Article pubs.acs.org/JAFC
Relationship between Sucrose Metabolism and Anthocyanin Biosynthesis During Ripening in Chinese Bayberry Fruit Liyu Shi,†,⊥ Shifeng Cao,‡,⊥ Jiarong Shao,† Wei Chen,† Yonghua Zheng,§ Yueming Jiang,∥ and Zhenfeng Yang*,† †
Key Laboratory of Fruits and Vegetables Postharvest and Processing Technology Research of Zhejiang Province, College of Biological and Environmental Sciences, Zhejiang Wanli University, No. 8, South Qian Hu Road, Ningbo, Zhejiang 315100, People’s Republic of China ‡ Nanjing Research Institute for Agricultural Mechanization, Ministry of Agriculture, Liuying 100, Nanjing 210014, People’s Republic of China § College of Food Science and Technology, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People’s Republic of China ∥ Key Laboratory of Plant Resource Conservation and Sustainable Utilization, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou 510650, People’s Republic of China S Supporting Information *
ABSTRACT: Two cultivars of Chinese bayberry fruit cvs ‘Dongkui’ and ‘Biqi’ with five different ripening stages were used to investigate the relationship between anthocyanin biosynthesis and sugar metabolism during fruit development. The results showed that anthocynin accumulated with the increased ripening stage in both of the two cultivars of bayberries. As compared to ‘Biqi’ fruit, a higher level of anthocyanin content was observed in ‘Dongkui’ fruit due to the increased expression of anthocyanin biosynthetic and regulatory genes especially MrCHI, MrDFR1, MrANS, and MrMYB1. Meanwhile, ‘Dongkui’ fruit also experienced higher levels of soluble sugars including sucrose, glucose, and fructose and expression of genes such as MrSPS1, MrSPS2, MrSPS3, MrINV1, MrINV2, and MrINV3 involved in sugar metabolism. Correlation analysis showed anthocyanin content had a significant relationship with all the three soluble sugars in bayberry fruit. Therefore, our results suggested that the higher anthocyanin content in ‘Dongkui’ fruit might be associated with its increased levels of soluble sugars. KEYWORDS: anthocyanins, Chinese bayberry, glucose, fructose, sucrose
■
INTRODUCTION Anthocyanins are ubiquitous natural pigments, playing a key role in providing pigmentation for flowers, fruits, and seeds to attract pollinators and seed dispersers, in plant defense as antimicrobial agents and feeding deterrents, in acting as signal molecules in plant-microbe interactions, and in UV protection.1 It is well-known that the accumulation of anthocyanins requires a complicated interaction between environmental and developmental factors, including light, temperature, plant hormone and sugars, etc.2 In plants, sugars are not only energy sources and structural components, but are also physiological signals regulating the expression of a variety of genes involved both in primary and secondary metabolism.3 The positive relationship between sugar concentration in plant tissue and pigmentation has been suggested. For example, anthocyanin accumulation in grape berries commenced at veraison and sugar accumulating began, and continued throughout berry ripening.4 Moreover, it has been previously reported that exogenous sugar addition enhanced the anthocyanin biosynthesis as well in several plant species. Anthocyanin accumulation was induced by sugars in radish hypocotyls and grape berries.5,6 All these results suggested that sugar concentration is one of the major factors affecting anthocyanin synthesis in plant tissues. The red and red-purple colors in Chinese bayberry (Myrica rubra Sieb. and Zucc.) fruit are produced by a group © 2014 American Chemical Society
of anthocyanins, and are important factors of market acceptance and nutritional values.7 Anthoycanin biosynthesis in the bayberries is controlled genetically, with gene expression of the enzymes in flavonoid pathway associated fundamentally with pigmentation. cDNAs derived from seven of the genes encoding these enzymes were cloned from bayberry fruit by Niu et al.:8 chalcone synthase (CHS), chalcone isomerase (CHI), dihydroflavonol 4-reductase (DFR), flavanone 3-hydroxylase (F3H), flavonoid 3′-hydroxylase (F3′H), anthocyanidin synthase (ANS), and UDP glucose-flavonoid 3-O-glucosyl transferase (UFGT). Meanwhile, a R2R3MYB transcription factor also played an important role in regulating the biosynthesis of anthocyanin in Chinese bayberry fruit, by activating the structural genes in the flavonoid pathway.8 However, little information was available on the relationship between anthocyanin accumulation and sugar metabolism in Chinese bayberry fruit. The aim of this study was to investigate the role of sugar metabolism as a possible factor involved in pigmentation in Chinese bayberry fruit during ripening. For this purpose, we compared the gene expression related to flavonoid pathway and sugar metabolism in two cultivars of bayberries with different colors. Received: Revised: Accepted: Published: 10522
July 11, 2014 October 4, 2014 October 4, 2014 October 4, 2014 dx.doi.org/10.1021/jf503317k | J. Agric. Food Chem. 2014, 62, 10522−10528
Journal of Agricultural and Food Chemistry
Article
Table 1. Primers Used for Gene Expression Analysis
■
gene
accession no.
forward primer (5′ to 3′)
reverse primer (5′ to 3′)
product size (bp)
MrCHS MrCHI MrF3H MrF3′H MrDFR1 MrDFR2 MrANS MrUFGT MrMYB1 MrINV1 MrINV2 MrINV3 MrSPS1 MrSPS2 MrSPS3 MrACT
GQ340759 GQ340760 GQ340761 GQ340762 GQ340763 GQ340764 GQ340765 GQ340766 GQ340767 JR053938 JR053939 JR053940 JR053941 JR053942 JR053943 GQ340770
AGTTCAAGAGCATGTGTGAC GCCATCGGGGTGTACTTAGA GTCGACATGGACCAGAAGGT GGATTGCTGCCTGAGAAG GACAATCAACGGGTTGTTAG AACGGTGAACGGGGTGTTGA CTAGTGGGAAGCTCGAGTGG TTTCCTCGACCAAACCAGAC GACTGAGGTGGCTGAATTATC GTTGAAAGCTTCGCTCAAGG TCCCGTGCTTGAAGGTGAAA TACACGACCGCTCCTATCC TGTGATCCTGAAGGGTGTGG CATTGTCCAAGGGTGTTATAGG AGGGAGAGGAAGCTCAGCAT AATGGAACTGGAATGGTCAAGG
TGGCAGCTTCTTTGCCTAGT GTTACCCGATAACGGCAAGA GGAGCAAGAGGGTGATGGTA CAGATAACCGTGTGGAGAC GACTGGCTTTTGGTGCTCTTC TACTTTCCTTTGGTGCTCAGA GCTAGCGCTCTCAGTTGCTT CTTACCTCCCTCCCATCTC CATCGTTCGCTGTTCTTCC ACTGAGGAAGTGATAGTGGC AAGAACAATCGTGCTGCTCC TCTATGGGCTGTTGGCTTTG CGAAGCTCGAATGTCGTTGC ACTTCCTCCTTCTCAATACTGG AGGGAGAGGAAGCTCAGCAT CCCGACATAGGCATCTTTCTG
167 210 112 155 118 118 142 186 150 134 144 127 139 105 132 132
MATERIALS AND METHODS
Plant Materials. Five 5-year-old Chinese bayberry (Myrica rubra Sieb. and Zucc.) trees were chosen for these experiments from commercial orchards in Zhejiang Province, China. Two types of varieties, ‘Biqi’ (BQ) and ‘Dongkui’ (DK), were obtained from the Cixi (30°12′N, 121°24′ E) and Xianju (28°85′N, 120°61′E), respectively. Fruit were collected at five developmental stages from 57 to 113 days after flower bloom (DAFB) with an interval of 14 days from May 1 to July 31 in 2013. At each stage, 10 fruit on each branch and 2 fruiting branches from each bayberry trees were selected. All of the samples were healthy and uniformly distributed around the tree. There were 10 fruit on each tree used to measure fruit diameter during different developmental stages (see Supporting Information S1). After transportation to laboratory in 2 h, 20 fruit from each variety were selected for color measurement. All samples were immediately frozen in liquid nitrogen, and then stored at −81 °C until use. Total Anthocyanin Content Determination. To prepare the fruit extract, 1 g samples from each replicate were homogenized with 5 mL of precooled acidified water (3% formic acid), and after centrifugation at 10 000g for 15 min (4 °C), another 5 mL of precooled acidified water was used to extract the residue again. The supernatant was combined to make the final volume of 25 mL for analysis. Total anthocyanin content of bayberry extract was measured using the pH differential method.9 Absorbance was measured at 510 and 700 nm, respectively, in different buffers at pH 1.0 and 4.5, using A = [(A510 − A700) pH1.0 − (A510 − A700) pH4.5] with a molar extinction coefficient of cyanidin 3-glucoside (Cy-3-Glu) of 29 600. Results were expressed as milligrams of Cy-3-Glu equivalents per gram of fresh weight. All analysis was repeated three times using three biological replicates Sugars Extraction and HPLC Determination. The extraction of sugars from bayberries was modified from a method described by Eyéghé-Bickong et al.10 Briefly, 80 mg of frozen homogenized bayberry tissue from each replicate was weighed off into 800 μL of dH2O containing 5% (w/v) insoluble PVPP and vortexed for 5 min to homogenize. An equal volume of chloroform was added to the mixture, and the biphasic solvent was vortexed for 5 min to mix and incubated at 50 °C for 30 min with continuous shaking. After incubation, the microfuge tube was centrifuged at 12 000g for 10 min at room temperature to recover the upper aqueous phase containing the sugars. The supernatant was passed through a 0.22 μm membrane filter (Millipore Corp., Bedford, MA) for HPLC analysis. All analysis was repeated three times using three biological replicates Chromatographic analysis of sugars was carried out on a Waters 2695-series HPLC system (Waters Corp., Milford, MA) equipped with a refractive index detector and Empower 3 software. A COSMOSIL Sugar-D column (4.6 mm i.d. × 250 mm) and COSMOSIL Sugar-D guard column (4.6 mm i.d. × 10 mm) both from NacalaiTesque Inc.
Figure 1. Changes of total anthocyanin content in Chinese bayberries during fruit development. Values are the means ±SE. Vertical bars represent the standard errors of the means. Asterisks indicate significant differences between ‘Dongkui’ and ‘Biqi’ samples (Duncan’s multiple range test; *P < 0.05, ** P < 0.01, and ***P < 0.001). (Kyoto, Japan) were used. The mobile phase was HPLC grade acetonitrile/water (65:35, v/v) with a flow rate of 1.0 mL/min at 35 °C, and sample volume injected was 20 μL. A refractive index detector maintained at 35 °C was used for detection purposes. The column was equilibrated for 10 min at the starting conditions before each injection. The sugars were identified on the basis of comparison of their retention times with those of pure standards and quantified using standard calibration curves. Total RNA Extraction and cDNA Synthesis. Total RNA was isolated using a Plant Total RNA Extraction Kit (Genotheramics, Suzhou, China) according to the manufacturer’s instructions. Extracted RNA was purified with amplification grade RNase-free DNase I (Omega, Norcross, GA) to remove any DNA contamination prior to cDNA synthesis. Reverse transcription (RT) was carried out using 2 μg of total RNA and the SuperRT First Strand cDNA Synthesis Kit (CWBIO, Beijing, China), following the manufacturer’s instructions. Quantitative Real-Time PCR (qPCR). qRT-PCR was conducted using a total volume of 12.5 μL reaction containing 0.5 μL of the synthesized cDNA, 0.25 μL of 10 μM each forward and reverse primers, 6.5 μL of the SYBR Green PCR Master Mix (Thermo Scientific, Pittsburgh, PA), and 5 μL of RNase-free water. Amplifications were performed using Mx3000P qRT-PCR System (Agilent Stratagene, Santa Clara, CA). The amplification program consisted of an initial denaturation step of 95 °C for 7 min, followed by 40 cycles of 15 s at 95 °C, and combined with each primer specific annealing temperature ranged from 50 to 60 °C for 30 s. Melting curve analysis was performed at the end of 40 cycles to ensure proper amplification of target fragments. MrACT (GenBank accession no. GQ340770) was used to 10523
dx.doi.org/10.1021/jf503317k | J. Agric. Food Chem. 2014, 62, 10522−10528
Journal of Agricultural and Food Chemistry
Article
Figure 2. Expression of anthocyanin biosynthetic genes in Chinese bayberries during fruit development. Values are the means ±SE. Vertical bars represent the standard errors of the means. Asterisks indicate significant differences between ‘Dongkui’ and ‘Biqi’ samples (Duncan’s multiple range test; *P < 0.05, ** P < 0.01, and ***P < 0.001).
anthocyanins than ‘BQ’ fruit, and the content in ‘DK’ fruit was nearly 2 times that in ‘BQ’ fruit at 113 DAFB. No anthocyanin was detected in ‘BQ’ fruit at 57 DAFB. Expression of Anthocyanin Biosynthetic Genes During Fruit Development. As shown in Figure 2, transcript levels of biosynthetic genes MrCHS, MrCHI, MrF3H, MrF3′H, MrDFR1, and MrANS increased throughout fruit development in both bayberry cultivars. Expression of MrDFR2 and MrUFGT in ‘DK’ fruit showed a gradual increase with ripening, but no significant change was observed in MrDFR2 transcript level in ‘BQ’ fruit. Transcript abundance of MrUFGT in ‘BQ’ fruit increased with fruit development from 57 to 85 DAFB and then declined toward to maturity. As compared to ‘BQ’ fruit, ‘DK’ fruit experienced
normalize as endogenous reference, and transcripts were quantified using the standard curve method. All analysis was repeated three times using three biological replicates, and primer sequences used for real time PCR are listed in Table 1. Statistical Analysis. All values are shown as the mean ±SE. Statistical analysis was performed using the SPSS package program version 16.0 (SPSS Inc., Chicago, IL). Student’s unpaired t test was used to compare the means at P < 0.05.
■
RESULTS Changes of Total Anthocyanin Content During Fruit Development. The total anthocyanin content in ‘DK’ and ‘BQ’ bayberries increased continuously during fruit development (Figure 1). Generally, ‘DK’ fruit had higher levels of 10524
dx.doi.org/10.1021/jf503317k | J. Agric. Food Chem. 2014, 62, 10522−10528
Journal of Agricultural and Food Chemistry
Article
higher expression of MrCHI, MrDFR1, and MrANS, whereas the transcript levels of MrF3′H and MrDFR2 were significantly lower during fruit development. Higher expression levels of MrCHS and MrF3H were found in ‘DK’ fruit from 57 to 71 DAFB, but there was no significant difference between the two cultivars from 85 to 113 DAFB. Meanwhile, a significant higher MrUFGT was observed in ‘DK’ fruit at the end of fruit development. Expression of MrMYB1 During Fruit Development. Transcript abundance of MrMYB1 increased gradually during bayberry fruit development. Expression of MrMYB1 was higher in ‘DK’ fruit than that in ‘BQ’ fruit (Figure 3).
Figure 3. Expression of MrMYB1 in Chinese bayberries during fruit development. Values are the means ±SE. Vertical bars represent the standard errors of the means. Asterisks indicate significant differences between ‘Dongkui’ and ‘Biqi’ samples (Duncan’s multiple range test; *P < 0.05, ** P < 0.01, and ***P < 0.001).
Changes of Glucose, Fructose, and Sucrose During Fruit Development. The changes of glucose, fructose, and sucrose differed from the two bayberry cultivars (Figure 4). In ‘DK’ fruit, levels of glucose and fructose accumulated at early development stage and showed the first peak at 71 DAFB, followed by the second peak at 99 DAFB (Figure 4A,B), whereas sucrose content increased with fruit development from 57 to 99 DAFB, and then decreased slightly toward maturity (Figure 4C). However, all of the three soluble sugars in ‘BQ’ fruit accumulated throughout fruit development. Significantly higher levels of glucose, fructose, and sucrose were observed in ‘DK’ fruit compared with that in ‘BQ’ fruit (Figure 4). Expression of Sucrose Phosphate Synthase and Sucrose Invertase Genes During Fruit Development. Both of the bayberry cultivars experienced a similar expression patterns in SPS genes during fruit ripening (Figure 5). No significant change in expression level was observed for MrSPS1, whereas the transcript abundance of MrSPS2 showed a slight increase during fruit development. The transcript level of MrSPS3 increased with fruit development from 57 to 85 DAFB and then decreased slightly toward maturity. A significantly higher expression level of these three SPS genes was observed in ‘DK’ fruit than ‘BQ’ during fruit development. Three INV genes, MrINV1, MrINV2, and MrINV3, showed similar expression patterns in ‘DK’ fruit (Figure 5). Transcript levels of these three INV genes decreased with fruit development from 57 to 71 DAFB, and then increased gradually from 71 to 99 DAFB followed by a decline toward maturity. In ‘BQ’ fruit, the expression levels of MrINV2 and MrINV3 were detected only at an early stage of fruit development from 57 to 71 DAFB. Moreover, no expression of MrINV1 was detected in this cultivar. ‘DK’ fruit showed remarkably higher expression of these
Figure 4. Changes of glucose (A), fructose (B), and sucrose (C) in Chinese bayberries during fruit development. Values are the means ±SE. Vertical bars represent the standard errors of the means. Asterisks indicate significant differences between ‘Dongkui’ and ‘Biqi’ samples (Duncan’s multiple range test; *P < 0.05, ** P < 0.01, and ***P < 0.001).
three INV genes compared to ‘BQ’ fruit throughout the fruit development. Correlation between Total Anthocyanins and Levels of Glucose, Fructose, and Sucrose. A common positive linear correlation was observed between anthocyanin and soluble sugars such as glucose, fructose, and sucrose in Chinese bayberry fruit. The corresponding correlation coefficients were 0.79, 0.79, and 0.72, respectively (Figure 6). From this linear function, threshold values of glucose, fructose, and sucrose (3.64, 2.74, and 18.5 mg/g FW, respectively), above which bayberries were stimulated to accumulate anthocyanins, could be obtained.
■
DISCUSSION In Chinese bayberry fruit, changes in the levels of anthocyanin accumulation have been well-known to occur during fruit ripening.8,11 The results of our study indicated a progressive increase of anthocyanin accumulation as the bayberry fruit developed which was in agreement with the previous report.12 However, fruit pigmentation differed significantly between the two tested cultivars. The maturation led to a more favorable red color in ‘DK’ fruit, in which higher anthocyanin content was observed compared to that in ‘BQ’ fruit. However, according to Niu et al.,8 ‘DK’ fruit was red whereas ‘BQ’ was dark red-purple which was due to a higher content of anthocyanins than ‘DK’. In our study, we observed that ‘BQ’ presented a 2-fold reduction 10525
dx.doi.org/10.1021/jf503317k | J. Agric. Food Chem. 2014, 62, 10522−10528
Journal of Agricultural and Food Chemistry
Article
Figure 5. Expression of sucrose phosphate synthase and sucrose invertase genes in Chinese bayberries during fruit development. Values are the means ±SE. Vertical bars represent the standard errors of the means. Asterisks indicate significant differences between ‘Dongkui’ and ‘Biqi’ samples (Duncan’s multiple range test; *P < 0.05, ** P < 0.01, and ***P < 0.001).
in anthocyanins when compared to ‘DK’. The difference in terms of anthocyanins in the two varieties between the published paper and our studies was associated with the temperature difference in the two different places where the fruit was picked (see Supporting Information S2). Expression of flavonoid genes has been shown to be correlated with anthocyanin accumulation during fruit development in apple, grape, pear, and Chinese bayberry.8,11,13,14 Therefore, the transcription of genes in the anthocyanin biosynthesis pathway was investigated by qPCR in present study. All of the biosynthetic genes studied were expressed in all the samples from the two cultivars taken at the different developmental stages. Expression of these genes in bayberry fruit increased during ripening, regardless of the cultivars. In particular, the higher transcript levels of MrCHI, MrDFR1, and MrANS in ‘DK’ fruit was in parallel to its higher anthocyanin concentration during fruit development. These data suggested that these three genes might be the key regulatory genes in the process of anthocyanin biosynthesis in Chinese bayberries. However, inconsistent with its anthocyanin content, ‘BQ’ fruit also exhibited higher expression of MrF3′H and MrDFR2 at each fruit development stage in comparison with ‘DK’ fruit. In grapes, Boss et al.13 reported that samples without anthocyanins expressed all major anthocyanin biosynthesis genes except UFGT, and they suggested that these genes were associated with the other
biosynthesis pathways, notably those involved in the biosynthesis of aurones, flavones, flavonols, iosflavonoids, and proanthocyanindins. These specific expression patterns of MrF3′H and MrDFR2 in Chinese bayberries were likely related to these other pathways, because phenolic compounds such as catechin and epicatechin, present in bayberries, are synthesized by proanthocyanindin biosynthesis pathway. MrMYB1 is a known activator of the bayberry anthocyanin pathway.8 In accord with anthocyanin content, ‘DK’ fruit was associated with higher MrMYB1 transcription than ‘BQ’. Overall, anthocyanin and transcript quantifications in Chinese bayberry fruit performed in this study suggested a possible mechanism controlling pigment patterns in bayberry fruit. We have found that less red-colored fruit ‘BQ’ were related to lower anthocyanin accumulation, which was explained by reduced transcript levels of several antho cyanin pathway genes evaluated, including the structural genes in the pathway, and MrMYB1, a transcription factor which regulates them. Sugar is a common regulator for the expression of genes encoding metabolic enzymes and proteins involved in photosynthesis, carbohydrate metabolism, pathogenesis,15 and anthocyanin biosynthesis.16,17 Glucose and fructose are primarily derived from the hydrolysis of the imported sucrose via invertase. Our data clearly suggested that the metabolism of sugars in bayberries varied from different cultivars and development stages. 10526
dx.doi.org/10.1021/jf503317k | J. Agric. Food Chem. 2014, 62, 10522−10528
Journal of Agricultural and Food Chemistry
Article
Figure 6. Correlation between total anthocyanins and levels of glucose (A), fructose (B), and sucrose (C) in both cultivars.
‘DK’ fruit experienced significantly higher expression of INV genes than ‘BQ’, indicating more glucose and fructose were produced and available for accumulation. However, it must be pointed that, being different from ‘BQ’, contents of glucose and fructose in ‘DK’ showed two peaks in relation to the expression pattern of INV genes. At the early stage of fruit development (57 DAFB), relatively higher expression of INV genes found in this study matched the first peak of glucose and fructose accumulation at 71 DAFB. Subsequently, the increased expression of these three INV genes from 71 to 99 DAFB indicated that the generation of glucose and fructose increased toward maturity. There are two sources of sucrose for accumulation: the imported sucrose that has not been metabolized and newly synthesized sucrose. In our present study, sucrose content in bayberries accumulated during fruit ripening regardless of the cultivars. However, the high transcript levels of SPS genes and very low expression of INV genes suggested that newly synthesized sucrose via SPS contributed significantly to the total sucrose level. The higher expression levels of SPS genes in ‘DK’ fruit toward maturity were consistent with faster accumulation of sucrose during this period. Therefore, taking into account all the expression studies involved in sugar metabolism, sucrose accumulation in bayberry fruit during ripening is of SPS type according to the categorization of mechanisms controlling sugar accumulation in fruit by Yamaki,18 as in strawberry, apple, and melon.19−21 A direct correlation between sucrose accumulation and SPS transcript levels has also been demonstrated in banana, melon, and apple fruit.20−22 Many studies have revealed the stimulatory effects of sugars on anthocyanin accumulation in a variety of plant species, of which sugars seem to not only be general carbohydrate sources, but also act as signal molecule to activate/repress the reactions.2,17 For example, in flowers, sugar levels increase during petal development. Corollas cultured in vitro without sucrose do not elongate or show color.2 Anthocyanin accumulation in grape berries commenced at veraison and sugar accumulating began, and continued throughout berry ripening,4 which can be promoted by sucrose in grape cell suspensions and intact detached grape.23,24 Similarly, sugars enhanced anthocyanin biosynthesis in radish hypocotyls.5 In our experiment, during bayberry development, anthocyanin accumulation was consistent with the levels of glucose, fructose, and sucrose. Also, the correlation analysis revealed a significant relationship between levels of anthocyanin and sugars. A few studies demonstrated that this regulation is mediated by the expression of genes involved in anthocyanin synthesis.6,25,26 In an Arabidopsis mutant impaired in phloem
unloading and thereby having an accumulation of high sugar levels, anthocyanin accumulated in the leaves as a result of sucroseinduced expression of anthocyanin biosynthesis-related genes.25 In sliced grape berries, sucrose up-regulated VvF3H expression, coinciding with enhanced anthocyanin levels.6 In our study, increased expression of anthocyanin biosynthetic and regulatory genes has been observed with the accumulation of glucose, fructose, and sucrose during bayberry ripening regardless of the cultivars. In addition, the transcripts of MrF3H, MrANS, and MrMYB1 in ‘DK’ fruit were dramatically higher than that in ‘BQ’, which was in compliance with the higher sugar levels. These results suggested that the accumulated sugars in Chinese bayberry fruit may play an important role in inducing expression of anthocyanin biosynthetic and regulatory genes, which was largely responsible for the pigmentation in bayberries. In conclusion, we demonstrated a close correlation between the production of anthocyanins and the amount of sugars such as glucose, fructose, and sucrose during fruit ripening in Chinese bayberry fruit. The data presented confirm a specific role of high sugar levels in the promotion of the synthesis of specific secondary metabolites. However, the direct evidence that sugars enhance anthocyanin accumulation is still unknown because the study of the effects of sugars on bayberries still attached to intact plants is very challenging due to the large size of plant, interplant, intercluster, and interberry variability. Recently, an in vitro culture system that enabled long-term culture covering the whole ripening processes was developed in grapes in order to reveal the synthesis of anthocyanin in response to sugar levels.23 A similar model system that enables easy modulation of the sugar status in Chinese bayberry fruit is therefore desirable to decipher the biochemical and molecular mechanisms of this regulation, which needs further investigation.
■
ASSOCIATED CONTENT
S Supporting Information *
Additional information as noted in the text. This material is available free of charge via the Internet at http://pubs.acs.org.
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Phone: +86-574-88222229. Fax: +86-574-88222991. Author Contributions ⊥
10527
These authors contributed equally to this work. dx.doi.org/10.1021/jf503317k | J. Agric. Food Chem. 2014, 62, 10522−10528
Journal of Agricultural and Food Chemistry
Article
Notes
(15) Rolland, F.; Baena-Gonzalez, E.; Sheen, J. Sugar sensing and signaling in plants: Conserved and novel mechanisms. Annu. Rev. Plant Biol. 2006, 57, 675−709. (16) Baier, M.; Hemmann, G.; Holman, R.; Corke, F.; Card, R.; Smith, C.; Rook, F.; Bevan, M. W. Characterization of mutants in Arabidopsis showing increased sugar-specific gene expression, growth, and developmental responses. Plant Physiol. 2004, 134, 81−91. (17) Mita, S.; Hirano, H.; Nakamura, K. Negative regulation in the expression of a sugar-inducible gene in Arabidopsis thaliana. Plant Physiol. 1997, 114, 575−582. (18) Yamaki, S. Physiology and metabolism of fruit development: biochemistry of sugar metabolism and compartmentation in fruits. Acta Hortic. 1995, 398, 109−120. (19) Dai, N.; Cohen, S.; Portnoy, V.; Tzuri, G.; Harel-Beja, R.; Pompan-Lotan, M.; Carmi, N.; Zhang, G.; Diber, A.; Pollock, S.; Karchi, H.; Yeselson, Y.; Petreikov, M.; Shen, S.; Sahar, U.; Hovav, R.; Lewinsohn, E.; Tadmor, Y.; Granot, D.; Ophir, R.; Sherman, A.; Fei, Z.; Giovannoni, J.; Burger, Y.; Katzir, N.; Schaffer, A. A. Metabolism of soluble sugars in developing melon fruit: a global transcriptional view of the metabolic transition to sucrose accumulation. Plant Mol. Biol. 2011, 76, 1−18. (20) Hubbard, N. L.; Pharr, D. M.; Huber, S. C. Sucrose phosphate synthase and other sucrose metabolizing enzymes in fruits of various species. Physiol. Plant 1991, 82, 191−196. (21) Li, M. J.; Feng, F. J.; Cheng, L. L. Expression patterns of genes involved in sugar metabolism and accumulation during apple fruit development. PLoS One 2012, 7, e33055 DOI: 10.1371/journal.pone.0033055. (22) Choudhury, R. S.; Roy, S.; Sengupta, D. N. A comparative study of cultivar differences in sucrose phosphate synthase gene expression and sucrose formation during banana fruit ripening. Postharvest Biol. Technol. 2009, 54, 15−24. (23) Dai, Z. W.; Meddar, M.; Renaud, C.; Merlin, I.; Hilbert, G.; Delrot, S.; Gomès, E. Long-term in vitro culture of grape berries and its application to assess the effects of sugar supply on anthocyanin accumulation. J. Exp. Bot. 2014, DOI: 10.1093/jxb/ert489. (24) Larronde, F.; Krisa, S.; Decendit, A.; Chèze, C.; Deffieux, G.; Mérillon, M. Regulation of polyphenols production in Vitis vinifera cell suspension cultures by sugars. Plant Cell Rep. 1998, 17, 946−950. (25) Loreti, E.; Povero, G.; Novi, G.; Solfanelli, C.; Alpi, A.; Perata, P. Gibberellins, jasmonate and abscisic acid modulate the sucrose induced expression of anthocyanin biosynthetic genes in Arabidopsis. New Phytol. 2008, 4, 1−13. (26) Solfanelli, C.; Poggi, A.; Loreti, E.; Alpi, A.; Perata, P. Sucrosespecific induction of the anthocyanin biosynthetic pathway in Arabidopsis. Plant Physiol. 2006, 140, 637−646.
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This study was supported by the National Natural Science Foundations of China (31101356).
■
ABBREVIATIONS USED
■
REFERENCES
ANS, anthocyanidin synthase; BQ, Biqi; CHS, chalcone synthase; CHI, chalcone isomerase; DAFB, day after flower bloom; DFR, dihydroflavonol 4-reductase; DK, Dongkui; F3H, flavanone 3-hydroxylase; F3′H, flavonoid 3′-hydroxylase; INV, sucrose invertase; qPCR, quantitative real-time PCR; SPS, sucrose phosphate synthase; UFGT, UDP glucose-flavonoid 3O-glucosyl transferase
(1) Winkel-Shirley, B. Flavonoid biosynthesis: A colourful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001, 126, 485−493. (2) Weiss, D. Regulation of flower pigmentation and growth: Multiple signaling pathways control anthocyanin synthesis in expanding petals. Physiol. Plant 2000, 110, 152−157. (3) Ohto, M.; Onai, K.; Furukawa, Y.; Aoki, E.; Araki, T.; Nakamura, K. Effects of sugar on vegetative development and floral transition in Arabidopsis. Plant Physiol. 2001, 127, 252−261. (4) Gonzalez-SanJose, M. L. Relationship between anthocyanins and sugars during the ripening of grape berries. Food Chem. 1992, 43, 193− 197. (5) Hara, M.; Oki, K.; Hoshino, K.; Kuboi, T. Enhancement of anthocyanin biosynthesis by sugar in radish (Raphanus sativus) hypocotyls. Plant Sci. 2003, 164, 259−265. (6) Zheng, Y.; Tian, L.; Liu, H.; Pan, Q.; Zhan, J.; Huang, W. Sugars induce anthocyanin accumulation and flavanone 3-hydroxylase expression in grape berries. Plant Growth Regul. 2009, 58, 251−260. (7) Yang, Z. F.; Zheng, Y. H.; Cao, S. F. Effect of high oxygen atmosphere storage on quality, antioxidant enzymes, and DPPH radical scavenging activity of Chinese bayberry fruit. J. Agric. Food Chem. 2009, 57, 176−181. (8) Niu, S. S.; Xu, C. J.; Zhang, W. S.; Zhang, B.; Li, X.; Wang, K. L.; Ferguson, I. B.; Allan, A. C.; Chen, K. S. Coordinated regulation of anthocyanin biosynthesis in Chinese bayberry (Myrica rubra) fruit by a R2R3MYB transcription factor. Planta 2010, 231, 887−899. (9) Cheng, G. W.; Breen, P. J. Activity of phenylalanine ammonialyase (PAL) and concentration of anthocyanins and phenolics in developing strawberry fruit. J. Am. Soc. Hortic. Sci. 1991, 116, 865−869. (10) Eyéghé-Bickong, H. A.; Alexandersson, E. O.; Gouws, L. M.; Young, P. R.; Vivier, M. A. Optimization of an HPLC method for the simultaneous quantification of the major sugars and organic acids in grapevine berries. J. Chromatogr., B 2012, 885−886, 43−49. (11) Feng, S. Q.; Wang, Y. L.; Yang, S.; Xu, Y. T.; Chen, X. S. Anthocyanin biosynthesis in pears is regulated by a R2R3-MYB transcription factor PyMYB10. Planta 2010, 232, 245−255. (12) Feng, C.; Chen, M.; Xu, C. J.; Bai, L.; Yin, X. R.; Li, X.; Allan, A. C.; Ferguson, I. B.; Chen, K. S. Transcriptomic analysis of Chinese bayberry (Myrica rubra) fruit development and ripening using RNA-Seq. BMC Genomics 2012, 13, 19. (13) Boss, P. K.; Davies, C.; Robinson, S. P. Analysis of the expression of anthocyanin pathway genes in developing Vitis vinifera L. cv shiraz grape berries and the implications for pathway regulation. Plant Physiol. 1996, 111, 1059−1066. (14) Honda, C.; Kotoda, N.; Wada, M.; Kondo, S.; Kobayashi, S.; Soejima, J.; Zhang, Z.; Tsuda, T.; Moriguchi, T. Anthocyanin biosynthetic genes are coordinately expressed during red colouration in apple skin. Plant Physiol. Biochem. 2002, 40, 955−962. 10528
dx.doi.org/10.1021/jf503317k | J. Agric. Food Chem. 2014, 62, 10522−10528
