Chem. Res. Toxicol. 2003, 16, 1507-1513
1507
Articles Polymorphisms in the Human Monomethylarsonic Acid (MMAV) Reductase/hGSTO1 Gene and Changes in Urinary Arsenic Profiles Lorraine L. Marnell,† Gonzalo G. Garcia-Vargas,‡ Uttam K. Chowdhury,† Robert A. Zakharyan,† Bruce Walsh,§ Mihaela D. Avram,† Michael J. Kopplin,| Mariano E. Cebria´n,⊥ Ellen K. Silbergeld,# and H. Vasken Aposhian*,†,| Department of Molecular and Cellular Biology, Department of Ecology and Evolutionary Biology, and Center for Toxicology, University of Arizona, Tucson Arizona 85721-0106, Facultad de Medicina, Universidad Juarez del Estado de Durango Lasalle, 1 y Sixto Ugalde S/N Gomez Palacio, Durango, 35050 Mexico, Centro de Investigacion y de Estudios Avanzados del IPN, Av. Instituto Politecnico Nacion Distrito Federal 07360, and Department of Environmental Health Sciences, Johns Hopkins University, Baltimore, Maryland Received July 14, 2003
Large interindividual variability in urinary arsenic profiles, following chronic inorganic arsenic exposure, is well-known in humans. To understand this variability, we studied the relationship between polymorphisms in the gene for human monomethylarsonic acid (MMAV) reductase/hGSTO1 and the urinary arsenic profiles of individuals chronically exposed to arsenic in their drinking water. To ensure that we did not overlook rare polymorphisms, not included in the public databases, we amplified and sequenced all six exons of the gene and their flanking regions, using DNA isolated from peripheral blood samples of 75 subjects, living in the vicinity of Torreon, Mexico. Four groups, based on the levels of arsenic (9-100 µg/L) in their drinking water, were studied. We identified six novel polymorphisms and two reported previously. The novel polymorphisms were a three base pair deletion (delGGC) in the first intron; a G > C transversion, leading to a serine-to-cysteine substitution at amino acid 86; a G > T transversion and a A > T transversion in intron 5; a G > A transition resulting in glutamate-to-lysine substitution in amino acid 208; and a C > T transition producing an alanine-to-valine substitution in amino acid 236. Two subjects displayed significant differences in patterns of urinary arsenic; they had increased levels of urinary inorganic arsenic and reduced levels of methylated urinary arsenic species as compared to the rest of the study population. These two subjects had the same unique polymorphisms in hGSTO1 in that they were heterozygous for E155del and Glu208Lys. The identified SNPs may be one of the reasons for the large interindividual variability in the response of humans to chronic inorganic arsenic exposure. The findings suggest the need for further studies to identify unambiguously specific polymorphisms that may account for interindividual variability in the human response to chronic inorganic arsenic exposure.
Introduction The presence of high concentrations of inorganic arsenic in drinking water (1) is a major health problem in many parts of the world (2-4) and results in an increased risk of cancer (5), circulatory diseases (6), and perhaps diabetes (3, 4, 7). There is variability in the * To whom correspondence should be addressed. E-mail: aposhian@ u.arizona.edu. † Department of Molecular and Cellular Biology, University of Arizona. ‡ Universidad Juarez del Estado de Durango Lasalle. § Department of Ecology and Evolutionary Biology, University of Arizona. | Center for Toxicology, University of Arizona. ⊥ Centro de Investigacion y de Estudios Avanzados del IPN. # Department of Environmental Health Sciences, Johns Hopkins University.
response of different individuals to chronic inorganic arsenic exposure (3, 4). Because MMAV 1 reductase is the rate-limiting enzyme in arsenic biotransformation (Figure 1) (8), we hypothesized that mutations in its gene would putatively effect arsenic metabolism. In humans, MMAV reductase protein is identical to the protein encoded by the gene recently identified by Board et al. (9) as hGSTO1 (10). The GST omegas are unusual members of the GST superfamily, which also includes classes termed alpha, mu, theta, pi, and zeta (11). GSTs 1 Abbreviations: MMAV, monomethylarsonic acid; hGSTO1, human glutathione-S-transferase omega -1; GST, glutathione-S-transferase; SNP, single nucleotide polymorphism; DMAV, dimethylarsinic acid; MMAIII, methylarsonous acid; DMAIII, dimethylarsinous acid; AsV, arsenate; AsIII, arsenite; PCR, polymerase chain reaction; E155del, deletion of glutamate 155.
10.1021/tx034149a CCC: $25.00 © 2003 American Chemical Society Published on Web 11/13/2003
1508 Chem. Res. Toxicol., Vol. 16, No. 12, 2003
Marnell et al.
Figure 1. Inorganic arsenic biotransformation.
are enzymes involved in the detoxification of many xenobiotics or electrophiles produced from the action of cytochrome P450-linked oxidases (12). Human GSTO1 has properties unlike those of other GSTs (9). The hGSTO1 gene is located on chromosome 10q24.3 and contains six exons and spans 12.5 kb (Figure 2) (13). To elucidate the possible reason for variability in the human response to inorganic arsenic, we have investigated the relationship between polymorphisms in the gene for human MMAV reductase/hGSTO1 and the urinary excretion of arsenic species. Several novel SNPs were discovered, and some already reported were verified. Also, two of the SNPs were associated with differences in the concentration of urinary arsenic species and therefore arsenic metabolism.
Experimental Procedures Subjects. Seventy-five subjects (39 females and 36 males) aged 18-75 years (average age of 36.1 years), living in the vicinity of Torreon, Mexico, were enrolled in this investigation. The localities and the arsenic content of their drinking water were Torreon Coahuila (9 µg/L), Ciudad Juarez Durango (17 µg/L), Viesca Coahuila (52 µg/L), and La Virgen Durango (100 µg/L). All subjects agreed to donate peripheral blood and urine samples for use in DNA and arsenic analysis, in accordance with the regulations of the Human Subjects Committee of the University of Arizona and the Bioethical Committee of the Faculty of Medicine, Juarez University of Durango. Subjects underwent a history and physical examination before enrollment in the study, and the physical examination was repeated the next morning. Participants were asked to exclude seafood from their diet for the preceding 3 days. Before the physical examination, each participant read and signed a consent form, which was written in Spanish. Subjects (i) with a history of chelation therapy; (ii) with a history of or current physical findings of serious renal or psychiatric disease; (iii) with a history of alcohol or recreational drug abuse; (iv) who had received any investigational drug during the preceding month before the initiation of this study; or (v) who had taken drugs with well-defined organ toxicity within the past 6 months were excluded. Subjects were transported by private bus to the General University Hospital of Torreon, where they stayed overnight (minus 11 to 0 h) during which time they fasted but were allowed to drink water brought with them from their homes or villages. Urine and Blood Collection. All collecting containers were soaked overnight in 2% nitric acid (Baker analyzed for trace metal analysis) (J. T. Baker, Inc., Phillipsburg, NJ) or washed
in 20% nitric acid and rinsed with water that had been double distilled and deionized. All plastic measuring and collecting equipment were similarly washed in Tucson, Arizona, sealed in bags, placed in locked footlockers, and transported by air to the site of the study at the same time as the investigators. Urine was collected in a 3 L polyethylene container (Baxter Laboratories, Inc., Morton Grove, IL), the volume was measured, and a 5 mL sample was removed and immediately frozen by placing in a portable icebox containing dry ice. Blood was collected by venous puncture in the morning after the physical exam, into vacutainers containing EDTA, and immediately frozen. The samples were kept frozen while being transported to Tucson where they were stored at -20 °C for less than 7 days before analysis. DNA Isolation. Genomic DNA was extracted from peripheral blood samples using the QIAamp kit (Qiagen, Valencia, CA). The DNA concentration was determined fluorometrically using the dsDNA quantitation dye, PicoGreen (Molecular Probes, Eugene, OR), and the samples were diluted with 10 mM TrisCl0.5 mM EDTA to a final concentration of 10 ng/µL and stored at -20 °C until use. Database Searching for SNPs. Publicly available databases were searched for SNPs in exons and flanking regions of hGSTO1. We did not find in our population the four SNPs that were found in the databases for the Laboratory of Population Genetics (http://lpg.nci.nih.gov) (GAI-CGAP 870703, 870704, 870707, 870710) and the five from the National Center for Biotechnology Information (Build 115, June, 2003) (http:// ncbi.nlm.nih.gov/SNP) (rs#629771, rs#1804834, rs#3211015, rs#15032, and rs#1045505). Other databases searched without finding additional SNPs were www.genome.UCSC.edu, www.genome.Utah.edu/genesnps, and the SNP Consortium (snp.cshl.org). PCR and Sequencing Primers for Identification and Detection of Sequence Variations. Primers for DNA amplification and sequencing were designed either by scanning manually or by using the primer selection software included in the GCG Wisconsin Package version 10.3 (Accelrys, Inc. San Diego, CA), based on the sequence of contig NT_030059 (http:// ncbi.nlm.nih.gov). The coding sequence was compared to Genbank accession number AF212303. PCR amplification of DNA from the exons and flanking regions was performed using pairs of primers (Table 1) that hybridize to intron sequence on either side of the hGSTO1 exons in order to avoid amplifying a processed pseudogene that occurs on chromosome 3 (13). Exons 1 and 2 were amplified together as one product and initially sequenced with those primers. They were then sequenced with internal primers to verify the results. Exon 4 was also sequenced in the forward direction with an internal primer. Sequencing
SNPs in Human MMAV Reductase
Chem. Res. Toxicol., Vol. 16, No. 12, 2003 1509
Table 1. Oligonucleotides Used for PCR and Sequencing region amplified exons 1, 2 exon 3 exon 4 exon 5 exon 6
forward
reverse
PCR Primer Sequences 5′ to 3′ ACCTACTTCCTGAATCCCC TGGAAGGAATCTAGGCAGAC CTAGAACACCTTGACACCAG CTCTCACCTGCTCTACTTATTTCC CTGTGATGTCATCCTAGTTG
CGGGCAAATCACTAACATCAC TCTCTCCCAAATCACTGAACC CCTTAAAGTGACTTGGAAAGTGG CTGCTTGTTCTCATTCAGACCAG CATGCAACCTGAACCTTGGT
Internal Sequencing Primer Sequences 5′ to 3′ exon 1 exon 2 exon 4
GGAGAAGCGAAGGCGATTA AATCGCCTTCGCTTCTCC GGCCGATACAGTTAGCCATA
of the other exons was done using the same primers as the amplification. PCR Amplification of Genomic DNA. Exonic DNA was amplified in separate reactions using the primer pairs described in Table 1. The reaction mixtures (35 µL) contained 14 ng of DNA, 0.25 µM each primer, 200 µM each deoxynucleoside triphosphate, 50 mM TrisCl, 10 mM KCl, 5 mM (NH4)2SO4, and 2 mM MgCl2 with 1.4 units of FastStart Taq DNA polymerase (Roche Applied Science, Mannheim, Germany). Amplification of exons 1, 2 required the addition of the reagent GC-RICH supplied with the kit (Roche Applied Science). PCR amplifications were performed in 96 well plates in a PTC-225 Peltier Thermal Cycler (MJ Research, Inc., Reno, NV) with an initial denaturation step of 5 min at 95 °C, followed by 30 cycles of 95 °C denaturation for 1 min, 50 °C annealing for 30 s (except exons 1, 2 and exon 3 were done at 55 °C for 1 min), 72 °C extension for 1 min, and a final extension step at 72 °C for 10 min. Identification and Genotyping of SNPs. The amplified DNA was purified, quantified, and sequenced by the University of Arizona Sequencing service on a ABI Prism 3700 DNA analyzer (Applied Biosystems, Foster City, CA) in both the forward and the reverse directions. Those samples identified to have variations from the consensus sequence were amplified and resequenced. Sequences were compared to each other using the program FAKtory (14) and compared to the contig sequence (NT_030059) in NCBI (http://ncbi.nlm.nih.gov). Statistics. Standard ANOVA showed highly significant association between the genotype and the percent of AsIII, AsV, DMAV, and total arsenic in the urine. However, this significance was caused by the contribution of only one or two individuals (nos. 44 and 47). Arsenic Analysis. An HPLC-ICP-MS speciation method (15) was modified for the measurement of arsenic. The HPLC system consisted of an Agilent 1100 HPLC (Agilent Technologies, Inc.) with a reverse-phase C18 column (Prodigy 3 µm ODS (3), 150 mm × 4.60 mm; Phenomenex, Torrance, CA). The mobile phase (pH 5.85) contained 4.7 mM tetrabutylammonium hydroxide, 2 mM malonic acid, and 4% (v/v) methanol at a flow rate of 1.2 mL/min. The column temperature was maintained at 50 °C. An Agilent 7500a ICP-MS with a Babington nebulizer was used as the detector. The operating parameters were as follows: Rf power, 1500 W; plasma gas flow, 15 L/min; carrier flow, 1.2 L/min; and arsenic was measured at 75 m/z. For total arsenic, an ASX500 autosampler (CETAC Technologies, Omaha, NE) was used to introduce the samples into the Agilent 7500a ICPMS. The operating parameters were as follows: Rf power, 1500 W; plasma gas flow, 15 L/min; and carrier flow, 1.2 L/min. The acquisition parameters were arsenic measured at m/z 75, terbium (IS) measured at m/z 159, points per peak were 3, dwell time for As was 1.5s, and the dwell time for Tb was 1.5 s. Seven repetitions were performed. Sample nos. 44 and 47 were repeated for verification. Creatinine Measurement. Creatinine determination in urine was determined using the Randox Creatinine Colorimetric Kit (San Diego, CA), which is based on the reaction of creatinine with picric acid in alkaline solution, forming a colored complex, measured at 492 nm (16).
Table 2. Polymorphisms Found in the Present Study sequence
context
effect
frequency
CCCGGC ggc/- ATGTTC ACGAGT c/g TGCCAT ACTATG c/a TGGCCT TAGAGG agg/- TAATTA TGACAG g/t TGGAAT TTCTTT a/t TAACAG CTGAGG c/t CTGTGA ATGAAG g/a AAGATC TCTGAA g/a GGGGCA
intron 1 exon 3 exon 4 exon 4 intron 5 intron 5 exon 6 exon 6 3′ UTR
noncoding Ser86Cys Ala140Asp E155del noncoding noncoding Ala236Val Glu208Lys noncoding
0.147 0.007 0.16 0.013 0.013 0.013 0.013 0.013 0.013
Results Identification of Four Novel Polymorphisms in the MMAV Reductase/hGSTO1 Gene. A search of publicly available databases provided a list of 11 SNPs in the exons and flanking regions of hGSTO1. However, in preliminary studies, we were only able to confirm two SNPs from the database and discovered one not previously identified. We, therefore, decided to use sequencing as the experimental approach to be certain that we identified all possible SNPs in our population. Sequencing of the PCR product encompassing exon 1, exon 2, and intron 1 showed a three base pair deletion (delGGC) in the first intron that had not been reported previously (Table 2). However, it does not occur in a position in the intron that would be predicted to affect splicing (17). We did not find any SNPs in exons 1 or 2, and none were present in the databases. One subject was heterozygous for a polymorphism in exon 3, with a C > G substitution that would result in a serine-to-cysteine change at amino acid 86 (Ser86Cys) (Table 2). No SNPs were found in exon 5, but we did discover two novel polymorphisms in intron 5 in two subjects, a G > T substitution and an A > T substitution (Table 2). We identified two novel polymorphisms in exon 6, each in two different subjects. One was a G > A substitution, resulting in a glutamate-to-lysine change at amino acid 208 (Glu208Lys), and the second was a C > T substitution resulting in an alanine-to-valine change (Ala236Val). Verification of SNPs Previously Reported for the MMAV Reductase/hGSTO1 Gene. Only two of the 11 SNPs described in the databases to be in exons and flanking regions were found. We identified SNP rs#4925, which results in an alanine-to-aspartate change in amino acid 140 of exon 4 (Ala140Asp), the only verified SNP reported in dbSNP that results in an amino acid change. In addition, we found SNP rs#7589 in the 3′-untranslated region of hGSTO1 in two of our subjects (Table 2). Two of our subjects were heterozygous for the polymorphism E155del (13), which results from a three base pair deletion at the end of exon 4, eliminating a glutamate
1510 Chem. Res. Toxicol., Vol. 16, No. 12, 2003
Marnell et al.
Figure 2. Map of hGSTO1. A gene map of hGSTO1 showing identified polymorphisms. Table 3. Genotypes Found in the Present Study genotype A B C D E F G H I
polymorphisms
n
no polymorphisms 50 heterozygous delGGC, heterozygous Ala140Asp 13 homozygous delGGC, homozygous Ala140Asp 4 no delGGC, heterozygous Ala140Asp 1 heterozygous G > A in 3′UTR, heterozygous 2 G > T, A > T in intron 5 heterozygous Ala236Val 2 heterozygous Ser86Cys in exon 3, 1 heterozygous Ala140Asp heterozygous E155del, heterozygous Glu208Lys 1 heterozygous delGGC, heterozygous Ala140Asp, 1 heterozygous E155del, heterozygous Glu208Lys
residue. These subjects also were heterozygous for the Glu208Lys variant, and one of the subjects was also heterozygous for Ala140Asp and delGGC. Because of the difficulty in sequencing past the deletion in heterozygotes, the PCR product from exon 4 was cloned in these subjects and verified by sequencing. Subject no. 47 had the E155del polymorphism on a different strand than Ala140Asp, so these SNPs are not linked in this individual despite their close proximity. Frequency of the SNPs in the MMAV Reductase/ hGSTO1 Gene. The frequency of delGGC, in the study population, was 0.147 (Table 3). It was linked to the Ala140Asp variant in all but two individuals who were heterozygous for Ala140Asp but did not have delGGC (linkage frequency of 0.92). We found that Ala140Asp occurs at a frequency of 0.16. The frequency of the other SNPs was very low (only one or two heterozygotes out of 75) (Table 2). Two subjects were heterozygous for the variants E155del and Glu208Lys; two were heterozygous for Ala236Val, and two were heterozygous for two SNPs in intron 5 and a G > A transition in the 3′-untranslated region. Influence of Genotype on Arsenic Levels in Urine. Scatterplots (Figure 3) of the individuals in each genotype vs urinary arsenic showed two genotypes, H and I, whose values were very different from the values of the other genotypes. Standard ANOVA showed that the association between genotypes H and I and the percentage of AsV and DMAV and genotype I with the percentage of AsIII in the urine was significant. These genotypes are represented by only one individual each. Genotype H (subject no. 44) had an abnormally high percentage of AsV in the urine (Figure 4), and genotype I (subject no. 47) had the
Table 4. Concentration of Arsenic Species in the Urine (µg/g Creatinine)a subject no.
AsV
AsIII
44 132.6 6.2 47 4.5 244.9 avg 100 µg/L 5.1 14.4 group avg all groups 7.91 16.02 a
MMAV MMAIII DMAV DMAIII 7.1 9.3 9.7
ND ND 0.18
14.1
0.43
29.7 114.2 54.5 81.17
ND ND ND ND
ND, not detected.
highest percentage as AsIII (Figure 4). These two subjects were from the 100 µg/L arsenic in drinking water group and also showed a low percentage of dimethylarsinate (DMAV) in their urine, when compared to either the rest of the group drinking 100 µg/L arsenic or the entire study population (Figure 4 and Table 4). It would appear that subject no. 44 had a reduced ability and subject no. 47 had an increased ability to reduce AsV. Both had decreased amounts of MMAV and DMAV arsenic in their urine. Interestingly, subject no. 47 is the mother of subject no. 44. They are the only subjects who have the variants E155del and Glu208Lys and are heterozygotes. In addition, subject no. 47 is heterozygous for the variants delGGC and Ala140Asp.
Discussion Variability in the Human Response to Arsenic. There is a large amount of literature dealing with the response of humans to chronic arsenic exposure as judged by urinary excretion of arsenic species such as inorganic arsenic, MMAV, and DMAV (3, 4). This has been expanded recently by the discovery (18) and confirmation of urinary MMAIII and DMAIII (19-23). It is reasonable to suggest that variability in response to chronic inorganic arsenic is due to genetic differences in the chemical metabolism (24, 25). Although there has been speculation about the involvement of methylation enzymes to explain these variations, MMAV reductase is another potential factor. We propose that differences in the MMAV reductase gene would be mainly, but not solely, responsible for such variation, since this enzyme is the rate-limiting part of the arsenic biotransformation pathway (8). This study shows that one genotype, E155del, Glu208Lys is associated with an inability to process inorganic AsV normally, and this is reflected by a large decrease in the percentage of methylated forms of arsenic in the urine. E155del is
SNPs in Human MMAV Reductase
Chem. Res. Toxicol., Vol. 16, No. 12, 2003 1511
Figure 4. Speciation of urinary arsenic as a percentage of total inorganic arsenic. Subject nos. 44 and 47 have the polymorphisms E155del and Glu208Lys and were from La Virgen Durango with 100 µg/L arsenic in their drinking water. Also included are the average of all the subjects from La Virgen and the average of all 75 subjects in the study population. Our analysis was unable to detect MMAIII and DMAIII.
Figure 3. Scatterplots of inorganic arsenic species by genotypes. Genotypes are defined in Table 3. (A-C) Circles represent the level of inorganic arsenic species as a percentage of total urinary arsenic for each subject. Lines represent the average value for groups of more than two individuals. (A) Percentage of AsV. (B) Percentage of AsIII. (C) Percentage of DMAV. MMAV is not shown because it did not show a significant association with a genotype.
at the exon-intron border and has the potential for missplicing and causing an aberrant message. However, Whitbread et al. (13) found no evidence of this, although they did not determine whether the polymorphic transcript produces a protein product in human cells. When expressed in Escherichia coli, the E155del polymorphism has been shown to result in a variant hGSTO1 with significantly higher activity toward 2-hydroxyethyl disulfide and 1-chloro-2,4-dinitrobenzene and to cause its thioltransferase activity to be more heat sensitive (13). The effect of the polymorphism on the arsenic methyla-
tion enzymes has not been tested as yet. Another possibility is that E155del and Glu208Lys are not directly causing the change in arsenic metabolism but are linked to another causative genetic variant. It is noteworthy that there are at least two known enzymatic mechanisms for the reduction of AsV to AsIII: purine nucleoside phosphorylase (26-28) and MMAV reductase (8, 29). The relevance of the former, based on human erythrocyte and rat studies, to arsenic metabolism has been questioned recently (30); MMAV reductase, however, can reduce AsV, MMAV, and DMAV (8). Accordingly, E155del and Glu208Lys may be affecting AsV, MMAV, and DMAV reduction. hGSTO1 SNPs. We were able to identify six novel polymorphisms because we did not limit our investigation to the predicted SNPs in the public databases. The first polymorphism, delGGC, is a three base pair deletion in intron 1 that is linked to the Ala140Asp variant in exon 4. Ser86Cys is another novel polymorphism that we identified. Serine 86 was predicted in the hGSTO1 crystal structure to be involved in hydrogen bonding to glutathione (9) and, therefore, might have an effect on enzyme activity. We did not observe a difference in urinary arsenic species in the one individual with this polymorphism, possibly because he was heterozygous for this SNP. Whitbread et al. (13) showed that the Ala140Asp variant of hGSTO1 occurred at a frequency of 0.335 in 100 Australian, 0.165 in 100 Chinese, and 0.081 in 62 African subjects. In our Mexican population, the frequency was 0.162, similar to that of their Chinese population. The original report on this SNP found it to occur at a frequency of 0.118 (Japanese JSNP database (snp.ims.u-tokyo.ac.jp)). Although we did not undertake a formal analysis of ethnicity (which is highly problematic for populations in northern Mexico), we are aware that the Torreon population has in general mixed ancestry of Western European and Amerindian origins (31). Whitbread et al. (13) also identified a novel three base pair deletion at the end of exon 4 that occurred at a low
1512 Chem. Res. Toxicol., Vol. 16, No. 12, 2003
frequency (0.032). We found this polymorphism in two of our subjects (allele frequency of 0.013), who also were the only ones with the novel SNP Glu208Lys. It is also important to evaluate phenotype in connection with identified SNPs. When recombinant Ala140Asp was tested for MMAV reductase activity, it was shown to have similar kinetics to the protein encoded by wild-type gene (32). This group (32) also showed that a polymorphism (Thr217Asn) resulted in lowered MMAV reductase activity. However, although Thr217Asn is predicted in the dbSNP database, it was not identified in the populations studied by either us or Whitbread et al. (13). Until this polymorphism is reported in a human population, the significance of its effect, if any, on enzyme activity cannot be determined. On the basis of such studies, the relationship of any SNPs in hGSTO1 with the signs of chronic arsenic exposure such as keratosis, hyperpigmentation, and cancer can rationally be investigated in larger epidemiological studies of populations exposed to arsenic in drinking water. In this work, we have shown that two subjects with the genotype, E155del, Glu208Lys, cannot process inorganic AsV normally. One has the phenotype of a block in the reduction of AsV to AsIII, while the other has the phenotype of AsIII accumulation. Additionally, the effect of these changes on MMAV reductase activity needs to be tested by site-directed mutagenesis to make recombinant human hGSTO1 containing the Glu208Lys polymorphism alone and in conjunction with E155del for expression in E. coli and testing for the ability to reduce AsV, MMAV, and DMAV. This can strengthen our hypothesis that these SNPs can be a major cause of the abnormal urinary arsenic profiles found in the humans in this study.
Acknowledgment. This work was supported in part by the Superfund Basic Research Program NIEHS Grant No. ES-04940 from the National Institute of Environmental Health Sciences and the Southwest Environmental Health Sciences Center P30-ES-06694. We thank Dr. Philip Board for his reading of this document and constructive criticism. Note Added in Proof. A recent paper may be of interest: Yu, L., Kalla, K., Guthrie, E., Vidrine, A., and Klimecki, W. T. (2003) Genetic variation in genes associated with arsenic metabolism: glutathione S-transferase omega 1-1 and purine nucleoside phosphorylase polymorphisms in European and indigenous Americans. Environ. Health Perspect. 111, 1421-1427.
References (1) Nordstrom, D. K. (2002) Worldwide Occurrences of Arsenic in Groundwater. Science 296, 2143-2145. (2) Chakraborti, D., Mohammed, M. R., Paul, K., Chowdhury, U. K., Sengupta, M. K., Lodh, D., Chanda, C. R., Saha, K. C., and Mukherjee, S. C. (2002) Arsenic calamity in the Indian subcontinent. What lessons have been learned? Talanta 58, 3-22. (3) National Research Council (1999) Arsenic in Drinking Water, National Academy Press, Washington, DC. (4) Subcommitte to update the 1999 arsenic in drinking water report, Committee on Toxicology, Board on Environmental Studies and Toxicology, National Research Council (2001) Arsenic in Drinking Water: 2001 Update, National Academy Press, Washington, DC. (5) Chappell, W. R., Abernathy, C. O., and Calderon, R. L., Eds. (1998) Arsenic exposure and health effects. In Proceedings of the Third International Conference on Arsenic Exposure and Health Effects, Elsevier Science Ltd., Oxford.
Marnell et al. (6) Wu, H. Y., and Chen, K. P. (1961) Epidemiologic studies on blackfoot disease. 1. Prevalence and incidence of disease by age, sex, year, population, and geographic distribution. Mem. Coll. Med. Natl. Taiwan Univ. 7, 33. (7) Wang, S. L., Chiou, J. M., Chen, C.-J., Tseng, C. H., Chou, W. L., Wang, C. C., Wu, T. N., and Chang, L. W. (2003) Prevalence of noninsulin-dependent diabetes mellitus and related vascular diseases in southwestern arseniasis-endemic and nonendemic areas in Taiwan. Environ. Health Perspect. 111, 155-159. (8) Zakharyan, R. A., and Aposhian, H. V. (1999) Enzymatic reduction of arsenic compounds in mammalian systems: the rate-limiting enzyme of rabbit liver arsenic biotransformation is MMAV reductase. Chem. Res. Toxicol. 12, 1278-1283. (9) Board, P. G., Coggan, M., Chelvanayagam, G., Easteal, S., Jermiin, L. S., Schulte, G. K., Danley, D. E., Hoth, L. R., Griffor, M. C., Kamath, A. V., Rosner, M. H., Chrunyk, B. A., Perregaux, D. E., Gabel, C. A., Geoghegan, K. F., and Pandit, J. (2000) Identification, characterization, and crystal structure of the omega class glutathione transferases. J. Biol. Chem. 275, 24798-24806. (10) Zakharyan, R. A., Sampayo-Reyes, A., Healy, S. M., Tsaprailis, G., Board, P. G., Liebler, D. C., and Aposhian, H. V. (2001) Human monomethylarsonic acid (MMAV) reductase is a member of the glutathione-S-transferase superfamily. Chem. Res. Toxicol. 14, 1051-1057. (11) Hayes, J. D., and Strange, R. C. (2000) Glutathione S-transferase polymorphisms and their biological consequences. Pharmacology 61, 154-166. (12) Salinas, A. E., and Wong, M. G. (1999) Glutathione S-transferase. Curr. Med. Chem. 6, 279-309. (13) Whitbread, A. K., Tetlow, N., Eyre, H. J., Sutherland, G. R., and Board, P. G. (2003) Characterization of the human omega class glutathione transferase genes and associated polymorphisms. Pharmacogenetics 13, 131-144. (14) Miller, S., and Myers, E. (1999) The FAKtory DNA Sequence Fragment Assembly System. http://www.cs.arizona.edu/research/ reports.html. (15) Gong, Z., Le, X., Cullen, W. R., and Le, X. C. (2001) Unstable trivalent arsenic metabolites, monomethylarsonous acid and dimethylarsinous acid. J. Anal. Spectrosc. 16, 1409-1413. (16) Bartels, H., Bahmer, M., and Heierli, C. (1972) Serum creatinine determination without protein precipitation. Clin. Chem. Acta 37, 193-197. (17) Rogan, P. K., and Schneider, T. D. (1995) Using information content and base frequencies to distinquish mutations from genetic polymorphisms in splice junction recognition sites. Hum. Mutat. 6, 74-76. (18) Aposhian, H. V., Gurzau, E. S., Le, X. C., Gurzau, A., Healy, S. M., Lu, X., Ma, M., Yip, L., Zakharyan, R. A., Maiorino, R. M., Dart, R. C., Tircus, M. G., Gonzalez-Ramirez, D., Morgan, D. L., Avram, D., and Aposhian, H. V. (2000) Occurrence of monomethylarsonous acid in urine of humans exposed to inorganic arsenic. Chem. Res. Toxicol. 13, 693-697. (19) Aposhian, H. V., Zheng, B., Aposhian, M. M., Le, X. C., Cebrian, M. E., Cullen, W. R., Zakharyan, R. A., Ma, M., Dart, R. C., Cheng, Z., Andrews, P., Yip, L., O’Malley, G. F., Maiorino, R. M., Van Voorhies, W., Healy, S. M., and Titcomb, A. (2000) DMPS-arsenic challenge test: II. Modulation of arsenic species, including monomethylarsonous acid (MMAIII), excreted in human urine. Toxicol. Appl. Pharmacol. 165, 74-83. (20) Le, X. C., Lu, X., Ma, M., Cullen, W. R., Aposhian, H. V., and Zheng, B. (2000) Speciation of Key Arsenic Metabolic Intermediates in Human Urine. Anal. Chem. 72, 5172-5177. (21) Le, X. C., Ma, M., Lu, X., Cullen, W. R., Aposhian, H. V., and Zheng, B. (2000) Determination of monomethylarsonous acid, a key arsenic methylation intermediate, in human urine. Environ. Health Perspect. 108, 1015-1018. (22) Del Razo, L. M., Styblo, M., Cullen, W. R., and Thomas, D. J. (2001) Determination of Trivalent Methylated Arsenicals in Biological Matrixes. Toxicol. Appl. Pharmacol. 174, 282-293. (23) Mandal, B. K., Ogra, Y., and Suzuki, K. T. (2001) Identification of dimethylarsinous and monomethylarsonous acids in human urine of the arsenic-affected areas in West Bengal, India. Chem. Res. Toxicol. 14, 371-378. (24) Loffredo, C. A., Aposhian, H. V., Cebrian, M. E., Yamauchi, H., and Silbergeld, E. K. (2003) Variability in human metabolism of arsenic. Environ. Res. 92, 85-91. (25) Vahter, M. (2000) Genetic polymorphism in the biotransformation of inorganic arsenic and its role in toxicity. Toxicol. Lett. 112113, 209-217. (26) Radabaugh, T. R., and Aposhian, H. V. (2000) Enzymatic reduction of arsenic compounds in mammalian systems: Reduction of arsenate to arsenite by human liver arsenate reductase. Chem. Res. Toxicol. 13, 26-30.
SNPs in Human MMAV Reductase (27) Radabaugh, T. R., Sampayo-Reyes, A., Zakharyan, R. A., and Aposhian, H. V. (2002) Arsenate Reductase II. Purine Nucleoside Phosphorylase in the Presence of Dihydrolipoic Acid Is a Route for Reduction of Arsenate to Arsenite in Mammalian Systems. Chem. Res. Toxicol. 15, 692-698. (28) Gregus, Z., and Ne´meti, B. (2002) Purine Nucleoside Phosphorylase as a Cytosolic Arsenate Reductase. Toxicol. Sci. 70, 13-19. (29) Aposhian, H. V., Zakharyan, R. A., Healy, S. M., Wildfang, E., Petrick, J. S., Sampayo-Reyes, A., Board, P. G., Carter, D. E., Guha Muzumder, D. N., and Aposhian, M. M. Enzymology and toxicity of inorganic arsenic. In Arsenic Exposure and Health Effects (Chappell, W. R., Abernathy, C. O., and Calderon, R. L., Eds.) In press, Elsevier Science, Ltd., St. Louis, MO.
Chem. Res. Toxicol., Vol. 16, No. 12, 2003 1513 (30) Ne´meti, B., Csanaky, I., and Gregus, Z. (2003) Arsenate reduction in human erythrocytes and rats. Testing the role of purine nucleoside phosphorylase. Toxicol. Sci. 74, 22-31. (31) Cerda-Flores, R. M., Budowle, B., Jin, L., Barton, S. A., Deka, R., and Chakraborty, R. (2002) Maximum likelihood estimates of admixture in northeastern Mexico using 13 short tandom repeat loci. Am. J. Hum. Biol. 14, 429-439. (32) Tanaka-Kagawa, T. (2003) Functional characterization of two variant human GSTO 1-1s (Ala140Asp and Thr217Asn). Biochem. Biophys. Res. Commun. 301, 516-520.
TX034149A
