloodstream post intravenous injection of these polyplex micelles, exhibited a similar trend, where both disulfide crosslinking and intermediate PNIPAM palisade committed to prolong systemic retention to a pronounced extend. Of note, approximate 20% DNA remained in the bloodstream even at 6 h post administration for the polyplex micelle from PEG/PNIPAM-PLys(SH) (Figure 2B). The appreciable prolonged retention profile of PEG/PNIPAM-PLys(SH) permits high bioavailability to the potential targets, thus heralding its potential use in the systemic therapeutic trial. 3.2. Promote Gene Expression to the Targeted Cells. PEG/PNIPAM-PLys(SH), by virtue of strategic arrangement of complex crosslinking and intermediate PNIPAM palisade, has achieved remarkable retention in the blood circulation, which indicated the persistent retention in the bloodstream and reaching the targeted cells after intravenous administration. Aiming to promote the gene expression activity at the targeted cells, ligand molecule (cRGD peptide) was strategically conjugated at the distal end of PEG segment in the block copolymer intended for promoting specific ligand-integrin mediated cellular endocytosis, which could also serve as an active tumor-targeting moiety to improve tumor accumulation efficiency by considering that RGD peptide is a recognition motif in multiple ligands of αv integrin family, in particular cyclic RGD peptides displayed high affinity to αvβ3 and αvβ5 integrin receptors which are overexpressed on angiogenic endothelial cells in tumor blood vessel and fibroblast cells in tumor stroma. Given that U87 cells (human primary glioblastoma cells) are featured with over-expression of RGD specific recognizable integrins (αVβ3 and αVβ5) on the cell surface,22-27 the cellular uptake and gene expression efficiency of polyplex micelles [PEG/PNIPAM-PLys(SH) and cRGD-PEG/PNIPAM-PLys(SH)] were examined in U87 cells to confirm the RGD effect. As evidenced in the cell uptake evaluation, cRGD-PEG/PNIPAM-PLys(SH) induced a remarkable larger amount of polyplex micelles internalized into U87 cells as compared to PEG/PNIPAM-PLys(SH) (Figure 3A), thereby confirming RGD-integrin mediated affinity. Furthermore, elevated gene expression was also observed for cRGD-PEG/PNIPAM-PLys(SH) with


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 37

approximate 2-order magnitude higher over PEG/PNIPAM-PLys(SH) (Figure 3B). It should be noted that, once internalized into the cells, the polyplex micelles should provide viable facilities to liberate the encapsulated pDNA for convenience of gene transcription machinery. In this respect, the proposed redox-responsive disulfide crosslinking is particular intriguing. Given that the cell interior is characterized to be a distinctive reducing compartment as compared to the extracellular milieu [e.g. intracellular antioxidant glutathione (GSH) concentrations usually range from 0.5 to 10 mM, whereas the extracellular values are determined to be one to three orders of magnitude lower in GSH)],28 it can readily anticipate reversible disulfide bond in the proposed polyplex micelle. Namely, the disulfide crosslinking preserving in the relative oxidizing extracellular milieu (e.g. bloodstream, extracellular matrix), could be readily cleaved in the intracellular reducing compartment. Consequently, a facilitated dissociation of polyplex could be presumed by considering the exchange reaction of electrostatic-assembled polyplex with charged intracellular species (cytoplasmic lipids, heparan sulfate, chondroitin sulfate, hyaluronic acid, DNA and RNA). Here, EtBr assay was employed to investigate the reduction-responsive DNA releasing behavior.29 EtBr is a commonly used DNA-intercalating fluorescent tag, whose fluorescence emission could be intensified approximate 20-fold when bind to DNA. Hence, EtBr was an indicator to assess the impact of reducing agent (DTT: 10 mM) treatment on the dissociation behavior of polyplex micelle in presence of anionic species (heparan sulfate). As opposed to a reluctant dissociation of PEGPLys(SH) and PEG/PNIPAM-PLys(SH) by heparan sulfate at absence of DTT, readily dissociation of polyplex was observed for both PEG-PLys(SH) and PEG/PNIPAM-PLys(SH) by heparan sulfate under DTT treatment (Figure S7), approving facile intracellular reduction-responsive release of DNA. Hence, the eventually gene expression level of cRGD-PEG/PNIPAM-PLys(SH) compiled with diverse functional components could achieve appreciable higher than the commercial nucleic acids transfection agents (Figure S10A), such as lipofectamine, PEI (involved considerable toxicity and non-stealth surface property, Figure S10B). The remarkable high transfection of our proposed


18

Page 19 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cRGD-PEG/PNIPAM-PLys(SH), together with its negligible toxicity (Figure S8) endows its distinct advantages as safe and efficient synthetic gene transfection carrier. Moreover, its stealth function, capable of retention in the blood circulation, encourages it to be utilized as advanced synthetic formulation to perform systemic gene therapy task. 3.3. Systemic Treatment of Intractable Tumors. In relative to PEG/PNIPAM-PLys(SH), cRGDPEG/PNIPAM-PLys(SH) was verified to preserve the appreciable blood circulation profile. Together with its high cell transfection efficiency, marked gene expression could be envisioned in the tumors from cRGD-PEG/PNIPAM-PLys(SH) polyplex micelle via intravenous administration. Here, in vivo efficacy of the ultimate cRGD-PEG/PNIPAM-PLys(SH) polyplex micelle was attempted in treatment of one of most intractable malignant gliomas constructed by U87 cells. Anti-angiogenic approach, where tumor growth is conceptually to be inhibited through destruction of neo-vasculature formation, was employed to treat this intractable tumor. In the present study, pDNA encoding soluble fms-like tyrosine kinase-1 (sFlt-1) capable of actively targeting and deactivating angiogenic molecules (e.g. vascular endothelial growth factors: VEGF),30-32 was selected as payload to demonstrate the feasibility of the proposed cRGD-PEG/PNIPAM-PLys(SH) for systemic antiangiogenic tumor gene therapy applications. Prior to therapeutic treatment, it is important to confirm the benefits of RGD motif for the targeted accumulation of polyplex micelles into the tumors [Note that vascular endothelial cells and fibroblasts overexpressing αVβ3 and αVβ5 integrins on the cell surface, thus are presumed to be the potential targets for cRGD-PEG/PNIPAM-PLys(SH)]. To quantify the tumor accumulation efficiency, polyplex micelles of PEG/PNIPAM-PLys(SH) and cRGD-PEG/PNIPAM-PLys(SH) prepared from Cy5labeled pDNA were intravenously administered into the bloodstream of Balb/c mice bearing U87 tumors via the tail vein. The tumor accumulation efficiency of polyplex micelles was quantified by measuring the fluorescence intensity of Cy5 in homogenized tumor tissues. Apparently, cRGD-


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 37

PEG/PNIPAM-PLys(SH) exhibited notably higher tumor accumulation, approximate 6 times higher than PEG/PNIPAM-PLys(SH) (Figure 4A, Figure S11). This result confirmed the utility of cRGD as targeting moiety to afford improved bioavailability to the targeted tumor site. Furthermore, sFlt-1 as payload was encapsulated in the cRGD-PEG/PNIPAM-PLys(SH) and PEG/PNIPAM-PLys(SH) polyplex micelles for treatment of U87 tumors through intravenous administration. PEG/PNIPAM-PLys(SH) displayed significant inhibitory effect on the tumor growth compared to the control groups (Figure 5). In particular, cRGD-PEG/PNIPAM-PLys(SH) exerting dramatically more potent tumor suppression effect than PEG/PNIPAM-PLys(SH) (Figure 5), thus approved the functional role of cRGD peptide in promoting systemic anti-tumor efficacy. Of note, no observable therapeutic efficacy was obtained for cRGD-PEG/PNIPAM-PLys(SH) containing nontherapeutic LUC gene as payload (Figure 5), suggesting the obtained therapeutic efficacy from cRGD-PEG/PNIPAM-PLys(SH) and PEG/PNIPAM-PLys(SH) as a consequence of the payload sFlt-1 expression. To gain direct evidence of the obtained anti-tumor efficacy as a result of the loaded pDNA expression at the tumor site, we immunostained the cyro-section of the tumor tissues using an antibody for VEGF receptor, which is capable of detecting the expressed soluble Flt-1. Significant expression of the total sFlt-1 (green) was observed in the mice administered with PEG/PNIPAMPLys(SH) and cRGD-PEG/PNIPAM-PLys(SH) (Figure 4B). In particular, cRGD-PEG/PNIPAMPLys(SH) displayed markedly higher gene expression than that of PEG/PNIPAM-PLys(SH) (Figure 4C). This observation was in good agreement with the tumor growth suppression result (Figure 5). Close observation found that the expressed sFlt-1 enriched in the tumor stroma adjacent to the vascular endothelial cells (red), rather than the tumor nest (cell nuclei stained into blue) (Figure 4B). This suggested the polyplex micelles should be most likely transfected to the vascular cells and/or the stromal cells adjacent to the vascular lumens. Most likely, the sFlt-1 proteins secreted


20

Page 21 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


from these transfected cells could accordingly conduce to potent anti-angiogenic environment for the entrapment of VEGF proteins in the tumors, consequently eliciting destruction of neovasculature formation and retarded tumor growth. Ultimately, the anti-angiogenic effect of the sFlt-1 expression from cRGD-PEG/PNIPAM-PLys(SH) was confirmed by immunostaining vascular endothelial cells by using PECAM-1 (Figure 6A). The quantified vascular density of the tumors treated by cRGD-PEG/PNIPAM-PLys(SH) was significantly lower than that of the other groups (Figure 6B). This result suggests accumulation of cRGDPEG/PNIPAM-PLys(SH) into the tumors inspired remarkable gene expression of the loaded antiangiogenic gene at the targeted tumor cells, resulting in anti-angiogenic effect (inhibition of neovasculature growth), eventually giving rise to potent anti-tumor efficacy. Aside from efficiency, the excellent safety profile of the proposed formulation was also confirmed, which is evidenced by no observable systemic toxicity by monitoring the body weight (no significant change in all treated group relative to the control PBS group, Figure S12). Moreover, the adverse effect based on quantification of biomarkers, including inflammation marker of interleukin6 (IL-6), liver damage markers of glutamate oxaloacetate transaminase (GOT), and glutamic pyruvic transaminase (GPT), and overall tissue damage marker of lactate dehydrogenase (LDH), also verified the safety profile of the proposed systems (Figure 7). This is in stark contrast to the control samples of commercial transfection agents of PEI and cRGD-PEG/PNIPAM-PLys(SH) at exceeding high N/P ratio of 20. The obtained results validated the tempting prosperous of the proposed system as safe and efficient gene delivery system as practical-applicable formulation for potential treatment of intractable diseases. To date, despite of magnificent progress in medicine, the cancer remains one of the highest fatalities among all the diseases due to lack of safe and efficient method for targeted regulate the biology of the cancerous tumor. Gene therapy has been highlighted for a couple of decades for


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 37

tentative treatment of tumors. The concept of gene therapy is intriguing, however, the real obstacle that restrict gene therapy from being widely applicable to clinical trial is due to lack of a safe and efficient gene delivery carriers. Here, the synthetic multi-layer architecture here could propose a feasible gene delivery carrier that may hold tempting promise due to its targeted delivery to the pathologic site, leadingly enhanced bioavailability into the pathologic tissue. Considering the proposed formulation was negligible in terms of systemic toxicity, as well as negligible cytotoxicity even at 10-fold dosage of the current therapeutic use (Figure S9), it should be feasible to deliver therapeutic genes repeatedly to angiogenic blood vessels for sustained treatment of tumors. Apparently, the successful anti-angiogenic gene expression at the tumor site by utilizing this novel gene delivery carriers will give rise to notable contribution for tumor treatment, open a new avenue for clinical applicable tumor therapy and remarkably diversify the therapeutic modalities for tumor treatment. 4. CONCLUSIONS We have strived to compile chemical strategies in manufacture of systemic-applicable pDNA delivery vehicle. The subsequent investigations approved that polyplex micelle with disulfide crosslinking for the complex core and intermediate PNIPAM barrier to protect the complex core for prolonged blood retention. Moreover, cRGD surface functionalization led to active targeted accumulation to the tumors, along with promotion of gene expression at the targeted cells, ultimately giving rise to pronounced gene expression in the targeted cells and potent therapeutic efficacy for anti-tumor treatment through anti-angiogenesis. The obtained results validated our proposed polyplex micelle with high systemic longevity and targeted delivery ability, which is of particular interest and should be a promising strategy worthy of further development to find broad utilities for targeted gene therapy via systemic route. ASSOCIATED CONTENT


22

Page 23 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Supporting Information. The Supporting Information is available free of charge on the ACS Publications website at DOI:..... The polymer synthetic scheme, polymer characterizations (1H-NMR, GPC), additional polyplex characterization (EtBr assay), cytotoxicity and transfection, in vivo toxicity and biodistribution AUTHOR INFORMATION Corresponding Author *Dr. Qixian Chen. Tel: +1-6175017710. Email: [email protected]. *Dr. Wenfei Dong. Tel: +86-512-69588307. Email: [email protected]. Author Contributions †These

two authors contributed equally to this work.

Notes The authors declare no competing financial interest. ACKNOWLEDGMENT This work was financially supported by the National Natural Science Foundation of China (Grant No. 61535010) and the Science and Technology Department of Suzhou City (No. ZXY201434).

REFERENCES: 1

Kay, M. A. State-of-the-Art Gene-Based Therapies: the Road Ahead. Nature Rev. Genetics 2011, 12, 316–328.


23


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

2

Page 24 of 37

Mingozzi, F.; High K. A. Therapeutic In Vivo Gene Transfer for Genetic Disease Using AAV: Progress and Challenges. Nature Rev. Genetics 2011, 12, 341–355.

3

Wang, J.; Mi, P.; Lin, G.; Wang, Y.; Liu, G.; Chen. X. Imaging-guided Delivery of RNAi for Anticancer treatment. Adv. Drug Delivery Rev. 2016, 104, 44–60.

4

Lee, Y.; Kataoka, K. Delivery of Nucleic Acid Drugs. Adv. Polym. Sci. 2012, 249, 95–134.

5

Alexis, F.; Pridgen, E.; Molnar, L. K.; Farkhazd, O. C. Factors Affecting the Clearance and Biodistribution of Polymeric Nanoparticles. Mol. Pharmaceutics 2008, 5, 505–515.

6

Osada, K.; Christie, J. R.; Kataoka, K. Polymeric Micelles from Poly(ethylene glycol)poly(amino acid) Block Copolymer for Drug and Gene Delivery. J. R. Soc. Interface 2009, 6, S325–339.

7

Osada, K.; Oshima, H.; Kobayashi, D.; Doi, M.; Enoki, M.; Yamasaki, Y.; Kataoka, K. Quantized Folding of Plasmid DNA Condensed with Block Catiomer into Characteristic Rod Structures Promoting Transgene Efficacy. J. Am. Chem. Soc. 2010, 132, 12343–12348.

8

Tockary T. A.; Osada, K.; Chen, Q.; Machitani, K.; Dirisala, A.; Uchida, S.; Nomoto, T.; Toh, K.; Matsumoto, Y.; Itaka, K.; Nitta, K.; Nagayama, K.; Kataoka, K. Tethered PEG Crowdedness Determining Shape and Blood Circulation Profile of Polyplex Micelle Gene Carriers. Macromolecules 2013, 46, 6585–6592.

9

Zuckerman, J. E.; Choi, C. H. J.; Han, H.; Davis, M. E. Polycation-siRNA Nanoparticles Can Disassemble at the Kidney Glomerular Basement Membrane. Proc. Natl. Acad. Sci. USA 2012, 109, 3137–3142.

10 West, A. L.; Griep, M. H.; Cole, D. P.; Karna, S. P. DNase I Retains Endodeoxyribonuclease Activity Following Gold Nanocluster Synthesis. Anal. Chem. 2014, 86, 7377–7382.


24

Page 25 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


11 Ge, Z.; Chen, Q.; Osada, K.; Liu, X.; Tockary T. A.; Uchida; S, Dirisala A, Ishii, T.; Nomoto, T.; Toh, K.; Matsumoto, Y.; Oba, M.; Kano, M. R.; Itaka, K.; Kataoka. Targeted Gene Delivery by Polyplex Micelles with Crowded PEG Palisade and cRGD Moiety for Systemic Treatment of Pancreatic Tumors. Biomaterials 2014, 35, 3416–3426. 12 Ruoslahti, E. RGD and Other Recognition Sequences for Integrins. Annu. Rev. Cell Dev. Biol. 1996, 12, 697–715. 13 Tockary, T. A.; Osada, K.; Motoda, Y.; Hiki, S.; Chen, Q.; Takeda, K. M.; Dirisala, A.; Osawa, S.; Kataoka, K. Rod-to-globule Transition of pDNA/PEG-Poly(L-lysine) Polyplex Micelles Induced by a Collapsed Balance between DNA Rigidity and PEG Crowdedness. Small 2016, 12, 1193–1200. 14 Oba, M.; Aoyagi, K.; Miyata, K.; Matsumoto, Y.; Itaka, K.; Nishiyama, N.; Yamasaki, Y.; Koyama, H.; Kataoka, K. Polyplex Micelles with Cyclic RGD Peptide Ligands and Disulfide Cross-links Directing to the Enhanced Transfection via Controlled Intracellular Trafficking. Mol. Pharmaceut. 2008, 5, 1080–1092. 15 Kakizawa, Y.; Harada, A. Kataoka, K. Glutathione-sensitive Stabilization of Block Copolymer Micelles Composed of Antisense DNA and Thiolated Poly(ethylene glycol)-block-poly(Llysine): A Potential Carrier for Systemic Delivery of Antisense DNA. Biomacromolecules 2001, 2, 491–497. 16 Eisenberg, H. DNA Flexing, Folding, and Function, Acc. Chem. Res. 1987, 20, 276–282. 17 Dirisala, A.; Osada, K.; Chen, Q.; Tockary, T. A.; Machitani, K.; Osawa, S.; Liu, X.; Ishii, T.; Miyata, K.; Oba, M.; Uchida, S.; Itaka, K.; Kataoka, K. Optimized Rod Length of Polyplex Micelles for Maximizing Transfection Efficiency and Their Performance in Systemic Gene Therapy against Stroma-Rich Pancreatic Tumors. Biomaterials 2014, 35, 5359–5368.


25


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 37

18 Li, J.; Chen, Q.; Zha, Z.; Li, H.; Toh, K.; Dirisala, A.; Matsumoto, Y.; Osada, K.; Kataoka, K.; Z. Ge, Ternary Polyplex Micelles with PEG Shells and Intermediate Barrier to Complexed DNA Cores for Efficient Systemic Gene Delivery. J. Controlled Release 2015, 77–87. 19 Ward, M. A.; Georgiou, T. K. Thermoresponsive Polymers for Biomedical Applications. Polymers 2011, 2, 1215–1242. 20 McCarthy, K. J.; Wassenhove-McCarthy J. W. The Glomerular Basement Membrane as a Model System to Study the Bioactivity of Heparan Sulfate Glycosaminoglycans. Microsc. Microanal. 2012, 18, 3–21. 21 Tamkovich, S. N.; Cherepanova, A. V.; Kolesnikova, E. V.; Rykova, E. Y.; Pyshnyi, D. V.; Vlassov, V. V.; Laktionov, P. P. Circulating DNA and DNase Activity in Human Blood. Ann. N. Y. Acad. Sci. 2006, 1075,191–196. 22 Danhier, F.; Breton, A. L.; Preat, V. RGD-Based Strategies to Target Alpha(v) Beta(3) Integrin in Cancer Therapy and Diagnosis. Mol. Pharmaceutics 2012, 9, 2961–2973. 23 Hwang, R.; Varner, J. V. The Role of Integrins in Tumor Angiogenesis. Hematol. Oncol. Clin. North Am. 2004, 18, 991–1006. 24 Kagaya, H.; Oba, M.; Miura, Y.; Koyama, H.; Ishii, T.; Shimada, T.; Takato, T.; Kataoka, K.; Miyata, T. Impact of Polyplex Micelles Installed with Cyclic RGD Peptide as Ligand on Gene Delivery to Vascular Lesions. Gene Ther. 2012, 19, 61–69. 25 Takayama, S.; Ishii, S.; Ikeda, T.; Masamura, S.; Doi, M.; Kitajima, M. The Relationship between Bone Metastasis from Human Breast Cancer and Integrin Alpha(v)beta3 Expression. Anticancer Res. 2005, 25, 79– 83.


26

Page 27 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


26 Furger, K. A.; Allan, A. L.; Wilson, S. M.; Hota, C.; Vantyghem, S. A.; Postenka, C. O.; Al-Katib, W.; Chambers, A. F.; Tuck, A. B. Beta(3) Integrin Expression Increases Breast Carcinoma Cell Responsiveness to the Malignancy-enhancing Effects of Osteopontin. Mol. Cancer Res. 2003, 1, 810–819. 27 Vellon, L.; Menendez, J, A.; Liu, H.; Lupu, R. Up-Regulation of Alphavbeta3 Integrin Expression is a novel Molecular Response to Chemotherapy-induced Cell Damage in a Heregulin-Dependent Manner. Differentiation 2007, 75, 819–30. 28 Maher, P. The Effects of Stress and Aging on Glutathione Metabolism. Ageing Res. Rev. 2005, 4, 288–314. 29 Wong, S.Y.; Sood, N.; Putnam, D. Combinatorial Evaluation of Cations, pH-sensitive and Hydrophobic Moieties for Polymeric Vector Design. Mol. Ther. 2009, 17, 480–490. 30 Yamaguchi, S.; Iwata, K.; Shibuya, M. Soluble Flt-1 (Soluble VEGFR-1), a Potent Natural Antiangiogenic Molecule in Mammals, Is Phylogenetically Conserved in Avians. Biochem. Biophys. Res. Commun. 2002, 291, 554–559. 31 Oba, M.; Vachutinsky, Y.; Miyata, K.; Kano, M. R.; Ikeda, S.; Nishiyama, N.; Itaka, K.; Miyazono, K.; Koyama, H.; Kataoka, K. Antiangiogenic Gene Therapy of Solid Tumor by Systemic Injection of Polyplex Micelles Loading Plasmid DNA Encoding Soluble Flt-1. Mol. Pharm. 2010, 7, 501–509. 32 Carmeliet, P.; Jain, R.K. Angiogenesis in Cancer and Other Diseases. Nature 2000, 407, 249– 257.


27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 37

Table 1 chemical characterization of diverse block polymers.

PEG-PLys

PEG-PLys(SH)

cRGD-PEGPLys(SH)

PNIPAM-PLys(SH)

DP of PLys

55

53

53

54

Thiolation degree

0

20%

18%

20%

cRGD percentage

-

-

95%

-

PEG segment

12 kDa

12 kDa

12 kDa

-

PNIPAM segment

-

-

-

5.5 kDa


28

Page 29 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1 Schematic illustration of formulation of three-layered polyplex micelle as pDNA delivery system. pDNA (red DNA bundle core) was electrostatically complexed with PLys (core blue) as the complex core, followed by crosslinking through redox disulfide (S-S) linkage. The thermoresponsive PNIPAM (green) translocates from the shell component to collapse down onto the complex core as protective intermediate barrier. The external PEG (orange) presented as the biocompatible shell. cRGD (yellow) as ligand was installed at the distal end of PEG to exert tumor-targeting function. The structure of the proposed formulation at 37 °C was characterized by fluid AFM measurement (right bottom).


29


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 37

Figure 1 Insight into thermoresponsive behavior of polyplex micelle prepared from PEG/PNIPAM-PLys(SH). A): Relative ratio of the integrated areas of PEG and PNIPAM from 1H-NMR for the polymeric formulation of PEG/PNIPAM-PLys(SH) along an elevated incubation temperature; B): Fluid AMF characterization of PEG/PNIPAM-PLys(SH) at 25 °C with subsequent incubation at either 25 °C (i) or 37 °C (ii). Scale bar: 100 nm.


30

Page 31 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2 Survival of pDNA within diverse polyplex micelle formulations in the biological milieu. A): Tolerability of pDNA within diverse polyplex micelle formulations in presence of anionic heparan sulfate (40 mg/mL) and nuclease (DNase I) by qRT-PCR measurement; B): Blood retention profiles of diverse polyplex micelle formulations post intravenous administration by quantification of the remaining intact DNA in the bloodstream based on qRT-PCR measurement.


31


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 37

Figure 3 In vitro cellular uptake and gene expression of diverse polyplex formulations in U87 cells. A): cell uptake activity, evaluated by flow cytometry using Cy5-labeled pDNA (ANOVA analysis was conducted to all the groups, p < 0.01); B): gene expression activity, where pDNA encoding luciferase was used as reporter gene for evaluation of gene transfection efficiency (ANOVA analysis was conducted to all the groups, p < 0.01).


32

Page 33 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4 Tumor accumulation and gene expression of diverse polyplex micelle formulations containing sFlt-1 gene for treatment of U87 tumors via intravenous administration. A): Tumor accumulation efficiency (**p < 0.01, student T Test); B) Immunostaining of cyro-section of tumors for identification of sFlt-1 expression, where blood vessel was stained into red, cell nuclei were stained into blue and sFlt-1 was stained into green. i) PBS, ii) PEG/PNIPAM-PLys(SH) and iii) cRGD-PEG/PNIPAM-PLys(SH). Scale bar: 300 μm; C): Quantification of sFlt-1 expression in the tumors by ELISA (ANOVA analysis was conducted to all the groups, p < 0.05).


33


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 37

Figure 5 Anti-tumor efficacies by intravenous administration of polyplex micelle containing anti-angiogenic sFlt-1 gene or non-therapeutic LUC gene as control. Intravenous dosage was performed to Balb/c nude U87 tumor bearing mice through tail vein at day 0, 3 and 6. Purple: PBS, Green: PEG/PNIPAM-PLys(SH) loading sFlt-1 gene, Red: cRGD-PEG/PNIPAM-PLys(SH) loading sFlt-1 gene, Blue: cRGD-PEG/PNIPAM-PLys(SH) loading Luc gene. ANOVA analysis was conducted to all the groups, p < 0.05.


34

Page 35 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6 Anti-angiogenesis of the tumors with treatment of diverse polyplex micelle formulations containing anti-angiogenic sFlt-1 gene through intravenous administration. A): Representative of blood vessel (green) in tumors under treatment of diverse polyplex micelle formulations. Scale bar: 500 μm; B): Quantification of vascular density under treatment of diverse polyplex micelle formulations. i) PBS, ii) PEG/PNIPAM-PLys(SH) and iii) cRGD-PEG/PNIPAM-PLys(SH) (ANOVA analysis was conducted to all the groups, p < 0.05).


35


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 37

Figure 7 Systemic toxicities of diverse synthetic gene delivery formulations after intravenous administration to Balb/c nude mice. A):IL-6; B): GOT; C): GPT; D): LDH.


36

Page 37 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Graphic Table of Contents


37

Polymeric Nanostructure Compiled with ... - ACS Publications

Recommend Documents