Preparation of a Single-Chain Variable Fragment ... - ACS Publications

Preparation of a Single-Chain Variable Fragment and a Recombinant Antigen-Binding Fragment against the Anti-Malarial Drugs, Artemisinin and Artesunate...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/ac

Preparation of a Single-Chain Variable Fragment and a Recombinant Antigen-Binding Fragment against the Anti-Malarial Drugs, Artemisinin and Artesunate, and Their Application in an ELISA Madan K. Paudel,† Ayako Takei,† Junichi Sakoda,† Thaweesak Juengwatanatrakul,§ Kaori Sasaki-Tabata,† Waraporn Putalun,‡ Yukihiro Shoyama, ∥ Hiroyuki Tanaka,*,† and Satoshi Morimoto† †

Department of Pharmacognosy, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka 812-8582, Japan Faculty of Pharmaceutical Sciences, Khon Kaen University, Khon Kaen, 40002, Thailand § Faculty of Pharmaceutical Sciences, Ubon Ratchathani University, Ubon Ratchathani, 34190, Thailand ∥ Faculty of Pharmaceutical Sciences, Nagasaki International University, Huis Ten Bosch 2825-7, Sasebo, Nagasaki 859-3298, Japan ‡

ABSTRACT: Two different recombinant antibodies, a single-chain variable fragment (scFv) and an antigen-binding fragment (Fab), were prepared against artemisinin (AM) and artesunate (AS) and were developed for use in an enzymelinked immunosorbent assay (ELISA). The recombinant antibodies, which were derived from a single monoclonal antibody against AM and AS (mAb 1C1) prepared by us, were expressed by Escherichia coli cells and their reactivity and specificity were characterized. As a result, to obtain sufficient signal in indirect ELISA, a much greater amount of a first antibody was needed in the use of scFv due to the differences of the secondary antibody and conformational stability. Therefore, we focused on the development of the recombinant Fab antibodies and applied it to indirect competitive ELISA. The specificity of the Fab was similar to that of mAb 1C1 in that it showed specific reactivity toward AM and AS only. The sensitivity of the icELISA (0.16 μg/mL to 40 μg/mL for AM and 8.0 ng/mL to 60 ng/mL for AS) was sufficient for analysis of antimalarial drugs, and its utility for quality control of analysis of Artemisia spp. was validated. The Fab expression and refolding systems provided a good yield of high-quality antibodies. The recombinant antibody against AM and AS provides an essential component of an economically attractive immunoassay and will be useful in other immunochemical applications for the analysis and purification of antimalarial drugs.

M

alaria is a devastating disease and presents a health threat across the globe, particularly in sub-Saharan Africa and South-East Asia. The number of deaths due to malaria is estimated to be 781 000 in 2009 from the World Malaria Report 2010. International funding for malaria control has risen steeply in the past decades and reached U.S. $18 billion in 2010. Artemisinin (AM), which is a sesquiterpene lactone, is a wellknown antimalarial compound isolated from Artemisia annua.1−3 Currently, AM and its related compounds (Figure 1), artesunate (AS) and artemether, are the most important drugs for the treatment of malaria and are used in artemisininbased combination therapies (ACTs) recommended by the World Health Organization.4−8 The number of patients receiving an ACT treatment course reached 158 million in 2009, and the cultivation of A. annua and production of artemisinin have expanded in line with the increase in the global demand for ACTs. ACT first-line treatments are 4−22 times more expensive than the most commonly dispensed drug, which is not based on AM. Because analogues of AM, as a class, show the highest efficacy toward the prevention of malaria epidemics, several synthetic organic chemistry and chemical biology groups have undertaken a program to develop a © 2012 American Chemical Society

Figure 1. Structures of artemisinin (AM) and artesunate (AS).

scalable synthetic approach to preparing AM; however, these programs have not yet devised a practicable AM supply system.9−11 The demand for AM may at present be better met by isolating the compounds from natural sources, such as A. annua. Received: November 24, 2011 Accepted: January 18, 2012 Published: January 18, 2012 2002

dx.doi.org/10.1021/ac203131f | Anal. Chem. 2012, 84, 2002−2008

Analytical Chemistry

Article

Table 1. List of Primers Used for Amplification of Anti-AM Recombinant Antibodiesa primer VH-for-BamHI VH-rev-linker VL-for-linker VL-rev-SalI VH−CH1-for-EcoRI VH−CH1-rev-SalI VL-CL-for-EcoRI VL-CL-rev-SalI a

sequence (5′ to 3′) AM-scFv CGCGGATCCCAGGTTCAGCTGCAGCAG GGAGCCGCCGCCGCCTGAACCACCACCACC AGAGACAGTGACCAGAGT GGCGGCGGCGGCTCCGGTGGTGGTGGTTCAGATATTGTGATGACGCAG CGCGTCGACCTA TCGTTTGATTTCCAGCTT AM-Fab CGCGAATTCCAGGTCCAGCTCCAGCAGTCTGGA AGCTTTGTCGACCTAACAATCCCTGGGCACAAT TTT CGCGAATTCATTGTGATGACTCAGGCTGCATTCTCCAAT AGCTTTGTCGACCTAACACTCATTCCTGTTGAAGCTCTTGAC

The restriction sites are underlined, and italicized letters indicate the linker coding sequences.

In addition to its antimalarial properties, AM is of interest for its anticancer effects in vitro and in vivo.12 Recent studies have shed light on the mechanism underlying the anticancer activities of AM, and synthetic approaches to preparing AM derivatives that display better efficacy and tolerability profiles have been conducted by several groups.13−20 The expanded medicinal applications of AM-related compounds may increase the demand for AM in the future. The efficient production of AM from good quality A. annua and the appropriate use of AMrelated compounds is one practical strategy for alleviating the economic burden to patients and society. We have developed quality control methods for preparing AM from an Artemisia spp. selected for its ability to produce high yields of AM. Because AM and its structurally related compounds do not absorb the UV or display fluorescence, previous quality control methods have involved derivatizing the compounds in acidic or basic solutions for analysis using conventional thin layer chromatography (TLC) or highperformance liquid chromatography (HPLC) techniques.21−26 Recently, a liquid chromatographic tandem mass spectroscopy method for the quantification of AM was developed and was found to provide a more sensitive quantitative analysis.27−29 Immunoassays would be much more convenient and could enable the rapid analysis of multiple samples.30−38 Some research groups have pursued development of immunochemical approaches by designing a convenient indirect competitive enzyme-linked immunosorbent assay (icELISA) using polyclonal antibodies or monoclonal antibodies for the analysis of AM and its related compounds.39−42 We prepared a monoclonal antibody (mAb 1C1) showing specificity for AM and AS, and we developed an icELISA using this novel mAb.43 The immunoassay was demonstrated to yield analysis results for multiple samples in a short period of time using simple and reliable protocols. However, the yield of the mAb 1C1 was insufficient due to the low production characteristics of the hybridoma. This has hindered the facile application of the novel antibody to various immunochemical experiments. This report describes the preparation of a recombinant antibody derived from the mAb 1C1 to overcome the insufficient production of the mAb using a hybridoma culture. A single-chain variable fragment, which consisted of the Ig heavy chain (IgH) and light (IgL) variable regions with a flexible peptide linker and a recombinant antigen-binding fragment (Fab), were easily constructed using antibody manipulation technologies and were produced by microorganisms in high yield.

In this report, we constructed and characterized two types of recombinant antibody against AM and AS, and we evaluated their utility in an enzyme-linked immunosorbent assay (ELISA) for the detection of AM-related compounds produced in an Artemisia spp. culture.

■

MATERIALS AND METHODS Reagents and Standards. Artemisinin (AM) and artesunate (AS) were purchased from Sigma-Aldrich (St. Louis, MO). Human serum albumin (HSA) and bovine serum albumin (BSA) were also provided by Sigma-Aldrich. The peroxidase-labeled antimouse Fab antibody was purchased from MP Biomedical (Solon, OH). The T7-Tag horseradish peroxidase (HRP) conjugate was obtained from Novagen (San Diego, CA). The DNA polymerase and DNA restriction enzymes were purchased from Takara (Kyoto, Japan). All other chemicals were standard commercial analytical-grade reagents. Cloning and Sequencing of Genes Encoding scFv and a Recombinant Fab against AM and AS. The total RNA (5 μg) was extracted from 3 × 106 hybridoma cells (1C1) using the Sepasol RNA I super reagent (Nacalai Tesque Inc., Kyoto, Japan) according to the manufacturer’s instructions. Firststrand cDNA was synthesized using random hexamer primers (Amersham Biosciences, Buckinghamshire, U.K.). The VH and VL genes were amplified by polymerase chain reaction (PCR) using established antibody-specific primers,44 and the PCR products were cloned into a pGEM-T Easy vector (Promega Co., Madison, WI). After transformation of E. coli JM109 cells with this ligation mixture, plasmid inserts were directly screened from E. coli colonies. The plasmids in about 10 positive colonies were purified, and each insert was sequenced to select for a plasmid having the correct VH and VL genes. The genes encoding VH and VL domains were assembled and linked together by splicing by overlapping extension-PCR (SOE-PCR) to yield a full-length scFv gene that encoded a VHlinker-VL format with the standard 15 amino acid linker (Gly4Ser)3. Then, the scFv gene with the correct sequence was subcloned into a pET28a(+) expression vector (Novagen, Merck KGaA, Darmstadt, Germany) to generate a pET28a/ scFv construct. The resulting construct, which directed the synthesis of the recombinant AM-scFv with N-terminal hexahistidine and T7 tags, was transformed into E. coli BL21 (DE3) cells. The VH- and VL- specific primers for the construction of AM-scFv were listed in Table 1. The amplification of VH-CH1 and VL-CL genes and the construction of each construct, pET28/VH-CH1 and pET28/ VL-CL, were performed using essentially the same approach as was used to prepare the AM-scFv. The primers for 2003

dx.doi.org/10.1021/ac203131f | Anal. Chem. 2012, 84, 2002−2008

Analytical Chemistry

Article

with various concentrations of scFv or Fab solutions in SPBS. The plate was then washed three times with TPBS, and the scFv was combined with 100 μL of a 5 000× diluted solution of T7-Tag HRP conjugate antibodies (Novagen) for 1 h. In the case of the Fab antibody, the Fab was combined with 100 μL of a 1 000× diluted solution of HRP-conjugated antimouse Fab antibodies (Sigma-Aldrich). After washing the plate three times with TPBS, 100 μL of a substrate solution (0.3 mg of ABTS in 100 mM citrate buffer (pH 4) containing 0.003% (v/v) H2O2) was added to each well and incubated for 15 min. The absorbance at 405 nm was measured using a microplate reader (Immuno Mini NJ-2300). All reactions were carried out at 37 °C. Plant Materials and Sample Preparation. Artemisia annua was collected from the herbal garden of the Faculty of Pharmaceutical Sciences, Khon Kaen University. Samples of other Artemisia spp. were purchased from the market in Japan. They were dried and ground into powders, then extracted with MeOH (0.5 mL) using an ultrasonic bath for 10 min. After centrifugation of the samples, the supernatant was transferred to a tube. This extraction step was repeated three times. After the extracted solutions had been concentrated in vacuo, the extract was dissolved in a small amount of MeOH and diluted appropriately to give 20% MeOH solutions for icELISA. icELISA Using Fab against AM and AS. AS-OVA (1 μg/ mL) dissolved in 50 mM carbonate buffer (pH 9.6) was adsorbed to the wells of a 96-well immunoplate. The plate was treated with 300 μL of S-PBS for 1 h to reduce nonspecific adsorption. Aliquots (50 μL) of various concentrations of AM or sample solutions dissolved in 20% MeOH were incubated with 50 μL of AM-Fab solution (5 μg/mL) in SPBS for 1 h. The plate was washed three times with TPBS, then incubated with 100 μL of a 1000× diluted HRP-labeled antimouse Fab antibody solution for 1 h. After washing the plate three times with TPBS, 100 μL of the ABTS solution were added to each well and incubated for 15 min. The absorbance at 405 nm was measured using a microplate reader. All reactions were carried out at 37 °C.

amplification of VH-CH1 and VL-CL (a light chain) were listed in Table 1. Expression of the Recombinant Antibodies against AM and AS. Cells harboring each construct were cultured in Luria−Bertani (LB) broth medium (1 L) containing 50 μg/mL kanamycin. When the optical density of the culture at 660 nm reached 0.6, isopropyl-β-D-thiogalactoside (IPTG) (0.5 mM) was added to the culture to induce recombinant protein expression. After incubation at 37 °C for 12 h, the cells were harvested by centrifugation, resuspended in 50 mL of 20 mM phosphate buffer (PB) (pH 8.2) containing 0.5 M NaCl, and lysed by hen egg lysozyme (1 mg/mL). The lysate was disrupted by sonication, then centrifuged at 9 000g for 20 min to prepare soluble and insoluble fractions. The insoluble fractions were dissolved in buffer A (20 mM PB containing 8 M urea and 0.5 M NaCl) and applied to a column (1.0 cm × 5.0 cm) containing His-bind resin (Novagen) equilibrated with buffer A. After sample application, nonspecifically bound proteins were removed with 100 mL of buffer A containing 20 mM imidazole. Then, hexahistidinetagged recombinant antibodies were eluted with 100 mL of buffer A containing 500 mM imidazole. The above purification protocol was performed a second time, and the purity of each recombinant protein was verified by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) analysis.45 Refolding of the Recombinant Antibodies against AM and AS. The scFv was solubilized in buffer B (20 mM PB (pH 8.2), 200 mM NaCl, and 1 mM EDTA) containing 8 M urea and refolded following the methods of Umetsu et al. with slight modification.46 In brief, the solubilized scFv protein (300 μg/ mL) was reduced by addition of β-mercaptoethanol (β-ME) (600 μM). Then, the scFv was refolded by gradual removal of urea via stepwise dialysis against buffer B containing urea (8, 6, 4, 2, 1, 0.5, 0.25, 0.125, and 0 M) and phosphate buffered saline (PBS). At the 2−0.125 M urea stages, 400 mM L-arginine and 600 μM reduced and oxidized glutathione were added to facilitate the formation of disulfide bonds. After stepwise dialysis, the refolded scFv solution was centrifuged at 9 000g for 20 min at 4 °C to remove aggregated proteins and was used for the ELISA assays as AM-scFv. To refold AM-Fab, a mixture of VH1-CH1 and VL-CL solutions in buffer B (300 μg/mL) was reduced with β-ME and the solution was applied to the stepwise dialysis described above. The refolded Fab was analyzed by nonreducing SDSPAGE. Preparation of Hapten−Protein Conjugates. The ASovalbumin (AS-OVA) conjugate was synthesized as described previously.31 1-Ethyl-3-(3′-dimethylaminopropyl)-carbodiimide hydrochloride (EDC; 6 mg) was added to a mixture of ovalbumin (3 mg) and AS (6 mg), and the reaction mixture was stirred at room temperature for 6 h. The mixture was then dialyzed against five changes of H2O at 4 °C and lyophilized to yield 3.2 mg of AS-OVA conjugate, which was used as a coating antigen in the ELISA. Indirect ELISA Using scFv and Fab against AM and AS. The reactivities of the refolded recombinant antibodies were determined by indirect ELISA. A 96-well immunoplate (Nunc, Roskilde, Denmark) was coated with 100 μL of AM-OVA (1 μg/mL) conjugates in carbonate buffer (pH 9.6) and incubated at 37 °C for 1 h. The plate was washed three times with PBS containing 0.05% (v/v) Tween 20 (TPBS) and then treated with 300 μL of PBS containing 5% (w/v) skim milk (SPBS) for 1 h to reduce nonspecific adsorption. The plate was incubated

■

RESULTS AND DISCUSSION Cloning and Sequencing of cDNAs Encoding the scFv and Fab against AM and AS. The VH and VL fragment genes were amplified by PCR using cDNA from the hybridoma cell line 1C1, which secreted a monoclonal antibody (mAb) against AM and AS. Both genes were successfully amplified, and their sequences were analyzed. Variations were identified in 6 and 5 sequences of, respectively, the VH and VL genes among the 10 samples. The amino acid sequences were aligned to determine the genes encoding the VH and VL fragments by reference to the N and C termini of each fragment and the complementarity-determining region (CDR) using the Kabat and Chothia numbering scheme (http://www.bioinf.org.uk/ abs). Plausible genes encoding the VH and VL fragments of the anti-AM mAb 1C1 were identified, as shown in Figure 2. These genes were then assembled by SOE-PCR to construct a gene encoding a single chain variable fragment (scFv) with a flexible linker (Gly4Ser)3 and restriction enzyme sites at both ends (Bam H I and SalI). The assembled scFv gene was digested with the restriction enzymes and inserted into the pET28a(+) vector. Analysis of the nucleic acid sequence of the constructed scFv gene on the plasmid vector revealed the presence of 729 bp encoding 243 amino acids including the (Gly4Ser)3 linker, as expected. 2004

dx.doi.org/10.1021/ac203131f | Anal. Chem. 2012, 84, 2002−2008

Analytical Chemistry

Article

Bacterial expression of VH1-CH1 and VL-CL were performed, and overexpressed proteins formed inclusion bodies. They were purified using an approach similar to that used for scFv from an inclusion body and were obtained in excellent yields, 19 mg per 1 L of culture and 18 mg per 1 L of culture, respectively. A molecular weight of 27 kDa was determined by 12.5% SDS-PAGE in Figure 3B (lanes 2 and 3), which was very close to the theoretical values (27 305 Da for the VH1-CH1 and 27 979 Da for the VL-CL, respectively) predicted for each fragment with the tags. Refolding and Reactivity Tests of scFv and Fab against AM and AS. Because the purified recombinant antibodies were purified in inactive forms, refolding was required to enable antigen recognition. We employed the efficient refolding method developed by Umetsu et al.,46 which is removal of the solubilizing agent by stepwise dialysis. Each recombinant antibody fragment, which did not have a correct high-order structure, was treated with β-ME in urea solution to cleave disulfide bonds and dialyzed against gradual tapering urea solutions. In the process of the dialysis, it is presumed that intramolecular hydrogen bonds are formed correctly and hydrophobic interactions and van der Waals forces go on to facilitate their folding. At the 2−0.125 M urea stages, L-arginine was supplemented as a solubilizing agent and reduced and oxidized glutathione were added to facilitate the formation of intra- and intermolecular disulfide bonds. Figure 3B (lane 4) shows the results of nonreducing SDS-PAGE analysis of the refolded Fab, in which only one band was observed. The results reveal that each supplement played a role in line with expectations and disulfide bonds formed during refolding of the Fab, and regeneration of the binding capabilities were expected. The sample was dialyzed to refold the scFv and Fab, and their reactivities were evaluated by indirect ELISA using an AS-OVA conjugate as the antigen. The validation study by indirect ELISA indicated that both recombinant antibodies recognized the AS-OVA conjugate, and the optical density (OD) increased in a concentration-dependent manner, as shown in Figure 4. The OD values for the two recombinant

Figure 2. Deduced amino acid sequences of VH and VL regions of anti-AM recombinant antibodies.

The cDNAs encoding the VH-CH1 and VL-CL fragments of the anti-AM mAb were amplified using two sets of specific primers containing an appropriate restriction site. Both cDNAs were cloned successfully in this way. Both VH-CH1 and VL-CL genes consisted of 654 bp, and each fragment was completely consistent with the corresponding variable regions and constant regions of the IgG1 and a κ light chain of the anti-AM mAb, respectively, as determined by sequence analyses. The two cDNAs were inserted into a pET28a(+) vector for expression and characterization of the Fab against AM and AS. Bacterial Expression and Purification of scFv and Fab against AM and AS. Escherichia coli BL21 (DE3) was transformed using the construct scFv/pET28a(+), and the scFv was induced by addition of IPTG. SDS analysis of a recombinant protein in E. coli demonstrated that the scFv was expressed in the insoluble fraction and showed a molecular mass of 29 kDa, which agreed with the theoretical value for scFv with the tags (29 620 Da), as shown in Figure 3A. The

Figure 3. SDS-PAGE analysis of recombinant antibodies against AM and AS. (A) Analysis of the scFv: lane 1, marker proteins; lane 2, total protein before IPTG induction; lane 3, total protein after IPTG induction; lane 4, soluble fraction, lane 5, insoluble fraction; lane 6, purified scFv. (B) Analysis of the Fab: lane 1, marker proteins; lane 2, purified VH-CH1; lane 3, VL-CL; lane 4, refolded Fab (nonreducing SDS-PAGE).

Figure 4. Reactivities of scFv and Fab against AM and AS in a direct ELISA using AS-OVA as a solid-phase antigen. The 96-well immunoplate precoated with 1 μg/mL AS-OVA was treated with various concentrations of each recombinant antibody. Then, the PODlabeled anti-T7 Tag antibody for the scFv or the anti-mouse Fab antibody for recombinant Fab were used as secondary antibodies to label the antigen-antibody complex. A plot of the absorbance at 405 nm versus AM concentration determined the signal intensity in each immunoassay.

scFv with an N-terminal hexahistidine tag expressed in the insoluble fraction was resolved in an 8 M urea solution and was purified by metal chelate affinity chromatography. Affinity purification provided the scFv in high purity and large quantities (13 mg per 1 L of culture medium). 2005

dx.doi.org/10.1021/ac203131f | Anal. Chem. 2012, 84, 2002−2008

Analytical Chemistry

Article

Figure 5. Standard curves for the inhibition by AM and AS (A) and calibration curve for the inhibition by AM (B) in an indirect competitive ELISA using the recombinant Fab. Various concentrations of AM and AS were incubated with the recombinant Fab (5 μg/mL) against AM and AS in a 96well immunoplate precoated with AS-OVA (1 μg/mL). A0 is the absorbance with no AM present, and A is the absorbance with AM present.

antibodies in the ELISA differed significantly. The Fab provided a higher signal intensity than the scFv, which produced a signal insufficient for use in an ELISA, even at 30 μg/mL. This result may reveal that the recombinant Fab can form the same and stable antigen recognition sites as the MA and shows a slightly higher affinity toward the antigens over the scFv. Whereas it must not be easy to stabilize the VH-VL interdomain interaction in the scFV and configure each complementarity determining region properly because there is no presence of interchain disulfide bridge between VH and VL. In addition, we used different secondary antibodies in the ELISA, against the T7tag and the mouse Fab fragment, to label the antibodyantigen complex with a peroxidase. The difference between the signal intensities of the ELISA systems was also attributed to the characteristics of the secondary antibodies. The assay using the Fab was advantageous compared to the scFv assay in terms of reactive properties, costs, and performance. Therefore, we focused on the development and evaluation of an icELISA using the Fab for application toward analysis of AM-related compounds. Development of icELISA Using a Fab against AM and AS. To develop analytical methods for use during production of the AM-related compounds, the refolded Fab was used in an icELISA using AS-OVA as a solid-phase antigen. Figure 5A indicates that standard curves for AM and AS were generated and were linear from 0.16 μg/mL to 40 μg/mL for AM and from 8.0 ng/mL to 60 ng/mL for AS. The cross-reactivities (CRs) of the Fab against other natural products were similar to those observed for the anti-AM mAb, which recognizes only AM-related compounds (Table 2). These results removed doubt that the sequences of the variable fragments of the Fab yielded properties consistent with those of the mAb 1C1. We validated the icELISA using the Fab, as shown in Figure 5B, for the quantitative identification of AM. The intra- and inter-assay variabilities were assessed for the icELISA by testing 9 samples of different AM concentration in 9 assays performed together on the same day and on 3 consecutive days, respectively. The results of Table 3 show that the maximum RSD of intra-assay was 4.7%, whereas the inter-assay RSD was 5.9%. The assay results were confirmed using the mAb, revealing that the developed icELISA was sufficiently accurate and reliable for quantitative analysis of AM. Analysis of Artemisia annua and Other Artemisia spp. with the icELISA Using the Recombinant Fab against

Table 2. Cross-Reactivities of Anti-AM Fab against Various Natural Products compound

IC50 (μg/mL)

Artemisinin Artesunate Saikosaponin a Ginsenoside Rb1 Baicalin Quinine Berberine Arbutin Amygdalin Swertiamarin Digitonin

1.58 0.022 >100 >100 >100 >100 >100 >100 >100 >100 >100

Table 3. Intra- and Inter-assay Precision of AM Analysis by Indirect Competitive ELISA Using the Anti-AM Fab AM (μg/mL)

intra-assay (n = 9) RSD (%)

inter-assay (n = 3) RSD (%)

10.0 5.00 2.50 1.25 0.625 0.313

3.10 2.70 2.78 2.02 2.92 4.68

2.90 5.03 4.17 4.34 5.87 3.19

AM. After validating the icELISA as a quantitative method, the method was used for the analysis of various Artemisia spp., including A. annua, which is a main source of AM. The aerial parts of five types of Artemisia spp. were collected and extracted with MeOH to prepare sample extracts. The MeOH extracts were simply diluted with H2O to prepare 20% MeOH solutions and were examined by icELISA using the recombinant Fab against AM. Table 4 indicates that AM content of A. annua was 5.40 μg/mg dry weight (dwt), which was the highest value among the samples, as expected. The analytical data confirmed that A. absinthium and A. abrotanum contained AM. The experimental results were highly reproducible and agreed with previously reports, supporting the practical utility of the icELISA using the recombinant Fab against AM as a method for quantitatively analyzing AM.47 2006

dx.doi.org/10.1021/ac203131f | Anal. Chem. 2012, 84, 2002−2008

Analytical Chemistry

Article

Table 4. Determination of AM in Artemisia Plants by the icELISA Using the Anti-AM Faba sample A. A. A. A. A. A. a

annua absinthium abrotanum Iudovicianna capillaris pontica

(5) Zongo, I.; Dorsey, G.; Rouamba, N.; Tinto, H.; Dokomajilar, C.; Guiguemde, R. T.; Rosenthal, P. J.; Ouedraogo, J. B. Lancet 2007, 369, 491−498. (6) Tshefu, A. K.; Gaye, O.; Kayentao, K.; Thompson, R.; Bhatt, K. M.; Sesay, S. S.; Bustos, D. G.; Tjitra, E.; Bedu-Addo, G.; BorghiniFuhrer, I.; Duparc, S.; Shin, C. S.; Fleckenstein, L. Lancet 2010, 375, 1468−1481. (7) Crawley, J.; Chu, C.; Mtove, G.; Nosten, F. Lancet 2010, 375, 1457−1467. (8) Poespoprodjo, J. R.; Fobia, W.; Kenangalem, E.; Hasanuddin, A.; Sugiarto, P.; Tjitra, E.; Anstey, N. M.; Price, R. N. J. Infect. Dis. 2011, 204, 1613−1619. (9) Ravindranathan, T.; Kumar, M. A.; Menon, R. B.; Hiremath, S. V. Tetrahedron Lett. 1990, 31, 755−758. (10) Avery, M. A.; Fhong, W. K. M.; Jenningswhite, C. J. Am. Chem. Soc. 1992, 114, 974−979. (11) Ro, D. K.; Paradise, E. M.; Ouellet, M.; Fisher, K. J.; Newman, K. L.; Ndungu, J. M.; Ho, K. A.; Eachus, R. A.; Ham, T. S.; Kirby, J.; Chang, M. C. Y.; Withers, S. T.; Shiba, Y.; Sarpong, R.; Keasling, J. D. Nature 2006, 440, 940−943. (12) Woerdenbag, H. J.; Moskal, T. A.; Pras, N.; Malingre, T. M.; Elferaly, F. S.; Kampinga, H. H.; Konings, A. W. T. J. Nat. Prod. 1993, 56, 849−856. (13) Mercer, A. E.; Copple, I. M.; Maggs, J. L.; O’Neill, P. M.; Park, B. K. J. Biol. Chem. 2011, 286, 987−996. (14) Liu, W. M.; Gravett, A. M.; Dalgleish, A. G. Int. J. Cancer 2011, 128, 1471−1480. (15) Disbrow, G. L.; Baege, A. C.; Kierpiec, K. A.; Yuan, H.; Centeno, J. A.; Thibodeaux, C. A.; Hartmann, D.; Schlegel, R. Cancer Res. 2005, 65, 10854−10861. (16) Hou, J.; Wang, D.; Zhang, R.; Wang, H. Clin. Cancer, Res. 2008, 14, 5519−5530. (17) Posner, G. H.; McRiner, A. J.; Paik, I. H.; Sur, S.; Borstnik, K.; Xie, S. J.; Shapiro, T. A.; Alagbala, A.; Foster, B. J. Med. Chem. 2004, 47, 1299−1301. (18) Jeyadevan, J. P.; Bray, P. G.; Chadwick, J.; Mercer, A. E.; Byrne, A.; Ward, S. A.; Park, B. K.; Williams, D. P.; Cosstick, R.; Davies, J.; Higson, A. P.; Irving, E.; Posner, G. H.; O’Neill, P. M. J. Med. Chem. 2004, 47, 1290−1298. (19) Galal, A. M.; Ross, S. A.; ElSohly, M. A.; ElSohly, H. N.; ElFeraly, F. S.; Ahmed, M. S.; McPhail, A. T. J. Nat. Prod. 2002, 65, 184−188. (20) Li, Y.; Shan, F.; Wu, J. M.; Wu, G. S.; Ding, J.; Xiao, D.; Yang, W. Y.; Atassi, G.; Leonce, S.; Caignard, D. H.; Renard, P. Bioorg. Med. Chem. Lett. 2001, 11, 5−8. (21) Marchand, E.; Atemnkeng, M. A.; Vanermen, S.; PlaizierVercammen, J. Biomed. Chromatogr. 2008, 22, 454−459. (22) Tanaka, H.; Putalun, W.; De-Eknamkul, W.; Matangkasombut, O.; Shoyama, Y. Planta Med. 2007, 73, 1127−1132. (23) Koobkokkruad, T.; Chochai, A.; Kerdmanee, C.; De-Eknamkul, W. Phytochem. Anal. 2007, 18, 229−234. (24) Shishan, Z.; Mei-Yi, Z. Anal. Chem. 1986, 58, 289−292. (25) Lapkin, A. A.; Walker, A.; Sullivan, N.; Khambay, B.; Mlambo, B.; Chemat, S. J. Pharm. Biomed. Anal. 2009, 49, 908−915. (26) Diawara, H. Z.; Gbaguidi, F.; Evrard, B.; Leclercq, J. Q.; Moudachirou, M.; Debrus, B.; Hubert, P.; Rozet, E. J. Pharm. Biomed. Anal. 2011, 56, 7−15. (27) Lai, C. S.; Nair, N. K.; Mansor, S. M.; Olliaro, P. L.; Navaratnam, V. J. Chromatogr., B.: Anal. Technol. Biomed. Life Sci. 2007, 857, 308−314. (28) Hodel., E. M.; Zanolari, B.; Mercier, T.; Biollaz, J.; Keiser, J.; Olliaro, P.; Genton, B.; Decosterd, L. A. J. Chromatogr., B.: Anal. Technol. Biomed. Life Sci. 2009, 877, 867−886. (29) Liu, C. Z.; Zhou, H. Y.; Zhao, Y. Anal. Chim. Acta 2007, 581, 298−302. (30) Yanagihara, H.; Sakata, R.; Minami, H.; Tanaka, H.; Shoyama, Y.; Murakami, H. Anal. Chim. Acta 1996, 335, 63−70. (31) Shan, S. J.; Tanaka, H.; Shoyama, Y. Anal. Chem. 2001, 73, 5784−5790.

AM content (μg/mg dry wt.) 5.40 ± 0.32 0.233 ± 0.037 0.976 ± 0.241 N.D. N.D. N.D.

N.D.: not detected.

■

CONCLUSIONS In the present study, we developed expression systems that abundantly produced two types of recombinant antibody against AM and AS, and we applied the recombinant Fab to the icELISA in the first such approach to quantitative analysis of AM-related compounds. Given the poor production quantity of the anti-AM mAb from the hybridoma 1C1, the improved and enhanced Fab production are significant for the development of a cost-effective immunoassay. Both the scFv and recombinant Fab showed binding characteristics comparable to those of the anti-AM mAb 1C1 and could be prepared easily and rapidly. Their application to an icELISA revealed the superiority of the recombinant Fab over scFv as a primary antibody mainly due to difference in structure and conformational stability. The icELISA developed using the recombinant Fab was validated as a quantitative analytical method in terms of its utility and reliability by testing the quantitative inter- and intra-assay variations for AM determination from Artemisia spp. Our results support that the recombinant antibodies against AM and AS provide a low-cost and facile solution to the problems of quality assurance in AM production, the identification of high-quality Artemisia spp. in a breeding program, and techniques for therapeutic drug monitoring. The application of the Fab developed here can potentially advance the clinical development of the antimalarial drugs AM and AS.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone:+81 92 642 6582. Fax: +81 92 642 6582. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was funded in part by a Grant in Aid from the JSPS Asian CORE Program, the Ministry of Education, Culture, Sports, Science and Technology of Japan, and the National Center for Genetic and Biotechnology (BIOTEC), Thailand. We appreciate the technical support from the Research Support Center, Graduate School of Medical Sciences, Kyushu University.

■

REFERENCES

(1) Klayman, D. L. Science 1985, 228, 1049−1055. (2) Eckstein-Ludwig, U.; Webb, R. J.; van Goethem, I. D. A.; East, J. M.; Lee, A. G.; Kimura, M.; O’Neill, P. M.; Bray, P. G.; Ward, S. A.; Krishna, S. Nature 2003, 424, 957−961. (3) Miller, I. H.; Su, X. Cell 2011, 146, 855−858. (4) Smithuis, F.; Kyaw, M. K.; Phe, O.; Aye, K. Z.; Htet, L.; Barends, M.; Lindegardh, N.; Singtoroj, T.; Ashley, E.; Lwin, S.; Stepniewska, K.; White, N. J. Lancet 2006, 367, 2075−2085. 2007

dx.doi.org/10.1021/ac203131f | Anal. Chem. 2012, 84, 2002−2008

Analytical Chemistry

Article

(32) Kim, J. S.; Tanaka, H.; Shoyama, Y. Analyst 2004, 129, 87−91. (33) Phrompittayarat, W.; Putalun, W.; Tanaka, H.; Wittaya-Areekul, S.; Jetiyanon, K.; Ingkaninan, K. Anal. Chim. Acta 2007, 584, 1−6. (34) Sakamoto, S.; Putalun, W.; Tsuchihashi, R.; Morimoto, S.; Kinjo, J.; Tanaka, H. Anal. Chim. Acta 2008, 607, 100−105. (35) Kido, K.; Edakuni, K.; Morinaga, O.; Tanaka, H.; Shoyama, Y. Anal. Chim. Acta 2008, 616, 109−114. (36) Juengwatanatrakul, T.; Sritularak, B.; Amornnopparattanakul, P.; Tassanawat, P.; Putalun, W.; Tanaka, H.; Morimoto, S. Analyst 2011, 136, 1013−1017. (37) Kido, K.; Morinaga, O.; Shoyama, Y.; Tanaka, H. Talanta 2008, 77, 346−350. (38) Paudel, M. K.; Putalun, W.; Sritularak, B.; Morinaga, O.; Shoyama, Y.; Tanaka, H.; Morimoto, S. Anal. Chim. Acta 2011, 701, 189−193. (39) Jaziri, M.; Diallo, B.; Vanhaelen, M.; Homes, J.; Yoshimatsu, K.; Shimomura, K. Phytochemistry 1993, 33, 821−826. (40) Ferreira, J. F.; Janick, J. Phytochemistry 1996, 41, 97−104. (41) Eggelte, T. A.; van Agtmael, M. A.; Vuong, T. D.; van Boxtel, C. J. Am. J. Trop. Med. Hyg. 1999, 61, 449−456. (42) He, S. P.; Tan, G. Y.; Li, G.; Tan, W. M.; Nan, T. G.; Wang, B. M.; Li, Z. H.; Li, Q. X. Anal. Bioanal. Chem. 2009, 393, 1297−1303. (43) Tanaka, H.; Putalun, W.; De-Eknamkul, W.; Matangkasombut, O.; Shoyama, Y. Planta Med. 2007, 73, 1127−1132. (44) Krebber, A.; Bornhauser, S.; Burmester, J.; Honegger, A.; Bosshard, H. R.; Pluckthun, A. J. Immunol. Methods 1997, 201, 35−55. (45) Laemmli, U. K. Nature 1970, 227, 680−685. (46) Umetsu, M.; Tsumoto, K.; Hara, M; Ashish, K.; Goda, S.; Adschiri, T.; Kumagai, I. J. Biol. Chem. 2003, 278, 8979−8987. (47) Abdul, M.; Ibrar, A.; Waheed, A.; Muhammad, F. A.; Rizwana, A. Q..; Izhar, H.; Bushra, M. Malaria J. 2010, 9, 310.

2008

dx.doi.org/10.1021/ac203131f | Anal. Chem. 2012, 84, 2002−2008