Simplified in Vitro and in Vivo Bioaccess to Prenylated Compounds

This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes.

Article Cite This: ACS Omega 2019, 4, 7838−7849

http://pubs.acs.org/journal/acsodf

Simplified in Vitro and in Vivo Bioaccess to Prenylated Compounds Julie Couillaud,† Juan Rico,† Alyssa Rubini,† Tarek Hamrouni,† Elise Courvoisier-Dezord,† Jean-Louis Petit,‡ Aline Mariage,‡ Ekaterina Darii,‡ Katia Duquesne,† Véronique de Berardinis,*,‡ and Gilles Iacazio*,† †

Aix-Marseille Université, CNRS, Centrale Marseille, iSm2, 13013 Marseille, France Génomique Métabolique, Genoscope, Institut François Jacob, CEA, CNRS, Université Evry, Université Paris-Saclay, 91057 Evry, France

‡

Downloaded via 193.93.192.37 on April 30, 2019 at 18:17:51 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

S Supporting Information *

ABSTRACT: All naturally produced terpenes are derived from two universal C5 diphosphate precursors, dimethylallyl diphosphate (DMAPP) and isopentenyl diphosphate (IPP). Various prenyl transferases use DMAPP to prenylate aromatic compounds, while others, in combination with IPP, lead to the enzymatic formation of geranyl diphosphate (GPP), farnesyl diphosphate (FPP), geranylgeranyl diphosphate (GGPP), and geranylfarnesyl diphosphate, the direct precursors of monoterpenes (C10), sesquiterpenes (C15), diterpenes (C20), and sesterterpenes (C25), respectively. FPP and GGPP are also the basis for the biosynthesis of triterpenes (steroids) and tetraterpenes (carotenoids), respectively. Nature has developed two biosynthetic pathways to produce DMAPP and IPP, the mevalonate (MEV) pathway and the methylerythritol phosphate (MEP) pathway. Both use compounds derived from glucose through glycolysis, and 18 enzymes are involved to generate both DMAPP and IPP. Here, we sought to simplify biochemical access to these two universal diphosphates using the two commercially and industrially available C5-OHs, dimethylallyl alcohol and isopentenol (IOH), as starting substrates, as well as two enzymes, selected from a diverse choice, able to carry out the double phosphorylation of these two C5-OHs at room temperature using ATP as a phosphate donor. The first phosphorylation is performed by a promiscuous acid phosphatase (AP), used in the reverse reaction mode, whereas the second is performed by the recently described isopentenyl phosphate kinase (IPK). We show the interest of this artificial biosynthetic terpene mini-path (TMP) by testing it in a three-enzyme cascade, leading to the formation of the cytotoxic prenylated diketopiperazine tryprostatin B (TB) from chemically synthesized brevianamide F (BF), using FtmPT1 prenyltransferase as a biocatalyst, in addition to the two previously mentioned kinases. We first performed the proof of concept of this simplified pathway in vivo ( Escherichia coli), using already described enzymes, that is, an AP from Salmonella enterica and an IPK from Thermoplasma acidophilum. The complete conversion of BF (3.3 mM, 1 g/L) to TB was obtained after optimization of culture conditions and process parameters. Following this first success, we performed a screen in search of highly active phosphatases and IPKs to develop the TMP in vitro. A highly active AP from Xanthomonas translucens and an IPK from Methanococcus vannielii were selected from these screens, allowing the in vitro development of the TMP. Under optimized conditions, the three-enzyme cascade led to the total transformation of BF (10 mM, 3.3 g/L) to TB in less than 24 h, establishing the in vitro utility as well as the in vivo utility of the TMP. The implementation of this biosynthetic TMP offers thus the possibility to access virtually any terpene structure using two easily commercially and industrially available compounds in bulk, either in vivo or in vitro, and is thus a viable alternative to the natural MEV and MEP pathways for bioaccess to terpenes.

1. INTRODUCTION With over 80 000 structures described to date,1 terpenes are the most abundant class of natural compounds on earth. They have long attracted attention because of their biological (anticancer, antimalarial, antibiotic, etc.) and physicochemical (flavors, fragrances, antioxidants, dyes, etc.) properties.2−4 From a biosynthetic point of view, all terpenes are derived from the two universal precursors dimethylallyl diphosphate (DMAPP) and isopentenyl diphosphate (IPP), which are themselves derived from two metabolic pathways, the mevalonate (MEV) and methylerythritol phosphate (MEP) pathways.5,6 Industrial access to terpenes is hampered by their © 2019 American Chemical Society

complex structure, rendering chemical synthesis tedious and uneconomical, as is also extraction from natural sources, in which terpenes are generally present in tiny quantities.4 Environmental concerns have recently prompted the development of the biobased production of natural compounds,7 and remarkable success has been obtained in the production of the two terpenes, artemisinin8 and farnesene,9 in yeast. The carbon source used in almost all bio-based production of terpenes is a Received: February 28, 2019 Accepted: April 12, 2019 Published: April 30, 2019 7838

DOI: 10.1021/acsomega.9b00561 ACS Omega 2019, 4, 7838−7849

ACS Omega

Article

monophosphates, DMAP and IP, from the corresponding DMAOH and IOH. This class of enzymes could therefore carry out the first phosphorylation of the TMP. The second enzyme required for the establishment of the TMP is known to be IPK and is naturally present in many organisms.12 It is particularly found in several archaebacteria, in which it is part of a modified MEV pathway specific to these microorganisms,18 and catalyzes the phosphorylation of IP to IPP as well as of DMAP to DMAPP.19 This review of the literature thus suggested the possibility of constructing the TMP using an AP in the reverse mode and an IPK to transform the two C5 alcohols into their respective diphosphates in two enzymatic steps. 2.2. In Vivo TMP Proof of Concept. We sought to develop the smallest (bio)synthetic pathway to access terpene compounds using the two enzymes selected for the TMP. We chose an enzymatic cascade involving a prenyl transferase (FtmPT114) using DMAPP as a prenylating agent and BF (chemically synthesized) as a substrate. The expected product, TB (Figure 1), is an intermediate in the biosynthesis of fumitremorgin-type alkaloids20 by A. fumigatus and shows cytotoxic activity.13

carbohydrate (very often glucose), which is also needed for microbial growth and energetic purposes. Both the MEV and MEP pathways require 18 enzymes for the synthesis of the two universal terpene precursors DMAPP and IPP from glucose. We investigated whether it was possible to simplify the production of these two compounds using the corresponding alcohols [dimethylallyl alcohol (DMAOH) and isopentenol (IOH)], which are commercially and industrially available in bulk, as carbon sources to transform them into their respective diphosphates (DMAPP and IPP) using two enzymes acting as kinases, both in vitro and in vivo. A survey of the literature showed that the first phosphorylation can possibly be conducted by a nonspecific acid phosphatase (AP) acting in reverse mode, using diphosphate,10 whereas the second phosphorylation is known to be catalyzed by isopentenyl phosphate kinase (IPK) using ATP, an enzyme involved in a modified MEV pathway found in some archaebacteria.11,12 We first demonstrated in vivo the relevance of a terpene mini-path (TMP) that efficiently and completely transformed exogenously added diketopiperazine brevianamide F (BF) into prenylated cytotoxic tryprostatin B (TB)13 at a 1 g/L BF concentration. The two enzymes used, in addition to the prenyl transferase from Aspergillus fumigatus FtmPT1,14 were AP from Salmonella enterica (PhoNSe) and IPK from Thermoplasma acidophilum (IPKTa). We developed the TMP in vitro as well by first screening the prokaryotic diversity to search for APs and IPKs able to function together at pH 7, using ATP as a phosphorylating agent, while using DMAOH and IOH as substrates. Such screening showed that many enzymes of both classes are catalytically active under these reaction conditions. We demonstrated the in vitro interest of the TMP by selecting two highly active and well-expressed ( Escherichia coli) enzymes: AP from Xanthomonas translucens (PhoNXt) and IPK from Methanococcus vannielii (IPKMv). Together with the prenyl transferase FtmPT1, this threeenzyme cascade allowed the complete in vitro transformation of BF (10 mM, 3.3 g/L) to TB. Here, we thus demonstrate the synthetic potential of the TMP, both in vivo and in vitro, as a third artificial enzymatic pathway to provide bioaccess to terpenes, as an alternative to the classical natural MEV and MEP pathways.

Figure 1. In vivo TMP access to TB using E. coli as a chassis.

In the first experiment to establish the TMP in vivo, we selected E. coli BL21(DE3) as a chassis and introduced two plasmids, pET22b, bearing the f tmPT1 gene, and pRSFDuet-1, bearing the phoNSe or phoNSe (V78L) and ipkTa genes. We added chemically synthesized BF (1 g/L) and DMAOH (1 g/ L) to the culture medium and after isopropyl β-D-1thiogalactopyranoside (IPTG) induction detected the presence of TB by thin-layer chromatography (TLC) and highperformance liquid chromatography (HPLC) after 24 h. There was no transformation without the addition of DMAOH or BF or if the E. coli was not transformed with either one of the plasmids. We improved the transformation of BF by testing various parameters, such as the AP used (PhoNSe, PhoNSe V78L), the cultivation temperature (25, 30, or 37 °C), agitation speed (160 or 200 rpm), the medium used [lysogeny broth (LB) or TB], the optical density (OD) at which the IPTG inductor was added (1, 1.5, 2, or 2.5), the time at which the substrates were added post-induction (0, 0.5, 1, or 2 h), the solvent used to dissolve the BF [dimethylsulfoxide (DMSO), dimethylformamide (DMF), EtOH, dioxane], and addition (+) or not (−) of glycerol (bold values are those which led to better BF to TB transformation, HPLC analysis). All parameters have some importance but the one that most influence the course of the reaction is the time at which substrates are added postinduction, the sooner the better. Combining all these optimal conditions in a single experiment led to the complete

2. RESULTS 2.1. Literature Survey. Setting up the TMP requires two types of biocatalysts: (i) the first enzyme must be able to convert the C5 alcohols DMAOH and IOH into their respective monophosphates (DMAP and IP) and (ii) the second enzyme must be able to transform the resulting monophosphates into the corresponding diphosphates (DMAPP and IPP). In a series of publications dedicated to the biocatalytic use of APs, the group of Wever10,15−17 showed that such monophosphate hydrolytic enzymes are also able to efficiently catalyze the reverse reaction of monophosphate ester synthesis from primary alcohols using diphosphate as a phosphorylating agent. This group has particularly demonstrated the great substrate promiscuity of this type of enzyme, which can accept many primary alcohols as substrates, and one result particularly caught our attention. It has been shown that the nonspecific AP from S. enterica (PhoNSe; Uniprot ID: P26976) as well as its V78L mutant can catalyze the phosphorylation of 3-methyl-1-butanol,10 the hydrogenated derivative of DMAOH and IOH, using diphosphate, suggesting the ability of this type of enzymes to produce the desired 7839


ACS Omega

Article

Figure 2. Preliminary optimization of TB formation. (A) Reaction catalyzed by FtmPT1 as the sole enzyme using chemically synthesized DMAPP and BF. (B) Reaction catalyzed by IPKMv and FtmPT1 enzymes using chemically synthesized DMAP and BF.

DMAOH/IOH kinase activity (see Experimental Section) were, respectively, determined spectrophotometrically and by LC/mass spectrometry (MS) for the PhoN collection. For MS analysis, three optimized multiple reaction monitoring (MRM) transitions were selected for IP (or DMAP) (MRM, transition 245 → 79/227/63). From the 41 selected phosphatases, 29 showed either phosphatase activity or IOH/DMAOH kinase activities (Table S2). Numerous APs were able to generate DMAP/IP from DMAOH/IOH under these targeted conditions. Indeed, as their name indicates, these enzymes are active at acidic pHs,24 and we were unsure whether any AP would be able to work at the neutral pH of our assay. Furthermore, in their reported work,10,15−17 the group of Wever used diphosphate as a phosphorylating agent, whereas we used ATP. X. translucens AP (PhoNXt; Uniprot ID: A0A1C3TIA7) showed the highest DMAOH/IOH kinase activity, and we selected this enzyme for the subsequent experiments. Curiously, phosphatase and kinase activities do not correlate well (Table S2). This is particularly true for the selected PhoNXt for which very high kinase activity is associated with very low phosphatase activity. 2.3.2. Screening of Prokaryote DiversityIsopentenyl Phosphate Kinase. As previously described,21 an IPK collection was built by a sequence-driven approach using four IPKs experimentally described11,19,25 as references. We selected a set of 93 enzymes from the Uniprot database representative of the diversity. From the 40 active IPKs (Table S3), we selected two, one from M. vannielii (IPKMv; Uniprot ID: A6UQT1) and one from Methanolobus tindarius (IPKMt; Uniprot ID: W9DTD1). The corresponding genes were cloned with a histidine tag for purification, and the activity was then determined on purified enzymes with chemically synthesized DMAP and IP using an ATP regeneration system involving PK and lactate dehydrogenase (LDH). The activity was of the same order (4.3 and 8.1 μmol/min/mg for IPKMv and IPKMt, respectively), but as we later found IPKMv to be largely superior in terms of overproduction, it was selected for subsequent experiments. We used the two selected highly active enzymes (PhoNXt and IPKMv) in the TMP, using the same (bio)synthetic pathway that we tested in vivo, integrating the prenyl transferase FtmPT114 into a three-enzyme cascade

transformation of BF after 24 h. We then conducted a preparative experiment using the combined optimized conditions, except that the agitation speed was lowered to 160 rpm, on 110 mg of BF in two 250 mL flasks. After a 24 h incubation, followed by extraction and purification, we recovered 86 mg of TB, corresponding to an isolated yield of 63%. Incubation of TB alone for 24 h in the reaction conditions resulted in loss of approximately half (HPLC analysis), suggesting possible metabolization by E. coli or intrinsic instability of this compound under the conditions used (or both). These first experiments established the TMP to be suitable for in vivo access to terpenes. We next turned our attention to the in vitro development of the TMP. Unfortunately, in our hands, the production of either PhoNSe or PhoNSe V78L in E. coli proved to be very low and was insufficient to conduct such experiments, for which large quantities of enzymes are needed. Encouraged by the results obtained in a recently described research program that tested IPK diversity for IOH and DMAOH double phosphorylation,21 we set up the same type of experiments but using prokaryotic APs. 2.3. In Vitro TMP Proof of Concept. 2.3.1. Screening of Prokaryote DiversityAcid Phosphatases. Setting up the TMP obviously requires that the enzymes constituting the cascade function at the same pH and temperature and possibly use the same phosphorylating agent. In a previous study,21 we screened the prokaryotic diversity for active IPKs at pH 7. These enzymes use ATP as a phosphorylating agent, and we found several very active IPKs under these conditions. We therefore screened the prokaryotic diversity of phosphatases at pH 7.0 and 37 °C that use ATP as a phosphorylating agent to select the most efficient enzymes possible. An AP collection was built by a sequence-driven approach using two class A APs:22 PhoNSe from S. enterica and PhoNSf from Shigella flexneri23 as references. From the 1734 PhoN-like proteins retrieved by sequence similarity from UniprotKB, we selected 41 enzymes representative of the diversity of this enzyme family. We cloned the corresponding genes into an expression vector, overexpressed the enzymes in E. coli BL21(DE3), and tested cell-free extracts at room temperature. Phosphatase activity (using p-nitrophenol phosphate as the substrate) and 7840


ACS Omega

Article

Figure 3. In vitro TMP access to TB involving the acid phosphatase PhoN from X. translucens, an IPK from M. Vannielii, and the prenyl transferase FTmPT1 from A. fumigatus.

Figure 4. First preparative production of TB using the TMP. Kinetic of consumption of BF using FtmPT1, IPKMv, and PhoNXt enzymes.

constant and introduced 20 mM DMAP and ATP to permit the DMAP to DMAPP transformation. The reactions were conducted in Eppendorf tubes, and we found that 70 μg of IPKMv (3 U/mg) per milliliter of the reaction mixture was sufficient to completely transform BF to TB in 1 h. A preparative experiment conducted on 100 mg of BF allowed the complete transformation of BF in 75 min (TLC and HPLC analysis, Figure S2), leading to the isolation of 105 mg of TB after extraction and purification (85% isolated yield). Having established the conditions of use of the two last enzymes of the envisioned cascade, we then integrated the phosphatase PhoNXt to use DMAOH (Figure 3) as the prenyl donor instead of chemically synthesized DMAPP or DMAP. We tested the complete pathway, keeping the previously established parameters constant and introducing 20 mM DMAOH instead of DMAP and increasing the ATP concentration to 40 mM to account for the second phosphorylation step. We conducted the reactions in Eppendorf tubes and obtained the formation of TB, regardless of the quantity of enzyme used. The reaction time was nevertheless longer than that of the previous reactions, as the reaction was still not complete after 24 h. We suspected that the longer reaction time was due to the reversible nature of the PhoNXt-catalyzed reaction, allowing the expected phosphate ester synthesis and also their unwanted hydrolysis. We thus tested the addition of supplementary ATP during the reaction with the aim to improve ATP availability for both IPKMv and PhoNXt. Although the yield of TB increased, the reaction time was still long and the reaction was still not complete after 24 h. We conducted a preparative experiment on 100 mg of BF and stopped the reaction after 24 h (Figure 4). The yield of isolated TB was 79% (98 mg). We studied the influence of PhoNXt in the cascade by first determining whether this enzyme can hydrolyze the phosphorylated species

to generate TB from chemically synthesized BF and enzymatically produce DMAPP. Aromatic prenylation is an active research field26 because many natural products exist as prenylated derivatives and such a modification increases biological activity over that of nonprenylated compounds.27,28 Thus, if successful, the envisioned cascade could be extended to the (bio)synthesis of numerous other natural or non-natural prenylated compounds by simply changing the used prenyl transferase and its substrate. 2.3.3. In Vitro TMP Proof of Concept and Optimization of TB Formation. First, we established the conditions of use of the enzyme FtmPT1 alone at a substrate (BF) concentration of 10 mM, with chemically synthesized DMAPP used as the prenylating agent (Figure 2A). On the basis of the literature,14 we conducted the reaction in 50 mM Tris−HCl buffer, pH 7.5, supplemented with 5 mM MgCl2, at a DMAPP concentration of 20 mM, and BF (10 mM final) dissolved in DMSO (final DMSO concentration 10%) was added. We conducted the reaction in Eppendorf tubes at 37 °C and 1000 rpm and tested the amount of FtmPT1 sufficient to completely transform BF into TB. In this preliminary study, we established that an amount of 0.22 mg of purified FtmPT1 per milliliter of the reaction mixture was sufficient to achieve complete transformation of BF to TB in 1 h. We performed a preparative experiment under the same optimized conditions as above, with 100 mg of BF (Figure 2A). The reaction was stopped after 1 h and total transformation of BF (TLC and HPLC analysis, Figure S1), extracted, and purified, resulting in 113 mg of TB (92% isolated yield). Having established the conditions of use of FtmPT1, we then introduced IPKMv. We tested the two-step cascade to assess the quantity of IPKMv required to completely transform BF to TB with chemically synthesized DMAP (Figure 2B). We kept the previously established parameters 7841


ACS Omega

Article

Figure 5. Second preparative production of TB using the TMP. Kinetic of consumption of BF using FtmPT1, IPKMv, and PhoNXt enzymes.

tion led us to consider one of two ways to optimize the enzymatic cascade, that is, in the presence of a high or low PhoNXt concentration. We further increased the yield of TB by systematically introducing the ATP regeneration system into our experiments and by performing ATP addition at specific times for both the low and high PhoNXt concentrations. At the high PhoNXt concentration, the addition of ATP at 20 and 40 min resulted in the transformation of almost 85% of the BF to TB (HPLC) in 5 h, with an isolated yield for TB of 69% (85 mg). The same reaction conducted at the low PhoNXt concentration, with the addition of ATP at 2 and 4 h, resulted in nearly total conversion of BF to TB in 24 h. A preparative experiment conducted on 100 mg allowed the recovery of 106 mg of TB for an isolated yield of 86% (Figure 5). Thus, the use of a low PhoNXt concentration was beneficial for the catalytic cascade and allowed us to perform the efficient full transformation of BF into TB in 24 h using the TMP.

likely to be formed, which could have a direct impact on the course of the reaction. We thus tested the action of PhoNXt on ATP, ADP, AMP, phosphoenol pyruvate (PEP), DMAP, and DMAPP by 31P NMR monitoring. These compounds all proved to be PhoNXt substrates, which, under the tested conditions, were completely hydrolyzed in less than 2 h. Such hydrolysis could thus account for the observed elongated reaction times and incomplete transformation of BF to TB during catalysis, PhoNXt partly consuming the formed phosphorylated compounds as they are synthesized as well as the initially added phosphate donors. This phenomenon also probably impairs the role of the used ATP regeneration system. Given the major effect of using PhoNXt on the course of the reaction, we attempted to optimize the enzymatic cascade by testing the influence of three parameters: FtmPT1 concentration, PhoNXt concentration, and DMAOH concentration. We also included an ATP recycling system [4 mM ATP, 40 mM PEP, and pyruvate kinase (PK)] to quickly regenerate ATP from ADP to sustain the IPK activity and minimize possible kinase inhibition by ADP. Our rationale was as follows: (i) an increase in PhoNXt concentration could accelerate the formation of DMAP and thus DMAPP, leading to faster synthesis of TB with, however, the risk of faster hydrolysis of the various phosphorylated compounds present in the reaction medium; (ii) a decrease in the PhoNXt concentration could, on the contrary, lead to a decrease in the hydrolysis of the various phosphorylated compounds present in the reaction and thus promote the synthesis of TB, with the risk of slowing the synthesis of DMAP; (iii) an increase in DMAOH concentration could favor the formation of DMAP through PhoNXt catalysis and thus further promote the formation of TB; and (iv) finally, an increase in FtmPT1 concentration should accelerate the use of DMAPP as the prenylating agent, thus lowering its hydrolysis and increasing TB formation. We used a 23 factorial design to test the three chosen parameters at two different levels (values of + or −50% relative to those used in the first experiment using PhoNXt with added ATP). The results showed two important facts: (i) an increase in PhoNXt concentration increased the initial rate of formation of TB but the enzymatic cascade stopped earlier (after 1−2 h) because of a probable lack of ATP required for the reaction catalyzed by IPKMv. A maximum yield of TB approaching 40% (HPLC) was obtained for the highest FtmPT1 and DMAOH concentrations; (ii) in the presence of the lowest amount of PhoNXt, the reaction was slower, but IPKMv and FtmPT1 were able to work longer and a yield of approximately 50% was obtained after 5 h once again for the highest FtmPT1 and DMAOH concentrations. This informa-

3. DISCUSSION Here, we addressed the question of whether it is possible to conduct terpene (bio)synthesis outside the canonical MEV and MEP pathways, either in vivo or in vitro. Following an earlier literature review, we first selected the already described AP PhoNSe and its mutant PhoNSe V78L as well as IPKTa to establish the TMP in vivo. We demonstrated the interest of this potentially very useful pathway to terpene by selecting a three-enzyme cascade to establish the proof of concept. We succeeded in completely transforming BF to prenylated TB, a cytotoxic compound, on a 1 g/L scale by adding the chemically synthesized diketopiperazine BF into the culture medium and introducing the gene encoding the prenyl transferase FtmPT1 into E. coli, as well as the genes coding for the previously mentioned PhoNSe (WT or V78L) and IPKTa. Having established the in vivo proof of concept, we then turned to in vitro experiments. We screened the prokaryotic diversity for highly active APs and IPKs that can work together at pH 7 at room temperature, using ATP as a common phosphorylation agent. We found a large panel of activities for both enzymes and selected two from this screening (PhoNXt and IPKMv) based on their high activities and ease of production. We tested them in the same three-enzyme cascade developed in vivo, with BF being added to the reaction mixture and TB as the final compound of the cascade. The main concern when using an AP is the already reported fact that these enzymes are able to catalyze both the forward (monophosphate synthesis) and reverse (monophosphate hydrolysis) reactions. This scheme was further complicated in our case, as we showed that every phosphate 7842


ACS Omega

Article

structures other than prenylated aromatics, and work is underway to fully exploit its synthetic potential by coupling it to terpene synthases. During the writing of this article, two groups independently published studies32,33 based on the same principle of simplified access to IPP and DMAPP from IOH and DMAOH. The enzymes used to perform the two successive phosphorylations were Saccharomyces cerevisiae choline kinase and E. coli IPK in one case32 and an AP from S. flexneri and the IPK from T. acidophilum in the other.33 In both cases, the TMP was implemented in vivo (E. coli) and lycopene and taxadiene production was used to assess the usefulness of the new pathway called the IUP (IOH utilization pathway),32 on the one hand, and lycopene and prenylated tryptophan33 on the other. Together with these two pioneering studies, our study confirms, through the production of TB, that the TMP is useful in vivo to access various terpenes and that it is also of great potential utility in vitro (our work). We are convinced that the TMP will attract interest from the chemical community for easy access to terpene structures of varying complexity.

derivative potentially present in the reaction solution was also susceptible to hydrolysis by AP. These unwanted hydrolytic reactions thus rendered the in vitro process of optimization more complex and necessitated more than stoichiometric amounts of the ATP cofactor to reach high yields. It is probable that ADP and AMP formed during AP phosphorylation, from ATP and ADP, respectively, also participated in the phosphorylation of DMAOH into DMAP by phosphorylating AP. The use of ATP offers thus three opportunities to phosphorylate AP, probably helping to extend the synthesis of TB. It is also possible that AMP, ADP, and ATP were resynthesized from adenosine, AMP, and ADP, respectively, present in the reaction medium from phosphorylated AP. Thus, the latter are probable competitors of DMAOH for access to the phosphate group present in the phosphorylated AP active site. Despite these drawbacks, we were able to optimize the process using an ATP regeneration system and completely transform BF into TB at the 10 mM scale, proving the usefulness of the TMP in vitro to access such an interesting compound. This study is the first to describe the in vitro biocatalytic synthesis of TB on the 100 mg scale and constitutes an interesting alternative to the very recently published chemical synthesis of TB.29 Concerning in vivo access to TB, the TMP compares favorably (>750 mg/L of TB) with an already published study (250 mg/L of TB).30 However, in the published study, the biosynthesis started from tryptophan and proline, which were enzymatically combined into BF in cellulo, and not from chemically synthesized BF, as in our case.

5. EXPERIMENTAL SECTION 5.1. Chemicals. Solvents were of analytical grade. DMAOH, IOH, tetrabutylammonium phosphate, PEP, NADH, malachite green oxalate salt, AMP, ADP, ATP, benzonase, inorganic pyrophosphatase (PPase) from S. cerevisiae, PK, and a mix of PK and LDH were from SigmaAldrich. Nα-Carbobenzyloxy-L-tryptophan (Z-Trp-OH), Lproline methyl ester hydrochloride (H-Pro-OMe-HCl), hydroxybenzotriazole (HBT), N-ethyl-N′-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl), and diisopropyl ethyl amine were from TCI. Buffer A consisted of a Tris−HCl 50 mM, pH 7.5 buffer solution containing 5 mM MgCl2. Dimethylallyl phosphate (DMAP), IP, DMAPP, and IPP were chemically synthesized according to Lira et al.34 starting from commercially available DMAOH and IOH. Briefly, a solution of 631 mg of DMAOH or IOH (7.3 mmol) and 1.7 mL of trichloroacetonitrile in 10 mL of acetonitrile were placed in a 100 mL round-bottom flask under agitation. A solution of 5 g of tetrabutylammonium phosphate (14.7 mmol) in 40 mL of acetonitrile was slowly added, and the reaction mixture was left for 2 h under agitation at room temperature. Then the reaction mixture was evaporated under reduced pressure and recovered in a minimum of a 7/2/1 isopropanol/NH4OH/ water mixture. Formed DMAP (IP) and DMAPP (IPP) were purified by silica gel flash chromatography using the same solvent system. DMAP and DMAPP (IP and IPP) containing fractions were pooled separately, and the solvents were evaporated. Both monophosphate and diphosphate derivatives were then cation-exchanged over NH4+-DOWEX-50 ion exchange resin, and fractions containing the ammonium form of either monophosphate or diphosphate were combined and lyophilized. DMAP, IP, DMAPP, and IPP were finally purified over cellulose using an isopropanol/acetonitrile/NH4·CO3H 0.1 M, 4.5/2.5/3 solvent system. After purification, the organic solvents were evaporated, and the resulting aqueous solution was lyophilized affording white powders (average isolated yield in monophosphate 30%, in diphosphate 6%). Structural assignment and purity were assessed by 1H, 13C, and 31P NMR spectroscopy. DMAP·2NH4: RMN 1H (D2O, 300 MHz): δ 5.35 (t, J = 7.2 Hz, 1H), 4.70 (br s, 8H), 4.26 (ap t, J = 6.6 Hz, 2H), 1.70 (br s, 3H), 1.65 (br s, 3H); RMN 13C

4. CONCLUSIONS Here, we have developed a new process for not only in vivo but also in vitro bioaccess to terpenes that complements the two natural MEV and MEP pathways. The use of DMAOH and IOH in the TMP, instead of glucose in the MEP and MEV pathways, offers intrinsic advantages, such as decoupling the carbon and energy sources and a drastic reduction in the number of individual enzymatic steps required to produce DMAPP and IPP (2 instead of 18). Both advantages hold promise in simplifying the optimization of DMAPP and IPP synthesis and thus in accelerating the optimization of terpene production. Another advantage of the TMP is that it can be conducted in vitro as well as in vivo, as the optimization of in vitro reactions will offer highly useful information for in vivo reaction optimization, such as the best relative enzyme activities or best substrate ratios and concentrations. We demonstrate that the TMP constitutes a viable alternative to total chemical synthesis or already developed chemoenzymatic synthesis of prenylated aromatics. It is noteworthy that exclusive enzymatic synthesis of TB is feasible starting from tryptophan and proline, using a dedicated NRPS,30 especially for the in vivo process. Here, we have established simplified bioaccess to prenylated compounds without requiring the tedious and poorly sustainable chemical synthesis of DMAPP. Importantly, we performed TMP-aided synthesis of TB without any genetic manipulation, except for plasmid introduction into E. coli, probably leaving significant space for improvement in both isolated and volumetric yields. Indeed, as DMAPP and IPP have a deleterious effect on E. coli,31 the precise control of DMAPP/IPP production and utilization is probably key for the in vivo development and optimization of the TMP. Finally, the TMP is of course of high potential interest for the production of a wide range of terpene 7843


ACS Omega

Article

(D2O, 75.47 MHz): δ 139.2, 119.6 (d, J = 7.8 Hz), 61.6 (d, J = 4.6 Hz), 24.9, 17.2; RMN 31P (D2O, 121.49 MHz): δ 2.2. DMAPP·3NH4: RMN 1H (D2O, 300 MHz): δ 5.38 (t, J = 6.5 Hz, 1H), 4.70 (br s, 12H), 4.39 (ap t, J = 6.2 Hz, 2H), 1.70 (br s, 3H), 1.65 (br s, 3H); RMN 13C (D2O, 75 MHz): δ 140.0, 120.3 (d, J = 7.7 Hz), 62.7 (d, J = 4.6 Hz), 24.9, 17.3; RMN 31 P (D2O, 121.49 MHz): δ −8.5, −10.4. BF was synthesized according to Torres-Garciá et al.35 with yields ranging from 51 to 85%. RMN 1H (CDCl3, 300 MHz): δ 8.33 (br s, 1H), 7.59 (d, J = 7.9 Hz, 1H), 7.39 (d, J = 8.1 Hz, 1H), 7.08−7.26 (m, 3H), 5.75 (br s, 1H), 4.37 (dd, J = 2.8, 10.7 Hz, 1H), 4.07 (tr, J = 7.1 Hz, 1H), 3.75 (ddd, J = 0.8, 3.7, 15.1 Hz, 1H), 3.70−3.52 (m, 2H), 2.98 (dd, J = 15.1, 10.7 Hz, 1H), 2.27−2.38 (m, 1H), 2.10−1.82 (m, 3H). RMN 13C (CDCl3, 75.47 MHz): δ 169.3, 165.5, 136.7, 126.7, 123.3, 122.8, 120.0, 118.5, 111.6, 110.0, 59.2, 54.6, 45.4, 28.3, 26.8, 22.6. 5.2. In Vivo Use of the TMP. 5.2.1. AP and IPK Cloning in pRSFDuet-1. The genes coding for the APs from S. enterica (phoNSe and phoNSe V78L)10 and IPK of T. acidophilum (ipkTa) were amplified by polymerase chain reaction (PCR) with their corresponding primers (KpnI_PhoNSe_fw: 5′-GTCGGTACCATGAAAAGCCGCTATCTG-3′; XhoI_PhoNSe_rv: 5′AGACTCGAGATTCAGTTTCGGGTGATCTTC-3′; HindIII_IPKTa_fw: 5′-CGACAAGCTTATGATGATACTGAAGATAG-3′; NotI_IPKTa_rv: 5′-TATGCGGCCGCTCATCTTATCACCGTACCTATG-3′). The PCR products were subsequently restricted HindIII/NotI or KpnI/XhoI and sequentially subcloned into pRSFDuet-1 (described to be at a level of >100 copies per cell) from Novagen, linearized with the same enzyme(s), thus generating the pRSF_AP_IPK plasmids (pRSF_phoNSe_ipkTa and pRSF_phoNSe V78L_ipkTa) used for in vivo experiments. 5.2.2. Strain Construction. E. coli BL21(DE3) strain was cotransformed with plasmids pRSF_AP_IPK and pET-PT1 bearing the corresponding phoNSe and ipkTa genes and the f tmPT1 gene, respectively. Recombinant clones were selected on LB (plates supplemented with 100 μg/mL ampicillin and 50 μg/mL kanamycin). Selected clones were restreaked onto a fresh plate, and an isolated colony was used to start the below described protocol. 5.2.3. Small-Scale Culture and Test of AP and IPK Combination. Isolated clones bearing both pRSF_AP_IPK and pET-PT1 were first used to inoculate 5 mL of LB medium supplemented with ampicillin and kanamycin. The tubes were incubated overnight on an orbital shaker (37 °C, 200 rpm). Then 500 μL of this preculture was used to inoculate 5 mL of LB medium. When an OD of 2 was reached, IPTG (final concentration 1 mM) as well as 500 μL of a 1/1 water/glycerol mixture and 50 μL of a DMF solution containing 5.5 mg of BF and 5 μL of DMAOH was added. The culture was further incubated at 37 °C and 200 rpm for 24 h, while aliquots were withdrawn time to time and analyzed by TLC (ethyl acetate/ MeOH, 9/1) and HPLC. 5.2.4. Small-Scale Culture and Optimization. By using the same experimental protocol as described above, the following parameters were tested: AP (PhoNSe, PhoNSe V78L), cultivation temperature (25, 30, 37 °C), agitation (160, 200 rpm), used medium [LB or TB (terrific broth)], the OD at which IPTG inductor is added (1, 1.5, 2, 2.5), the time at which substrates are added post-induction (0, 0.5, 1, 2 h), the solvent used to dissolve BF (DMSO, DMF, ethanol, dioxane) and addition (+) or no addition (−) of glycerol.

5.2.5. Preparative Scale Culture. Isolated clones bearing a plasmid coding PhoNSe (V78L) and IPKTa (pRSF_AP_IPK) and a plasmid coding FtmPT1 (pET-PT1) were first used to inoculate 2 × 5 mL of LB medium supplemented with ampicillin and kanamycin. The tubes were incubated overnight on an orbital shaker (37 °C, 200 rpm). Then these two precultures were used to inoculate two 250 mL flasks containing 50 mL of LB medium supplemented with ampicillin and kanamycin. The flasks were incubated at 37 °C and 160 rpm, and after reaching an OD of 2, IPTG (final concentration 1 mM) as well as 5 mL of a 1/1 water/glycerol mixture and 500 μL of a DMF solution containing both 55 mg of BF and 50 μL of DMAOH was added in each flask. The culture was further incubated at 37 °C and 160 rpm for 24 h, while aliquots were withdrawn time to time and analyzed by TLC and HPLC. After 24 h, the reaction mixtures were combined and extracted with ethyl acetate (3 × 100 mL), and the organic phases were washed with water and dried over anhydrous sodium sulfate. After filtration and removal of the solvent under reduced pressure, TB was purified over silica gel (ethyl acetate/MeOH, 9/1) affording 86 mg of pure TB (63% isolated yield). RMN 1 H (CDCl3, 300 MHz): δ 8.42 (br s, 1H), 7.46 (d, J = 7.5 Hz, 1H), 7.27 (d, J = 7.8 Hz, 1H), 7.09 (m, 2H), 5.71 (br s, 1H), 5.28 (t, J = 7.0 Hz, 1H), 4.35 (dd, J = 10.8, 2.7 Hz, 1H), 4.01 (t, J = 7.4 Hz, 1H), 3.72−3.35 (m, 5H), 2.96 (dd, J = 15.0, 11.1 Hz, 1H), 2.34−2.22 (m, 1H), 2.06−1.79 (m, 3H), 1.74 (s, 3H), 1.72 (s, 3H). RMN 13C (CDCl3, 75.47 MHz): δ 169.3, 165.9, 136.6, 135.6, 135.0, 128.0, 121.7, 120.0, 119.8, 117.7, 110.9, 104.5, 59.3, 54.7, 45.4, 28.3, 25.7, 25.7, 25.2, 22.6, 18.0. 5.3. In Vitro Use of the TMP. 5.3.1. Acid Phosphatase from Diversity. A sequence-driven approach36 has been applied using experimentally described enzymes. Two PhoN (PhoN from S. enterica (Uniprot ID: P26976) and from S. flexneri [Uniprot ID: Q7BEK9)] were used as the reference for AP collection. Primers were chosen for 41 PhoN-like genes corresponding to the proteins selected from the UniProt database. Genes were cloned with a histidine tag in the Nterminal part in a pET22b(+) (Novagen) modified for ligation independent cloning as already described.37 All primers and strains are listed in Table S1 (phoN-like genes). All the strains along with their identifiers were purchased from DSMZ collection. Each expression plasmid was transformed into E. coli BL21-CodonPlus (DE3)-RIPL. Cell culture, induction of protein production, and cell lysis were conducted as previously published37 in 96-well microplates. The storage lysis buffer was Tris 50 mM, pH 6.8, NaCl 50 mM, and glycerol 15%, 0.2 μL Lysonase Bioprocessing Reagent (Novagen) and Pefabloc 1 mM. The sample was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using the NuPAGE system (Invitrogen). After centrifugation and recovery of the supernatant, the induction of the protein was checked by E-PAGE 8% protein gels, 48-well system from Invitrogen. Protein concentration was determined by the Bradford method, with bovine serum albumin as the standard (Bio-Rad). 5.3.2. Enzymatic Screening by LC/MS Analysis. Biochemical assays were performed in 96-well microplates. Enzyme assays were performed in a final volume of 100 μL containing 2-(N-morpholino)ethanesulfonic acid (MES) buffer 50 mM, pH 6.0, 10 mM substrates (IOH and DMAOH), ATP 2.5 mM, MgCl2 5 mM, PEP 5 mM, PK 1 U, and 3 μL cell lysate (0.05− 0.1 mg/mL of total proteins). Coupled enzymatic system with 7844


ACS Omega

Article

CATGTCCGCGTTCCCCGCCTTGC-3′ and 5′GTGTAATGGATAGTGATCTTAATGGTGATGGTGATGATGCAGCGCGCTGGCTGGCCG-3′ as primers into pET22LIC-G12. 5.3.3.2. Enzyme Expression. Tubes (one for IPK and PhoN proteins, two for FtmPT1) filled with 5 mL of LB medium supplemented with ampicillin (100 μg/mL) were inoculated with recombinant isolated E. coli BL21(DE3) clones and grown overnight (37 °C, 180 rpm). These tubes were used to inoculate a 2 L flask for IPKMv and PhoNXt and a 5 L flask for FtmPT1 filled with 500 mL and 1 L of LB medium supplemented with ampicillin (100 μg/mL), respectively. Flasks were incubated at 37 °C and 180 rpm for 2 h (OD600 between 0.4 and 0.6), and the culture was induced by the addition of 500 μL (IPKMv and PhoNXt expression) and 1 mL (FtmPT1 expression) of a 1 M stock solution of IPTG (final concentration 1 mM) and incubated overnight at 37 °C and 200 rpm for FtmPT1 while 16 °C and 190 rpm for IPK and PhoN protein expression. 5.3.3.3. Purification. After 22 h, the cultures were centrifuged, and the pellets were rinsed in 40 mL (for IPK and PhoN proteins) and 80 mL (for FtmPT1 protein) of purification buffer. Purification buffer used for FtmPT1 and IPKMv was NPI-10 buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0), whereas NP buffer (50 mM NaH2PO4, 300 mM NaCl, pH 8) was used for PhoN proteins. The pellets were rinsed again with purification buffer supplemented with lysozyme (final concentration 1 mg/mL) and benzonase (1 U per 0.8 ODU, stock solution at 250 U/ μL) before cell breaking (constant cell disruption system, 1.3 kbar). The resultant suspension is further centrifuged (10 000g, 4 °C, 30 min), and the supernatant was recovered and loaded on an open Ni-NTA column previously equilibrated with purification buffer. Elution was conducted with 50−250 mM imidazole gradient in the same NP buffer. Fractions containing the purified enzyme were pooled and desalted by gel filtration with a prepacked PD-10 column (Sephadex G-25 resin, GE Healthcare, buffer A). Protein purity was checked by SDSPAGE analysis. Protein quantification was conducted at 280 nm (Nanodrop 2000c, Thermo Scientific) with the following parameters (Expasy ProtParam): (i) for FtmPT1 MM = 53.66 kDa and extinction coefficient ε = 71 400 cm−1·M−1; (ii) for IPKMv MM = 30 kDa and extinction coefficient ε = 27 055 cm−1·M−1; and (iii) for PhoNXt MM = 31.3 kDa and extinction coefficient ε = 28 210 cm−1·M−1. For long-term conservation, glycerol is added (15% final concentration), and the protein solution was stored at −20 °C. 5.3.3.4. Enzymatic Activity. FtmPT1 activity was determined by the Malachite green assay38 linked to the capacity of FtmPT1 to generate diphosphate. The colorimetric assay was conducted in Eppendorf tubes in a final volume of 1 mL consisting of 2 μL of serial dilutions of the protein (from 0.3 to 0.01 μM), 2 μL of a BF solution (100 μM DMSO), 2 μL of DMAPP solution (100 μM in buffer A), and 0.2 U of inorganic pyrophosphatase from S. cerevisiae. Then, 754 μL of malachite green assay buffer (MES 25 mM, CAPS 25 mM, Tris 50 mM, MgCl2 5 mM, pH 7.5) was added in order to reach 760 μL. Standard curves (0.01−12.5 μM) were obtained from various dilutions of sodium phosphate and pyrophosphate stock solutions. Reactions were set up on ice and then incubated at 30 °C for 30 min. Enzymatic reactions were quenched by addition of 240 μL of the malachite green development solution (freshly prepared by mixing 10 mL of malachite green

PK was added in order to avoid potential ADP inhibition on kinase activity. Assays were performed overnight at room temperature, and then reactions were stopped by adding 1% trifluoroacetic acid. After centrifugation, a 1/20 dilution was done before LC/MS injection by transferring 10 μL of each well of acidified reaction media in 190 μL of mobile phase (80% acetonitrile) and 20% aqueous phase 10 mM (NH4)2CO3 in a 96-well daughter microplate. The standards were prepared as described above replacing enzyme cell lysate by E. coli BL21(DE3) blank cell lysate. The detection of IP or DMAP was performed by the LC/ electrospray ionization (ESI)-MS method using a Dionex UltiMate TCC-3000RS chromatographic system (Thermo Fisher Scientific, Courtaboeuf, France) coupled to a hybrid triple quadrupole linear ion trap mass spectrometer (QTRAP 5500 from ABSciex, Courtaboeuf, France) equipped with a HESI source. HPLC separation was achieved on a Sequant ZICpHILIC column 5 μm, 2.1 × 100 mm (Merck, Darmstadt, Germany) thermostated at 15 °C. The mobile phase flow rate was set at 0.2 mL/min, and injection volume was 3 μL. Phase A was the aqueous solution of 10 mM (NH4)2CO3 at the pH adjusted to 9.5 with NH4OH and organic phase B was acetonitrile. The following gradient conditions were applied: 0.5 min equilibration step at 80% of phase B; 4.5 min linear gradient from 80 to 40% of phase B; 2.5 min isocratic elution at 40% of phase B, return to 80% of phase B in 2 min, and a reconditioning step of 6 min. For MS analysis, MRM in the negative ionization mode was applied. Three optimized MRM transitions were selected for IP (or DMAP): 245 → 79/227/63. The data processing was performed using Analyst software 1.5.1 (ABSciex). Quantification of product formation was calculated using the reference compounds. On each microtiter plate, E. coli cell lysate was used as negative control. Enzymes were considered as positive when the signal was at least 3-fold higher than that of the negative control. PhoNXt phosphatase activity was determined by the p-nitrophenyl phosphate (pNPP) phosphatase assay (see below). 5.3.3. Candidate Enzyme Production. 5.3.3.1. Cloning. The sequence of the prenyl transferase f tmPT1 gene14 from A. fumigatus was codon-optimized for E. coli overproduction and obtained from GeneArt, Thermo Fisher Scientific. The gene f tmpt1 was PCR-amplified with primers XhoI_STOP_FtmPT1_pET22bTER: 5′-gtgCTCGAGGTTCGGAAAGCTCACATCACC-3′ and AseI_ATG_FtmPT1: 5′tataATTAATatgCCTCCGGCACCG-3′ using Platinum Taq DNA Polymerase High Fidelity (ThermoFisher Scientific). The PCR product was digested by AseI and XhoI and inserted into pET22b(+) previously digested by NdeI and XhoI. The recombinant plasmid, pET-PT1, bears ftmpt1 gene under the control of T7 promoter with a six-histidine tag in C-terminal. The ipkMv and phoNXt genes were recloned with a sixhistidine tag in N-terminal and C-terminal parts, respectively, in the expression vector pET22b(+) (Novagen) modified for ligation independent cloning as already described.36 The gene of kinase IPKMv from M. vannielii (IPKMv; Uniprot ID: A6UQT1) was cloned with the histidine tag in N-terminal into pET22LIC-A3 as described previously.21 The AP PhoN from X. translucens (PhoNXt; Uniprot ID: A0A1C3TIA7) contains a signal peptide, and the corresponding gene was then recloned with the histidine tag in the Cterminal using 5′-AAAGAAGGAGATAGGAT7845


ACS Omega

Article

were added various amounts of buffer A in order to reach a final volume of 1 mL. Then, 100 μL of a stock solution of 100 mM BF in DMSO, 100 μL of a stock solution of 200 mM DMAP in buffer A, and 100 μL of a stock solution of 200 mM ATP in buffer A were added. The tubes were vortexed and placed for 5 min in a dry bath at 37 °C. Then, 100 μL of a 2.2 mg/mL purified FtmPT1 solution in buffer A as well as various amounts (0, 1, 2, 5, and 10 μL) of a 10.3 mg/mL purified IPKMv solution in buffer A (specific activity 3 U/mg) was added. The tubes were placed at 37 °C under agitation (1000 rpm) for 24 h. Samples (100 μL) were regularly withdrawn and analyzed by TLC and HPLC for TB formation. 5.5.2. Large-Scale Synthesis of TB from BF and DMAP Catalyzed by FtmPT1 Prenyl Transferase and IPKMv. In a 100 mL round-bottom flask, 140 mg of DMAP (0.8 mmol) was weighed and then dissolved in 24.3 mL of buffer A under magnetic agitation. Then, 3.5 mL (0.7 mmol) of a 200 mM ATP solution in buffer A and 100 mg of BF dissolved in 3.5 mL of DMSO (0.35 mmol) were added, and the solution was left for 15 min at 37 °C (oil bath). The reaction was started by the addition of 3.5 mL of a 2.2 mg/mL purified FtmPT1 solution in buffer A and 0.2 mL of a 10.3 mg/mL purified IPKMv solution in buffer A and left at 37 °C under agitation (400 rpm) for 1 h. Samples (100 μL) were regularly withdrawn and analyzed by TLC and HPLC for TB formation. After 75 min, the reaction mixture was extracted with ethyl acetate (3 × 50 mL), and the organic phases were washed with water and dried over anhydrous sodium sulfate. After filtration and removal of the solvent under reduced pressure, TB was purified over silica gel (ethyl acetate/MeOH, 9/1) affording 105 mg of pure TB (85% isolated yield). 5.6. Biocatalytic Formation of TB from BF and DMAOH. 5.6.1. Optimization of Small-Scale Synthesis of TB from BF and DMAOH Catalyzed by FtmPT1 Prenyl Transferase, IPKMv, and Various Amounts of PhoNXt. In three 1.5 mL Eppendorf tubes were added various amounts of buffer A in order to reach a final volume of 1 mL. Then, 50 μL of a stock solution of 200 mM BF in DMSO and 50 μL of a stock solution of 400 mM DMAOH in DMSO were added. A stock solution (200 μL) of 200 mM ATP in buffer A was added, and the tubes were then vortexed and placed for 5 min in a dry bath at 37 °C. The reactions were started by the addition of 113 μL of a 2.4 mg/mL solution of purified FtmPT1 in buffer A, 5.8 μL of a 8.6 mg/mL solution of purified IPKMv in buffer A, and various amounts (35, 85, and 170 μL) of a 0.5 mg/mL solution of purified PhoNXt in buffer A. The tubes were then placed at 37 °C under agitation (800 rpm) for 24 h. A stock solution (75 μL) of 200 mM ATP at 2 and 6 h was added during the reaction. Samples were regularly withdrawn and analyzed by TLC for TB formation. 5.6.2. First Large-Scale Synthesis of TB from BF and DMAOH Catalyzed by FtmPT1 Prenyl Transferase, IPKMv, and PhoNXt. In a 100 mL round-bottom flask, 1.75 mL of a stock solution of 400 mM DMAOH in DMSO and 7 mL of a stock solution of 200 mM ATP in buffer A were added to 14.6 mL of buffer A. Then, 100 mg of BF dissolved in 3.5 mL of DMSO (0.35 mmol) was added, and the solution was left for 15 min at 37 °C (oil bath). The reaction was started by the addition of enzymatic solutions in buffer A: 6 mL of a 1.6 mg/ mL purified FtmPT1 solution (specific activity 0.5 U/mg), 220 μL of a 7 mg/mL purified IPKMv solution (specific activity 4 U/mg), and 1.9 mL of a 0.3 mg/mL purified PhoNXt solution (specific activity 0.9 U/mg) and left at 37 °C under agitation

dye stock solution with 2.5 mL of 7.5% ammonium molybdate and 0.2 mL 11% Tween 20) and incubated for 15 min at room temperature before readings at 623 nm (Nanodrop 2000c, Thermo Scientific). The malachite green dye stock solution was prepared by mixing 300 mL of 18 M sulfuric acid stock solution and 1.5 L of water. The solution was cooled down to room temperature, and then malachite green oxalate salt (2.2 g) was added. IPK activity was determined by the PK-LDH assay in Eppendorf tubes by quantification at 340 nm of the NADH consumption during the enzymatic reaction. The total reaction volume was 1 mL consisting of buffer A, fixed concentrations of ATP and PEP (4 mM), NADH (210 μM), KCl (100 mM), and IP (1 mM) all dissolved in buffer A, 5 μL of a commercial mix of PK (3−5 U) and LDH (4.5−7 U), and 20 μg of purified IPKMv. The OD at 340 nm was measured each 5 s for 2 min (Nanodrop 2000c, Thermo Scientific). The obtained negative slope was used to determine IPK activity (ε = 6220 cm−1·M−1 for NADH). Phosphatase activity was determined by the pNPP phosphatase assay by quantification at 402 nm of pNPP production during the enzymatic reaction. The total reaction volume was 1 mL consisting of 500 μL of a 1 M stock solution of pNPP in buffer A and 40 μg of purified PhoNXt completed with buffer A. The OD at 402 nm was measured each 5 s for 2 min (Nanodrop 2000c, Thermo Scientific). The obtained slope was used to determine phosphatase activity (ε = 12 900 cm−1·M−1 for p-nitrophenol). 5.4. Biocatalytic Formation of TB from BF and DMAPP. 5.4.1. Optimization of Small-Scale Synthesis of TB from BF and DMAPP Catalyzed by Various Amounts of FtmPT1 Prenyl Transferase. In five 1.5 mL Eppendorf tubes were added various amounts of buffer A in order to reach a final volume of 1 mL. Then 100 μL of a stock solution of 100 mM BF in DMSO and 100 μL of a stock solution of 200 mM DMAPP in buffer A were added. The tubes were then vortexed and placed for 5 min in a dry bath at 37 °C. Various amounts (0, 10, 25, 50, and 100 μL) of a 2.2 mg/mL purified FtmPT1 solution in buffer A were then added, and the tubes were placed at 37 °C under agitation (1000 rpm) for 24 h. Samples (100 μL) were regularly withdrawn and analyzed by TLC (ethyl acetate/MeOH, 9/1) and HPLC for TB formation. 5.4.2. Large-Scale Synthesis of TB from BF and DMAPP Catalyzed by FtmPT1 Prenyl Transferase. In a 100 mL roundbottom flask, 238 mg of DMAPP (0.8 mmol) was weighed and then dissolved in 28 mL of buffer A under magnetic agitation. Then, 100 mg of BF dissolved in 3.5 mL of DMSO (0.35 mmol) was added, and the solution was left for 15 min at 37 °C (oil bath). The reaction was started by the addition of 3.5 mL of a 2.2 mg/mL purified FtmPT1 solution in buffer A and left at 37 °C under agitation (400 rpm) for 1 h. Samples (100 μL) were regularly withdrawn and analyzed by TLC and HPLC for TB formation. After 1 h, the reaction mixture was extracted with ethyl acetate (3 × 50 mL), and the organic phases were washed with water and dried over anhydrous sodium sulfate. After filtration and removal of the solvent under reduced pressure, TB was purified over silica gel (ethyl acetate/MeOH, 9/1) affording 114 mg of pure TB (92% isolated yield). 5.5. Biocatalytic Formation of TB from BF and DMAP. 5.5.1. Optimization of Small-Scale Synthesis of TB from BF and DMAP Catalyzed by FtmPT1 Prenyl Transferase and Various Amounts of IPKMv. In five 1.5 mL Eppendorf tubes 7846


ACS Omega

Article

After 24 h, the reaction mixture was extracted with ethyl acetate (3 × 50 mL), and the organic phases were washed with water and dried over anhydrous sodium sulfate. After filtration and removal of the solvent under reduced pressure, TB was purified over silica gel (ethyl acetate/MeOH, 9/1) affording 85 mg of pure TB (69% isolated yield). 5.6.6. Optimized Large-Scale Synthesis of TB from BF and DMAOH Catalyzed by FtmPT1 Prenyl Transferase, IPKMv, and Low PhoNXt Concentration. In a 100 mL round-bottom flask, 2.6 mL of a stock solution of 400 mM DMAOH in DMSO and 7 mL of a stock solution of 200 mM ATP in buffer A were added to 16.8 mL of buffer A. BF (100 mg) dissolved in 3.5 mL of DMSO (0.35 mmol) was added, and ATP recycling system was implemented, thanks to the addition of 3.5 mL of a stock solution of 400 mM PEP and 1.75 mL of commercial PK. Then, the solution was left for 15 min at 37 °C (oil bath). The reaction was started by the addition of enzymatic solutions in buffer A: 664 μL of a 5.1 mg/mL purified FtmPT1 solution (specific activity 2 U/mg), 627 μL of a 0.9 mg/mL purified IPKMv solution (specific activity 16 U/ mg), and 317 μL of a 1.9 mg/mL purified PhoNXt solution (specific activity 1.8 U/mg) and left at 37 °C under agitation (400 rpm) for 24 h. A stock solution (2.6 mL) of 200 mM ATP was added at 2 and 4 h during the reaction. Samples (100 μL) were regularly withdrawn and analyzed by TLC and HPLC for TB formation. After 24 h, the reaction mixture was extracted with ethyl acetate (3 × 50 mL), and the organic phases were washed with water and dried over anhydrous sodium sulfate. After filtration and removal of the solvent under reduced pressure, TB was purified over silica gel (ethyl acetate/MeOH, 9/1) affording 106 mg of pure TB (85% isolated yield). 5.7. HPLC Analysis. HPLC analysis was performed after dilution of 100 μL sample with 200 μL stock solution of indole (in vitro) or dimethyl-indole (in vivo) in acetonitrile. Samples (5 μL) were analyzed by reverse-phase HPLC on a KNAUER PLATINblue system equipped with a diode array detector and a MACHEREY-NAGEL Nucleodur C18-Gravity-SB column (100 mm × 2 mm, 1.8 mm) thermostated at 50 °C, and multidetection at 210, 230, 260, and 280 nm was performed. The eluent consisted of a 60/40 H2O/MeOH mixture delivered at 0.3 mL/min. Retention times: BF 2.3 min, indole 4.0 min, and dimethyl-indole 12.9 min and TB 16.0 min. Calibration curve (at 280 nm) was realized using chemically synthesized BF.

(400 rpm) for 24 h. A stock solution (2.6 mL) of 200 mM ATP at 2 and 6 h was added during the reaction. Samples (100 μL) were regularly withdrawn and analyzed by TLC and HPLC for TB formation. After 24 h, the reaction mixture was extracted with ethyl acetate (3 × 50 mL), and the organic phases were washed with water and dried over anhydrous sodium sulfate. After filtration and removal of the solvent under reduced pressure, TB was purified over silica gel (ethyl acetate/MeOH, 9/1) affording 98 mg of pure TB (79% isolated yield). 5.6.3. PhoN Xt Activity on Various Phosphorylated Compounds by 31P NMR Monitoring. In six 2 mL Eppendorf tubes were added various amounts of buffer A in order to reach a final volume of 1.5 mL. Then, 150 μL of a stock solution of 200 mM ATP, ADP, AMP, DMAP, or DMAPP in buffer A was added. In the case of PEP, 75 μL of a 400 mM stock solution in buffer A was added. The tubes were then vortexed and placed for 5 min in a dry bath at 37 °C. The reaction was started by the addition of 102 μL of a 0.6 mg/mL purified PhoNXt solution in buffer A and left at 37 °C under agitation (800 rpm) for 24 h. Samples (300 μL) were regularly withdrawn and mixed with 300 μL of DMSO-d6 for 31P NMR monitoring. 5.6.4. Optimization of Small-Scale Synthesis of TB from BF and DMAOH Catalyzed by FtmPT1 Prenyl Transferase, IPKMv, and PhoNXt Using ATP Recycling System and Design of Experiments. In nine 1.5 mL Eppendorf tubes were added 50 μL of a stock solution of 200 mM BF in DMSO, 20 μL of a stock solution of 200 mM ATP in buffer A, and various amounts of buffer A in order to reach a final volume of 1 mL. Then various amounts (25, 50, and 75 μL) of a stock solution of 400 mM DMAOH in DMSO were added. ATP recycling system was implemented, thanks to the addition of 100 μL of a stock solution of 400 mM PEP and 50 μL of commercial PK. The tubes were then vortexed and placed for 5 min in a dry bath at 37 °C. The reaction was started by the addition of enzymatic solutions in buffer A: various amounts (25, 50, and 100 μL) of a 1.5 mg/mL purified FtmPT1 solution (specific activity 1.4 U/mg), 10 μL of a 1.3 mg/mL purified IPKMv solution (specific activity 20 U/mg), and 50, 100, and 150 μL of a 0.6 mg/mL purified PhoNXt solution (specific activity 1.1 U/mg) and left at 37 °C under agitation (800 rpm) for 24 h. Samples (100 μL) were regularly withdrawn and analyzed by TLC and HPLC for TB formation. 5.6.5. Optimized Large-Scale Synthesis of TB from BF and DMAOH Catalyzed by FtmPT1 Prenyl Transferase, IPKMv, and High PhoNXt Concentration. In a 100 mL round-bottom flask, 2.6 mL of a stock solution of 400 mM DMAOH in DMSO and 7 mL of a stock solution of 200 mM ATP in buffer A were added to 14 mL of buffer A. BF (100 mg) dissolved in 3.5 mL of DMSO (0.35 mmol) was then added, and an ATP recycling system was implemented, thanks to the addition of 3.5 mL of a stock solution of 400 mM PEP in buffer A and 1.75 mL of commercial PK. Then, the solution was left for 15 min at 37 °C (oil bath). The reaction was started by the addition of enzymatic solutions in buffer A: 1.1 mL of a 5.1 mg/mL purified FtmPT1 solution (activity 1.3 U/mg), 276 μL of a 5.9 mg/mL purified IPKMv solution (activity 5.9 U/mg), and 1.2 mL of a 1.9 mg/mL purified PhoNXt solution (1.4 U/ mg) and left at 37 °C under agitation (400 rpm) for 24 h. A stock solution (2.6 mL) of 200 mM ATP in buffer A was added at 20 and 40 min. Samples (100 μL) were regularly withdrawn and analyzed by TLC and HPLC for TB formation.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsomega.9b00561. List of tested PhoNs and IPKs, kinetics of BF transformation with FtmPT1 alone and in combination with IPKMv, NMR analysis of BF and TB, SDS PAGE gel electrophoresis of used enzymes, and HPLC analysis of BF and TB (PDF)

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected] (V.d.B.). *E-mail: [email protected] (G.I.). 7847


ACS Omega

Article

ORCID

(14) Grundmann, A.; Li, S.-M. Overproduction, Purification and Characterization of FtmPT1, a Brevianamide F Prenyltransferase from Aspergillus f umigatus. Microbiology 2005, 151, 2199−2207. (15) Babich, L.; Hartog, A. F.; van der Horst, M. A.; Wever, R. Continuous-Flow Reactor-Based Enzymatic Synthesis of Phosphorylated Compounds on a Large Scale. Chem.Eur. J. 2012, 18, 6604− 6609. (16) Tanaka, N.; Hasan, Z.; Hartog, A. F.; van Herk, T.; Wever, R. Phosphorylation and Dephosphorylation of Polyhydroxy Compounds by Class A Bacterial Acid Phosphatases. Org. Biomol. Chem. 2003, 1, 2833−2839. (17) Babich, L.; van Hemert, L. J. C.; Bury, A.; Hartog, A. F.; Falcicchio, P.; van der Oost, J.; van Herk, T.; Wever, R.; Rutjes, F. P. J. T. Synthesis of Non-natural Carbohydrates from Glycerol and Aldehydes in a One-pot Four-enzyme Cascade reaction. Green Chem. 2011, 13, 2895−2900. (18) Matsumi, R.; Atomi, H.; Driessen, A. J. M.; van der Oost, J. Isoprenoid Biosynthesis in Archaea - Biochemical and Evolutionary Implications. Res. Microbiol. 2011, 162, 39−52. (19) Chen, M.; Poulter, C. D. Characterization of Thermophilic Archaeal Isopentenyl Phosphate Kinases. Biochemistry 2010, 49, 207− 217. (20) Li, S.-M. Genome Mining and Biosynthesis of Fumitremorgintype Alkaloids in Ascomycetes. J. Antibiot. 2011, 64, 45−49. (21) Rico, J.; Duquesne, K.; Petit, J.-L.; Mariage, A.; Darii, E.; Peruch, F.; de Berardinis, V.; Iacazio, G. Exploring Natural Biodiversity to Expand Access Towards Microbial Terpene Synthesis. Microb. Cell Fact. 2019, 18, 23. (22) Gandhi, N.; Chandra, S. A Comparative Analysis of three Classes of Bacterial non-Specific Acid Phosphatases and Archaeal Phosphoesterases: Evolutionary Perspective. Acta Inf. Med. 2012, 20, 167−173. (23) Tanaka, N.; Hasan, Z.; Hartog, A. F.; van Herk, T.; Wever, R. Phosphorylation and Dephosphorylation of Polyhydroxy Compounds by Class A Bacterial Acid Phosphatases. Org. Biomol. Chem. 2003, 1, 2833−2839. (24) Duff, S. M. G.; Lefebvre, D. D.; Plaxton, W. C. Purification, Characterization, and Subcellular Localization of an Acid Phosphatase from Black Mustard Cell-Suspension Cultures: Comparison with Phosphoenolpyruvate Phosphatase. Arch. Biochem. Biophys. 1991, 286, 226−232. (25) Vannice, J. C.; Skaff, D. A.; Keightley, A.; Addo, J. K.; Wyckoff, G. J.; Miziorko, H. M. Identification in Haloferax volcanii of Phosphomevalonate Decarboxylase and Isopentenyl Phosphate Kinase as Catalysts of the Terminal Enzyme Reactions in an Archaeal Alternate Mevalonate Pathway. J. Bacteriol. 2014, 196, 1055−1063. (26) Yang, X.; Jiang, Y.; Yang, J.; He, J.; Sun, J.; Chen, F.; Zhang, M.; Yang, B. Prenylated Flavonoids, Promising Nutraceuticals with Impressive Biological Activities. Trends Food Sci. Technol. 2015, 44, 93−104. (27) Wollinsky, B.; Ludwig, L.; Hamacher, A.; Yu, X.; Kassack, M. U.; Li, S.-M. Prenylation at the Indole Ring Leads to a Significant Increase of Cytotoxicity of Tryptophan-containing Cyclic Dipeptides. Bioorg. Med. Chem. Lett. 2012, 22, 3866−3869. (28) Mukai, R. Prenylation Enhances the Biological Activity of Dietary Flavonoids by Altering their Bioavailability. Biosci., Biotechnol., Biochem. 2018, 82, 207. (29) Huisman, M.; Rahaman, M.; Asad, S.; Oehm, S.; Novin, S.; Rheingold, A. L.; Hossain, M. M. Total Synthesis of Tryprostatin B: Synthesis and Asymmetric Phase-Transfer-Catalyzed Reaction of Prenylated Gramine Salt. Org. Lett. 2019, 21, 134−137. (30) Maiya, S.; Grundmann, A.; Li, S.-M.; Turner, G. Improved Tryprostatin B Production by Heterologous Gene Expression in Aspergillus nidulans. Fungal Genet. Biol. 2009, 46, 436−440. (31) Martin, V. J. J.; Pitera, D. J.; Withers, S. T.; Newman, J. D.; Keasling, J. D. Engineering a Mevalonate Pathway in Escherichia coli for Production of Terpenoids. Nat. Biotechnol. 2003, 21, 796−802.

Gilles Iacazio: 0000-0003-3168-5500 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work is part of the ANR project Reset ANR-14-CE060027-01. We greatly acknowledge the financial support of the Agence Nationale de la Recherche (ANR). J.C. thanks the Ministère de la Recherche for Ph.D. Grant. We are grateful to Adrien Debard and Virginie Pellouin for excellent technical assistance. We also acknowledge the technical support from the AVB Platform, Service 312, Faculté des Sciences de Saint Jérôme, Aix-Marseille Université.

■

REFERENCES

(1) Christianson, D. W. Structural and Chemical Biology of Terpenoid Cyclases. Chem. Rev. 2017, 117, 11570−11648. (2) Bohlmann, J.; Keeling, C. I. Terpenoid Biomaterials. Plant J. 2008, 54, 656−669. (3) Paramasivan, K.; Mutturi, S. Progress in Terpene Synthesis Strategies through Engineering of Saccharomyces cerevisiae. Crit. Rev. Biotechnol. 2017, 37, 974. (4) Mafu, S.; Zerbe, P. Plant Diterpenoid Metabolism for Manufacturing the Biopharmaceuticals of Tomorrow: Prospects and Challenges. Phytochem. Rev. 2018, 17, 113−130. (5) Bloch, K. The Biological Synthesis of Cholesterol. Science 1965, 150, 19−28. (6) Frank, A.; Groll, M. The Methylerythritol Phosphate Pathway to Isoprenoids. Chem. Rev. 2017, 117, 5675−5703. (7) Liu, X.; Ding, W.; Jiang, H. Engineering Microbial Cell Factories for the Production of Plant Natural Products: from Design Principles to Industrial-Scale Production. Microb. Cell Fact. 2017, 16, 125−133. (8) Paddon, C. J.; Westfall, P. J.; Pitera, D. J.; Benjamin, K.; Fisher, K.; McPhee, D.; Leavell, M. D.; Tai, A.; Main, A.; Eng, D.; Polichuk, D. R.; Teoh, K. H.; Reed, D. W.; Treynor, T.; Lenihan, J.; Jiang, H.; Fleck, M.; Bajad, S.; Dang, G.; Dengrove, D.; Diola, D.; Dorin, G.; Ellens, K. W.; Fickes, S.; Galazzo, J.; Gaucher, S. P.; Geistlinger, T.; Henry, R.; Hepp, M.; Horning, T.; Iqbal, T.; Kizer, L.; Lieu, B.; Melis, D.; Moss, N.; Regentin, R.; Secrest, S.; Tsuruta, H.; Vazquez, R.; Westblade, L. F.; Xu, L.; Yu, M.; Zhang, Y.; Zhao, L.; Lievense, J.; Covello, P. S.; Keasling, J. D.; Reiling, K. K.; Renninger, N. S.; Newman, J. D. High-Level Semi-Synthetic Production of the Potent Antimalarial Artemisinin. Nature 2013, 496, 528−532. (9) Meadows, A. L.; Hawkins, K. M.; Tsegaye, Y.; Antipov, E.; Kim, Y.; Raetz, L.; Dahl, R. H.; Tai, A.; Mahatdejkul-Meadows, T.; Xu, L.; Zhao, L.; Dasika, M. S.; Murarka, A.; Lenihan, J.; Eng, D.; Leng, J. S.; Liu, C.-L.; Wenger, J. W.; Jiang, H.; Chao, L.; Westfall, P.; Lai, J.; Ganesan, S.; Jackson, P.; Mans, R.; Platt, D.; Reeves, C. D.; Saija, P. R.; Wichmann, G.; Holmes, V. F.; Benjamin, K.; Hill, P. W.; Gardner, T. S.; Tsong, A. E. Rewriting Yeast Central Carbon Metabolism for Industrial Isoprenoid Production. Nature 2016, 537, 694−697. (10) van Herk, T.; Hartog, A. F.; van der Burg, A. M.; Wever, R. Regioselective Phosphorylation of Carbohydrates and Various Alcohols by Bacterial Acid Phosphatases; Probing the Substrate Specificity of the Enzyme from Shigella f lexneri. Adv. Synth. Catal. 2005, 347, 1155−1162. (11) Grochowski, L. L.; Xu, H.; White, R. H. Methanocaldococcus jannaschii Uses a Modified Mevalonate Pathway for Biosynthesis of Isopentenyl Diphosphate. J. Bacteriol. 2006, 188, 3192−3198. (12) Dellas, N.; Thomas, S. T.; Manning, G.; Noel, J. P. Discovery of a Metabolic Alternative to the Classical Mevalonate Pathway. eLife 2013, 2, No. e00672. (13) Zhao, S.; Smith, K. S.; Deveau, A. M.; Dieckhaus, C. M.; Johnson, M. A.; Macdonald, T. L.; Cook, J. M. Biological Activity of the Tryprostatins and Their Diastereomers on Human Carcinoma Cell Lines. J. Med. Chem. 2002, 45, 1559−1562. 7848


ACS Omega

Article

(32) Chatzivasileiou, A. O.; Ward, V.; Edgar, S. M.; Stephanopoulos, G. Two-step Pathway for Isoprenoid Synthesis. Proc. Natl. Acad. Sci. U.S.A. 2019, 116, 506−511. (33) Lund, S.; Hall, R.; Williams, G. J. An Artificial Pathway for Isoprenoid Biosynthesis Decoupled from Native Hemiterpene Metabolism. ACS Synth. Biol. 2019, 8, 232−238. (34) Lira, L. M.; Vasilev, D.; Pilli, R. A.; Wessjohann, L. A. One-pot Synthesis of Organophosphate Monoesters from Alcohols. Tetrahedron Lett. 2013, 54, 1690−1692. (35) Torres-García, C.; Díaz, M.; Blasi, D.; Farràs, I.; Fernandez, I.; Fernández, X.; Farràs, J.; Lloyd-Williams, P.; Royo, M.; Nicolás, E. Side Chain Anchoring of Tryptophan to Solid Supports Using a Dihydropyranyl Handle: Synthesis of Brevianamide F. Int. J. Pept. Res. Ther. 2012, 18, 7−19. (36) Vergne-Vaxelaire, C.; Bordier, F.; Fossey, A.; Besnard-Gonnet, M.; Debard, A.; Mariage, A.; Pellouin, V.; Perret, A.; Petit, J.-L.; Stam, M.; Salanoubat, M.; Weissenbach, J.; De Berardinis, V.; Zaparucha, A. Nitrilase Activity Screening on Structurally Diverse Substrates: Providing Biocatalytic Tools for Organic Synthesis. Adv. Synth. Catal. 2013, 355, 1763−1779. (37) Bastard, K.; Smith, A. A. T.; Vergne-Vaxelaire, C.; Perret, A.; Zaparucha, A.; De Melo-Minardi, R.; Mariage, A.; Boutard, M.; Debard, A.; Lechaplais, C.; Pelle, C.; Pellouin, V.; Perchat, N.; Petit, J.-L.; Kreimeyer, A.; Medigue, C.; Weissenbach, J.; Artiguenave, F.; De Berardinis, V.; Vallenet, D.; Salanoubat, M. Revealing the Hidden Functional Diversity of an Enzyme Family. Nat. Chem. Biol. 2014, 10, 42−49. (38) Vardakou, M.; Salmon, M.; Faraldos, J. A.; O’Maille, P. E. Comparative Analysis and Validation of the Malachite Green Assay for the High Throughput Biochemical Characterization of Terpene Synthases. MethodsX 2014, 1, 187−196.

7849


Simplified in Vitro and in Vivo Bioaccess to Prenylated Compounds

Recommend Documents