Stable Knock-down of Efflux Transporters Leads to Reduced

Mar 5, 2015 - Efflux of glucuronide is facilitated by the membrane transporters including BCRP and MRPs. In this study, we aimed to determine the effe...
0 downloads 6 Views 2MB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Stable Knock-down of Efflux Transporters Leads to Reduced Glucuronidation in UGT1A1-Overexpressing HeLa Cells: The Evidence for Glucuronidation-Transport Interplay Xingwang Zhang,†,§ Dong Dong,‡,§ Huailing Wang,†,‡ Zhiguo Ma,† Yifei Wang,‡ and Baojian Wu*,† †

Division of Pharmaceutics, College of Pharmacy, and ‡Guangzhou Jinan Biomedicine Research and Development Center, Jinan University, 601 Huangpu Avenue West, Guangzhou 510632, China S Supporting Information *

ABSTRACT: Efflux of glucuronide is facilitated by the membrane transporters including BCRP and MRPs. In this study, we aimed to determine the effects of transporter expression on glucuronide efflux and cellular glucuronidation. Single efflux transporter (i.e., BCRP, MRP1, MRP3, or MRP4) was stably knocked-down in UGT1A1-overexpressing HeLa cells. Knock-down of transporters was performed by stable transfection of shorthairpin RNA (shRNA) using lentiviral vectors. Glucuronidation and glucuronide transport in the cells were characterized using three different aglycones (i.e., genistein, apigenin, and emodin) with distinct metabolic activities. BCRP knock-down resulted in significant reductions in excretion of glucuronides (42.9% for genistein glucuronide (GG), 21.1% for apigenin glucuronide (AG) , and 33.7% for emodin glucuronide (EG); p < 0.01) and in cellular glucuronidation (38.3% for genistein, 38.6% for apigenin, and 34.7% for emodin; p < 0.01). Knock-down of a MRP transporter led to substantial decreases in excretion of GG (32.3% for MRP1, 36.7% for MRP3, and 36.6% for MRP4; p < 0.01) and AG (59.3% for MRP1, 24.7% for MRP3, and 34.1% for MRP4; p < 0.01). Also, cellular glucuronidation of genistein (38.3% for MRP1, 32.3% for MRP3, and 31.1% for MRP4; p < 0.01) and apigenin (40.6% for MRP1, 32.4% for MRP3, and 34.6% for MRP4; p < 0.001) was markedly suppressed. By contrast, silencing of MRPs did not cause any changes in either excretion of EG or cellular glucuronidation of emodin. In conclusion, cellular glucuronidation was significantly altered by decreasing expression of efflux transporters, revealing a strong interplay of glucuronidation with efflux transport. KEYWORDS: glucuronidation, UGT, BCRP, MRPs, HeLa cells

■

INTRODUCTION Metabolism is a drug-like property that plays an important role in determining the pharmacokinetics and efficacy/toxicity of drugs. Accordingly, metabolism studies have become an indispensable part of drug discovery and development programs.1−3 Drug metabolism reactions are classified into phase I and phase II reactions. The former includes the oxidation, reduction, and hydrolysis reactions.4 The latter refers to various types of conjugation reactions such as glucuronidation and glutathionylation.5 This “phase” classification system is based on the historical observations that phase II enzymes tend to conjugate drugs that have undergone phase I metabolism. It is noteworthy that in addition to conjugating phase I metabolites, phase II enzymes are known to directly metabolize a number of drugs (e.g., raloxifene and gemfibrozil).6 In fact, 15% of the 200 most prescribed drugs in the USA are cleared directly via glucuronidation pathway, which is mediated by the UGT enzymes (UDP-glucuronosyltransferases).6 Efflux transporters (e.g., P-glycoprotein (P-gp), breast cancer resistance protein (BCRP), and multidrug resistance-associated proteins (MRPs)) mediate active transport of drug molecules © 2015 American Chemical Society

out of cells, thereby playing an important role in modulating drug absorption, distribution, and elimination.7,8 In addition, the transporters show great potential in altering drug metabolism.9−11 For instance, coadministration of GG918 (a specific inhibitor of P-gp) causes a marked reduction in firstpass metabolism of K77 (a CYP3A4 substrate).9 The interdependence of metabolism and transport is termed as the “metabolism-transport interplay”.12 Extensive studies have focused on the interplay of CYP (cytochrome P450) enzyme with P-gp and demonstrated that P-gp has modulatory effects on CYP metabolism.13−15 In contrast, little is known about whether and how phase II enzymes interact with efflux transporters. A better understanding of metabolism-transport interplay assumes great importance in an attempt to predict drug disposition and drug−drug interactions in vivo.16 Received: Revised: Accepted: Published: 1268

December 1, 2014 February 24, 2015 March 5, 2015 March 5, 2015 DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278

Article

Molecular Pharmaceutics Table 1. Design of shRNAs Targeting the Transporter Genes shRNA

nucleotide sequence

BCRP-shRNA1

forward: 5′-GATCCGGCCTTGGGATACTTTGAATCTTCAAGAGAGATTCAAAGTATCCCAAGGCCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGGCCTTGGGATACTTTGAATCTCTCTTGAAGATTCAAAGTATCCCAAGGCCG-3′ forward: 5′-GATCCGCAGGATAAGCCACTCATAGATTCAAGAGATCTATGAGTGGCTTATCCTGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCAGGATAAGCCACTCATAGATCTCTTGAATCTATGAGTGGCTTATCCTGCG-3′ forward: 5′-GATCCGGATACTACAGAGTGTCATCTTTCAAGAGAAGATGACACTCTGTAGTATCCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGGATACTACAGAGTGTCATCTTCTCTTGAAAGATGACACTCTGTAGTATCCG-3′ forward: 5′-GATCCGCAGATGCCTTCTTCGTTATGTTCAAGAGACATAACGAAGAAGGCATCTGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCAGATGCCTTCTTCGTTATGTCTCTTGAACATAACGAAGAAGGCATCTGCG-3′ forward: 5′-GATCCGGATCACCTTCTGGTGGATCATTCAAGAGATGATCCACCAGAAGGTGATCCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGGATCACCTTCTGGTGGATCATCTCTTGAATGATCCACCAGAAGGTGATCCG-3′ forward: 5′-GATCCGGAAGAAGGAATGCGCCAAGATTCAAGAGATCTTGGCGCATTCCTTCTTCCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGGAAGAAGGAATGCGCCAAGATCTCTTGAATCTTGGCGCATTCCTTCTTCCG-3′ forward: 5′-GATCCGCAAAGACAATCGGATCAAGCTTCAAGAGAGCTTGATCCGATTGTCTTTGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCAAAGACAATCGGATCAAGCTCTCTTGAAGCTTGATCCGATTGTCTTTGCG-3′ forward: 5′-GATCCGCAGGCCTGGATTCAGAATGATTCAAGAGATCATTCTGAATCCAGGCCTGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCAGGCCTGGATTCAGAATGATCTCTTGAATCATTCTGAATCCAGGCCTGCG-3′ forward: 5′-GATCCGCACGACACAAGGCTTCAGCATTCAAGAGATGCTGAAGCCTTGTGTCGTGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCACGACACAAGGCTTCAGCATCTCTTGAATGCTGAAGCCTTGTGTCGTGCG-3′ forward: 5′-GATCCGCAGTCGCTGATCTTACAACATTCAAGAGATGTTGTAAGATCAGCGACTGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCAGTCGCTGATCTTACAACATCTCTTGAATGTTGTAAGATCAGCGACTGCG-3′ forward: 5′-GATCCGGGAAATTGTCAACCTCATGTTTCAAGAGAACATGAGGTTGACAATTTCCCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGGGAAATTGTCAACCTCATGTTCTCTTGAAACATGAGGTTGACAATTTCCCG-3′ forward: 5′-GATCCGCAGAACCTAGGTCCCTCTGTTTCAAGAGAACAGAGGGACCTAGGTTCTGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCAGAACCTAGGTCCCTCTGTTCTCTTGAAACAGAGGGACCTAGGTTCTGCG-3′ forward: 5′-GATCCGCACAGAAGCCTTCTTTAACATTCAAGAGATGTTAAAGAAGGCTTCTGTGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCACAGAAGCCTTCTTTAACATCTCTTGAATGTTAAAGAAGGCTTCTGTGCG-3′ forward: 5′-GATCCGCATGGAAGAATTGCCTATGTTTCAAGAGAACATAGGCAATTCTTCCATGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCATGGAAGAATTGCCTATGTTCTCTTGAAACATAGGCAATTCTTCCATGCG-3′ forward: 5′-GATCCGCAGTAGATGCGGAAGTTAGCTTCAAGAGAGCTAACTTCCGCATCTACTGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCAGTAGATGCGGAAGTTAGCTCTCTTGAAGCTAACTTCCGCATCTACTGCG-3′ forward: 5′-GATCCGGTTGCCTATGTGCTTCAAGATTCAAGAGATTTGAAGCACATAGGCAACCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGGTTGCCTATGTGCTTCAAGATCTCTTGAATCTTGAAGCACATAGGCAACCG-3′ forward: 5′-GATCCGCTCGCCTGTCTACTAACTAATTCAAGAGATTAGTTAGTAGACAGGCGAGCTTTTTTACGCGTC-3′ reverse: 5′-TCGAGACGCGTAAAAAAGCTCGCCTGTCTACTAACTAATCTCTTGAATTAGTTAGTAGACAGGCGAGCG-3′

BCRP-shRNA2 BCRP-shRNA3 BCRP-shRNA4 MRP1-shRNA1 MRP1-shRNA2 MRP1-shRNA3 MRP1-shRNA4 MRP3-shRNA1 MRP3-shRNA2 MRP3-shRNA3 MRP3-shRNA4 MRP4-shRNA1 MRP4-shRNA2 MRP4-shRNA3 MRP4-shRNA4 scramble

The objective of the present study was to assess the effects of efflux transporters with varied expression levels on glucuronide excretion as well as cellular glucuronidation. To this end, HeLa cells were stably transfected with UGT1A1 to enable the cells (named as HeLa1A1 cells) to synthesize glucuronides. UGT1A1 was selected because it is one of the most important UGT isozymes with established functions in detoxification of the endogenous bilirubin and the chemotherapeutic drug SN38.22−24 Further, four stable transporter knock-down HeLa1A1 cell lines were established using short-hairpin RNA (shRNA)mediated silencing technique. Three aglycones genistein, apigenin, and emodin were selected as the model compounds because they showed distinctly different glucuronidation activities. We demonstrated for the first time that reduced expression of efflux transporters led to suppressed glucuronidation, revealing a strong dependence of cellular glucuronidation on the efflux transporters.

Because of a high hydrophilicity, efflux of glucuronide is a required step in drug clearance via UGT metabolism.17,18 It is well-accepted that following the glucuronidation reaction (or glucuronide formation) within the cells, excretion of glucuronide is enabled by the efflux transporters including BCRP and MRP family proteins.17,19,20 The efflux transporters work together with the UGT enzymes to eliminate drugs, limiting the oral bioavailability of xenobiotics/drugs.19,20 The coordinated action of efflux transporters with UGT enzymes suggests that there may be an interdependence between the glucuronidation and glucuronide transport (or efflux), described as the “glucuronidation-transport interplay” (a type of aforementioned “metabolism-transport interplay”). Contrasting with the fact that the metabolic enzyme and transporter act on the same substrate in the interplay of P-gp with CYP, the two players act on different substrates (i.e., the aglycones for the enzymes and the glucuronides for the transporters) in the glucuronidation-transport interplay.18 Investigations of glucuronidation-transport interplay have been challenged by the lack of specific inhibitors for the transporters (and enzymes). Further, the transporter inhibitors (e.g., Ko143 and MK-571) have been shown to alter the glucuronidation activity.21 Hence, there is a clear need to explore the interplay of glucuronidation with transport using the biological approaches such as gene silencing of the players.

■

MATERIALS AND METHODS Materials. Expressed human UGT1A1 and anti-UGT1A1 antibody were purchased from BD Biosciences (Woburn, MA). pGEM-T plasmid carrying UGT1A1 cDNA clone was purchased from Sino Biological Inc. (Beijing, China). HeLa cells, 293T cells, pLVX-mCMV-ZsGreen-PGK-Puro vector, and pLVX-shRNA2-Neo vector were obtained from BioWit

1269

DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278

Article

Molecular Pharmaceutics Table 2. Primer Sets for Quantitative Real-Time Polymerase Chain Reactions primer

GenBank number

forward (5′ → 3′ sequence)

reverse (5′ → 3′ sequence)

BCRP MRP1 MRP3 MRP4

NM_004827.2 NM_004996.3 NM_003786.3 NM_005845.3

CCGCGACAGCTTCCAATGAC TCGCTCAGAGGTTCATGGACT CCACCTGTCCAAGCTCAAGATG CCTATGCCACGGTGCTGAC

CAGGATGGCGTTGAGACCAG GGGCCACCTGATACGTCTTG GACCACACACAGGAACCAGAAG TGGCACATGGCTACTCGTAAC

Cell Transfection. HeLa1A1 cells were stably transfected by the lentiviruses following the procedures stated in our previous publication.21 The positive clones were screened by G418 instead of puromycin. The established cells were named as HeLa1A1-BCRP-shRNA cells. Development of MRP-shRNA Transfected HeLa1A1 Cells. Following identical procedures in development of HeLa1A1-BCRP-shRNA cells, MRP1-shRNA, MRP3-shRNA and MRP4-shRNA transfected HeLa1A1 cells were established, respectively. The stably shRNA transfected cell lines were named as HeLa1A1-MRP1-shRNA, HeLa1A1-MRP3-shRNA, and HeLa1A1-MRP4-shRNA cells, respectively. Glucuronidation Assay. The aglycones (i.e., genistein, apigenin, and emodin) were incubated with expressed UGT1A1 to determine the rates of glucuronidation as described in our publications.25,27−29 Kinetic Evaluation. The rates of glucuronidation were determined for the aglycones at a series of concentrations (0.156−10 μM). The substrate inhibition equation (eq 1) was fitted to the data to obtain the kinetic parameters because the Eadie−Hofstee plots showed a hook in the top portion.30,31 The Graphpad Prism V5 software (San Diego, CA) was used in model fitting and parameter estimation.

Technologies (Shenzhen, China). The anti-BCRP, anti-MRP1, anti-MRP3, and anti-MRP4 antibodies were purchased from OriGene Technologies (Rockville, MD). The anti-GAPDH antibody was purchased from Abcam (Cambridge, MA). Uridine diphosphoglucuronic acid (UDPGA), alamethicin, and D-saccharic-1,4-lactone monohydrate were purchased from Sigma-Aldrich (St. Louis, MO). Apigenin, genistein, and emodin were purchased from Aladdin chemicals (Shanghai, China). Apigenin-7-O-glucuronide (or apigenin glucuronide (AG)), genistein-7-O-glucuronide (or genistein glucuronide (GG)), and emodin-6-O-glucuronide (or emodin glucuronide (EG)) of about 5 mg were synthesized as described.25 All other materials (typically analytical grade or better) were used as received. Development of UGT1A1 Transfected HeLa Cells. HeLa cells were stably transfected with UGT1A1 cDNA using the lentiviral approach. The experimental procedures were detailed in our previous publication.21 The UGT1A1 modified cells were named as HeLa1A1 cells. Construction of shRNA Plasmids. Four different shRNA fragments were designed for each transporter (i.e., BCRP, MRP1, MRP3, and MRP4) (Table 1). All shRNAs were synthesized by Biowit Technologies (Shenzhen, Chia). Each pair of shRNA was ligated into the pLVX-ShRNA2-Neo plasmid as described.21 The shRNA fragments within the vector construct were sequenced using the primer U6-F (5′TACGATACAAGGCTGTTAGAGAG-3′) by Invitrogen (Carlsbad, CA). Transient Transfection of shRNA Plasmids. The shRNA plasmid construct was transiently transfected into the HeLa1A1 cells as described.21 After transfection for 2 days, the cells were collected for quantitative real-time polymerase chain reaction (qPCR) analyses. Quantitative Real-Time Polymerase Chain Reaction (qPCR). The cells were collected and total RNA isolation was performed using the TRIzol extraction method as described.26 The total RNA was converted to cDNA using the iScript cDNA synthesis kit according to the manufacturer’s protocol (BioRad, Hercules, CA). PCRs were performed with an ABI Prism 7900 Sequence Detection System (Applied Biosystems). The primers are summarized in Table 2. The PCR conditions were as follows: 30 s denaturation at 95 °C followed by 45 cycles of 10 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C, and a final step of 1 min at 95 °C, 1 min at 55 °C, and 1 min at 95 °C. Each sample contained 0.2 μg of cDNA in 10 μL of SYBR Green/ Flourescein qPCR Master Mix (Fermentas, Canada) and 8 pmol of each primer in a final volume of 20 μL. The relative amount of each studied mRNA was normalized to levels of GAPDH as housekeeping gene, and the data were analyzed according to the 2−ΔΔCT method. Development of BCRP-shRNA Transfected HeLa1A1 Cells. Lentiviral Vector Production. Lentiviral vectors were produced by transient transfection of recombinant shRNA plasmid into 293T cells as described.21

Vmax[S]

V=

(

K m + [S] 1 +

[S] K si

)

(1)

where Km is the Michaelis constant, Vmax is the maximal rate of glucuronidation, and Ksi is the substrate inhibition constant. Glucuronide Excretion Experiments. The excretion experiments were performed as described.21,32,33 All aglycones (i.e., genistein, apigenin, and emodin) were incubated with the cells at a concentration of 5 μM. The excretion rate (ER) of intracellular glucuronide was calculated as defined.21 Fraction metabolized ( f met) value (eq 2), the fraction of dose metabolized, was calculated exactly as described.14,32 The f met value measured the extent of drug glucuronidation in the cells. fmet =

excreted glucuronide + intracellular glucuronide dosed aglycone (2)

Preparation of Cell Lysate. The cell lysate was prepared and total protein concentration was measured following the procedures described in our previous publication.21 Glucuronide Hydrolysis Experiment. The cell lysate was incubated with the glucuronides (GG, AG, and EG) to determine the rates of hydrolysis by β-glucuronidase as described.21 Quantification of Aglycones and Glucuronides by UPLC Analysis. Quantification of aglycones and their glucuronides were performed by Waters ACQUITY UPLC system as described.21 The gradient program was 5% B at 0 to 0.5 min, 5 to 40% B at 0.5 to 1.2 min, 40% B at 1.2 to 1.5 min, 40 to 95% B at 1.5 to 2.8 min, 95% B at 2.8 to 3.3 min, and 95 to 5% B at 3.3 to 4 min. The detection wavelengths were 258, 1270

DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278

Article

Molecular Pharmaceutics 340, and 261 nm for genistein/GG, apigenin/AG, and emodin/ EG, respectively. Immunoblotting. Immunoblotting was performed as described previously.21 In brief, the cell lysate was analyzed by SDS-PAGE (8% acrylamide gels). Blots were probed with the UGT1A1 or transporter antibody. Protein bands were detected by ECL. Band intensities were measured by densitometry using the Quantity One software. Statistical Analysis. Data are recorded as mean ± SD. Student’s t test was used to compare the mean differences. The level of significance was set at p < 0.05 (*), p < 0.01 (**), or p < 0.001 (***).

■

RESULTS HeLa1A1 Cells Generated Glucuronides from Genistein, Apigenin, and Emodin. The HeLa1A1 cells were fairly active in generation of glucuronides from genistein, apigenin, and emodin (Figure 1). By contrast, the wild-type HeLa cells

Figure 2. Western blots of various cell lines against human UGT1A1, BCRP, MRP1, MRP3, and MRP4.

cells did not express MRP2 (data not shown). Accordingly, gene knock-down was performed for those transporters significantly expressed in the cells, namely, BCRP, MRP1, MRP3, and MRP4. Four different shRNA fragments (i.e., shRNA1, shRNA2, shRNA3, and shRNA4) were synthesized for each efflux transporter (Table 1) and the plasmids carrying each shRNA were constructed. The interference efficiency of shRNA was evaluated by transient transfection of shRNA plasmid into HeLa1A1 cells, followed by determination and comparisons of the mRNA levels of the target transporter. Clearly, among four strands of shRNAs targeting BCRP, shRNA3 was most effective in silencing BCRP gene (Figure 3A). Of four shRNAs targeting MRP1, shRNA1 was most effective in silencing MRP1 gene (Figure 3B). Further, MRP3-shRNA3 and MRP4-shRNA1 showed the highest potency in suppressing the MRP3 and MRP4 genes, respectively (Figure 3C,D). The best-performing shRNA fragments (i.e., BCRP-shRNA3, MRP1-shRNA1, MRP3-shRNA3, and MRP4-shRNA1) were selected to develop stable transporter knock-down cell lines using the lentiviral transfection method. Compared to the scramble-transfected cells, the BCRP mRNA was suppressed to approximately 17% in the BCRP knock-down cells (Figure 3E). The mRNA level of MRP1 was reduced to approximately 21% in the MRP1 knock-down cells (Figure 3F). Likewise, the MRP3 and MRP4 knock-down cells showed marked reductions in the mRNA levels of MRP3 (72%, p < 0.001) and MRP4 (51%, p < 0.001), respectively (Figure 3G,H). Further, the protein levels of the transporters in the cells were determined by Western blotting. Consistent with the substantial decreases in the mRNA levels, a significant reduction in the protein level of the target transporter was observed, whereas no changes occurred in the levels of off-target transporters (Figure 2 and Table 3). To be specific, the BCRP protein was reduced by 45% in HeLa1A1-BCRP-shRNA cells (Figure 2 and Table 3). The MRP1 protein was reduced by 43% in HeLa1A1-MRP1shRNA cells (Figure 2 and Table 3). The MRP3 protein was reduced by 52% in HeLa1A1-MRP3-shRNA cells (Figure 2 and Table 3). The MRP4 protein was reduced by 65% in HeLa1A1MRP4-shRNA cells (Figure 2 and Table 3). Taken together, the results indicated that four stable transporter knocked-down HeLa1A1 cell lines were successfully established. Glucuronidation of Genistein, Apigenin, and Emodin by UGT1A1 Enzyme. The recombinant UGT1A1 enzyme was able to metabolize the aglycones (genistein, apigenin, and emodin), generating single glucuronide (i.e., GG, AG, or EG). Glucuronidation of the three aglycones consistently followed

Figure 1. Functional characterization of HeLa1A1 cells. Comparisons of UPLC chromatograms, showing that HeLa1A1 cells were active in generation of the glucuronide (GG, genistein glucuronide) from (A) genistein, (B) glucuronide (AG, apigenin glucuronide) from apigenin, and (C) glucuronide (GG, emodin glucuronide) from emodin. WT, wild-type HeLa cells; IS, internal standard (biochanin A).

were unable to catalyze the glucuronidation reactions (Figure 1). The results indicated that UGT1A1 expressed in HeLa cells were functional in generation of glucuronides from the substrates. Establishment of Stable Transporter Knock-down HeLa1A1 Cell Lines. The HeLa1A1 (and wild-type HeLa) cells showed significant expression of the efflux transporters BCRP, MRP1, MRP3, and MRP4 (Figure 2). However, the 1271

DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278

Article

Molecular Pharmaceutics

Figure 3. Determination of the mRNA levels of transporters in various types of cells. Comparisons of the mRNA expression of BCRP after transient transfection of (A) each of four BCRP shRNAs to HeLa1A1 cells, (B) each of four MRP1 shRNAs to HeLa1A1 cells, (C) each of four MRP3 shRNAs to HeLa1A1 cells, and (D) each of four MRP4 shRNAs to HeLa1A1 cells. Comparisons of the mRNA expression of (E) BCRP after stable transfection of BCRP-shRNA3 to HeLa1A1 cells, (F) of MRP1 after stable transfection of MRP1-shRNA1 to HeLa1A1 cells, (G) of MRP3 after stable transfection of MRP3-shRNA3 to HeLa1A1 cells, and (H) of MRP4 after stable transfection of MRP4-shRNA1 to HeLa1A1 cells. In panels A−D, the stars denote the best performing shRNA.

Table 3. Relative Protein Expression of Transporters (Normalized to the Levels of GAPDH) in HeLa and Engineered Cells Based on Western Blotting

a

protein

blank cells

scramble cells

BCRP-shRNA cells

MRP1-shRNA cells

MRP3-shRNA cells

MRP4-shRNA cells

BCRP MRP1 MRP3 MRP4 UGT1A1 GAPDH

1.1 ± 0.12 1.1 ± 0.11 1.0 ± 0.14 1.2 ± 0.15 0.85 ± 0.11 1

1.0 ± 0.16 1.0 ± 0.13 0.98 ± 0.087 1.1 ± 0.19 0.83 ± 0.091 1

0.55 ± 0.13a 0.99 ± 0.11 1.1 ± 0.10 1.1 ± 0.098 0.84 ± 0.087 1

1.1 ± 0.092 0.57 ± 0.079a 1.0 ± 0.054 1.1 ± 0.12 0.86 ± 0.13 1

1.0 ± 0.14 0.99 ± 0.11 0.47 ± 0.14a 1.0 ± 0.17 0.87 ± 0.11 1

0.96 ± 0.24 0.97 ± 0.21 1.0 ± 0.11 0.38 ± 0.071a 0.82 ± 0.12 1

Statistically significant compared with the scramble or blank cells (p < 0.05).

resulted in significant reductions in excretion of glucuronides (42.9% for genistein glucuronide (GG), 21.1% for apigenin glucuronide (AG), and 33.7% for emodin glucuronide (EG); p < 0.01) (Figure 5A−C). Also, marked decreases in the f met value (38.3% for genistein, 38.6% for apigenin, and 34.7% for emodin; p < 0.01) were observed (Figure 5D−F), revealing that knock-down of BCRP transporter led to a decreased efficiency in cellular glucuronidation. It was noted that the intracellular level of GG was significantly reduced (p < 0.05) (Figure 5G). However, the intracellular levels of AG and EG were not altered (Figure 5H,I). Effects of MRP Knock-down on Glucuronidation in HeLa1A1 Cells. Knock-down of MRP1 led to substantial decreases in excretion of GG (32.3%, p < 0.01) and AG (59.3%, p < 0.01) (Figure 6A,B). Also, cellular glucuronidation of genistein (38.3%, p < 0.001) and apigenin (40.6%, p < 0.001) was markedly suppressed (Figure 6D,E). By contrast, silencing of MRP1 did not cause any changes in either excretion of EG or cellular glucuronidation of emodin (Figure 6C,F). Further, the intracellular levels of all glucuronides (GG, AG, and EG) were not altered by MRP1 silencing (Figure 6G−I). Likewise, knock-down of MRP3 or MRP4 led to substantial decreases in excretion of GG (36.7% for MRP3 and 36.6% for MRP4, p < 0.01) and AG (24.7% for MRP3 and 34.1% for

the substrate inhibition kinetics with CLint (=Vmax/Km) values of ≥0.8 mL/min/mg (Figure 4). Of note, the Km values were less than 5 μM, indicating that all three aglycones were highaffinity substrates of UGT1A1 (Figure 4D). However, the rates of glucuronidation showed a marked difference (e.g., >10-fold) among the aglycones (at an identical concentration). For example, at the concentration of 5 μM, the rates of glucuronidation were 0.117, 0.300, and 1.21 nmol/min/mg for genistein, apigenin, and emodin, respectively. The reaction kinetics for glucuronidation of three model aglycones were also determined using HeLa1A1 cell lysate (Supporting Information Figure S1). The Km or Ksi values were similar (p > 0.05) to the corresponding values derived with UGT1A1 enzyme. However, the Vmax values of cell lysate were significantly lower (p < 0.01) than those of UGT1A1 most likely due to less concentrated enzyme in the cell lysate. Effects of BCRP Knock-down on Glucuronidation in HeLa1A1 Cells. The HeLa1A1 and HeLa1A1-BCRP-shRNA cells were used to perform glucuronide excretion experiments and to determine the effects of BCRP knock-down on glucuronide transport and cellular glucuronidation. The three aglycones genistein, apigenin, and emodin (at 5 μM) were selected as the model compounds due to distinct glucuronidation activities (see above results). BCRP knock-down 1272

DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278

Article

Molecular Pharmaceutics

Figure 4. Kinetic profiles for glucuronidation reactions mediated by recombinant UGT1A1 enzyme. Kinetic profile for glucuronidation of (A) genistein, (B) apigenin, and (C) emodin by UGT1A1. (D) Summary of kinetic parameters derived by fitting the data to the substrate inhibition model. In panels A−C, the inset shows the corresponding Eadie−Hofstee plot.

Figure 5. Effects of shRNA-mediated BCRP knock-down on glucuronide excretion and cellular glucuronidation. Effects of BCRP knock-down on the excretion profile of (A) genistein glucuronide (GG), (B) apigenin glucuronide (AG), and (C) emodin glucuronide (EG). Effects of BCRP knockdown on cellular glucuronidation (or f met) of (D) genistein, (E) apigenin, and (F) emodin. Effects of BCRP knock-down on the intracellular level of (G) GG, (H) AG, and (I) EG. *p < 0.05; **p < 0.01; ***p < 0.001.

MRP4, p < 0.01) (Figures 7 and 8). Also, gene silencing caused significant reductions in cellular glucuronidation of genistein

(32.3% for MRP3 and 31.1% for MRP4; p < 0.01) and apigenin (32.4% for MRP3 and 34.6% for MRP4; p < 0.001) (Figures 7 1273

DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278

Article

Molecular Pharmaceutics

Figure 6. Effects of shRNA-mediated MRP1 knock-down on glucuronide excretion and cellular glucuronidation. Effects of MRP1 knock-down on the excretion profile of (A) genistein glucuronide (GG), (B) apigenin glucuronide (AG), and (C) emodin glucuronide (EG). Effects of MRP1 knock-down on cellular glucuronidation (or f met) of (D) genistein, (E) apigenin, and (F) emodin. Effects of MRP1 knock-down on the intracellular level of (G) GG, (H) AG, and (I) EG. ***p < 0.001.

down cells were validated through determination of both mRNA and protein levels of efflux transporters. Compared to the scramble cells, the knock-down cells showed identical expression of UGT1A1 but decreased expression of the target transporter (Figure 2). All these cell lines were functional in generating glucuronides from the aglycones genistein, apigenin, and emodin. In addition, we demonstrated that knock-down of BCRP led to reduced glucuronidation and knock-down of MRPs caused reductions in glucuronidation depending on the substrates, providing direct evidence that there was a strong dependence of cellular glucuronidation on the efflux transporters (i.e., glucuronidation-transport interplay). Further, it was revealed that excretion of GG and AG was contributed by multiple efflux transporters, whereas excretion of EG was contributed by BCRP only. Hence, the newly established cell lines were an excellent tool to determine exact contributions of efflux transporters to glucuronide excretion and to study the glucuronidation-transport interplay. We found that multiple transporters (BCRP, MRP1, MRP3, and MRP4) were significantly expressed in the HeLa cells and were important contributors to excretion of the glucuronides GG and AG. Our results were consistent with a previous study in which BCRP contributed to excretion of flavonoid glucuronides and the contribution of MRP2 was none.32 However, Jiang et al. excluded the MRP3 transporter as a potential contributor to glucuronide excretion in HeLa cells.32 In the present study, in addition to MRP3, MRP1 and MRP4 played important roles in excretion of the glucuronides AG and

and 8). MRP3 silencing resulted in a significant reduction (p < 0.05) in the intracellular level of AG (Figure 7). However, the intracellular levels of GG and EG were not altered (Figure 7). By contrast, MRP4 silencing resulted in a significant elevation (p < 0.05) in the intracellular level of GG, while the levels of AG and EG were not altered (Figure 8). Hydrolysis of Glucuronides (GG, AG, and EG). The hydrolysis experiments with cell lysate were performed to explore the potential of conversion of glucuronides back to the parent compounds within the cells. Clearly, the hydrolysis reactions occurred when the glucuronides were incubated with the cell lysate (Figure 9). We were unable to determine the kinetic parameters by model fitting because saturation of metabolism was not achieved under tested substrate concentrations (Figure 9). However, a linear equation was well fitted to the data for estimation of the intrinsic clearance (CLint). The derived CLint values were 6.1, 5.2, and 13 μL/h/mg for GG, AG, and EG, respectively (Figure 9). This may suggest that EG was subjected to a more efficient hydrolysis compared to GG and AG (p < 0.01). Our results overall suggested that the glucuronides within the cells were susceptible to hydrolysis reactions.

■

DISCUSSION

In this study, we for the first time established four stable transporter knock-down HeLa1A1 cell lines, namely, HeLa1A1BCRP-shRNA, HeLa1A1-MRP1-shRNA, HeLa1A1-MRP3shRNA, and HeLa1A1-MRP4-shRNA cells. The stable knock1274

DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278

Article

Molecular Pharmaceutics

Figure 7. Effects of shRNA-mediated MRP3 knock-down on glucuronide excretion and cellular glucuronidation. Effects of MRP3 knock-down on the excretion profile of (A) genistein glucuronide (GG), (B) apigenin glucuronide (AG), and (C) emodin glucuronide (EG). Effects of MRP3 knock-down on cellular glucuronidation (or f met) of (D) genistein, (E) apigenin, and (F) emodin. Effects of MRP3 knock-down on the intracellular level of (G) GG, (H) AG, and (I) EG. *p < 0.05; **p < 0.01; ***p < 0.001.

of glucuronides. This suggested that efflux of glucuronides was efficient in the cells and that cellular glucuronidation can essentially reflect the microsomal glucuronidation. Hence, the HeLa1A1 cells were an alternative tool for determination of the substrate selectivity of UGT1A1 enzyme. Substrate inhibition was observed in glucuronidation kinetics of three model compounds (i.e., genistein, apigenin, and emodin) (Figure 4), as noted for UGT1A1-mediated reactions in previous studies.31,38,39 The mechanisms for substrate inhibition in metabolic reactions appear to be rather complex.31 The proposed mechanisms included multiple (at least two) binding sites within the enzyme, formation of a ternary deadend enzyme complex, and ligand-induced changes in enzyme conformation.31 It was noted that binding of the aglycones to microsomal proteins was negligible as estimated from the Hallifax and Houston model.40 Thus, it was unnecessary to correct the kinetic parameters with protein binding. The model aglycones (genistein, apigenin, and emodin) undergo extensive glucuronidation reactions in the intestine and liver.41−44 In addition, it is well-accepted that the interplay of UGT enzymes with efflux transporters facilitates production and excretion of glucuronides in the intestine and liver, limiting the oral bioavailability of drugs.19,37 Our finding that suppressed efflux of glucuronides led to reduced glucuronidation (or elevated drug exposure) was well consistent with the study of Yang et al. in which Bcrp knockout mice showed improved bioavailability of genistein.45 Hence, our results generated from HeLa1A1 cells (and the transporter knock-down cell lines) will

GG (Figures 6−8). Significant contributions of these three transporters to glucuronide excretion were possible because MRP1, MRP3, and MRP4 did express in HeLa cells (Figure 2), as also found by a different group of investigators.34 BCRP and MRP proteins showed overlapping substrate selectivity toward many glucuronides such as AG, GG, and others.35 The extensive overlaps in substrate selectivity were a main reason why selective substrates/inhibitors are lacking.36 It was interesting to note here that BCRP silencing caused a marked reduction in excretion of EG, whereas silencing of three MRP proteins did not (Figures 6−8). This suggested that EG was a good substrate transported by BCRP rather than MRPs. In this regard, EG was a potentially selective substrate for BCRP. However, MRPs were suggested to be involved in excretion of EG based on chemical inhibition experiments in a previous study of Liu et al.37 Although the results of Liu et al.37 may be confounded by the fact that chemical inhibitors can also modify the glucuronidation activity,21 further investigations were warranted to address this discrepancy. Three aglycones (i.e., genistein, apigenin, and emodin) with distinct rates of glucuronidation (at 5 μM) were chosen as the model compounds to determine the effects of transporter knock-down on cellular glucuronidation. The glucuronidation rates of genistein, apigenin, and emodin by UGT1A1 were 0.117, 0.300, and 1.21 nmol/min/mg, respectively (Figure 4). Further, the excretion rates of GG, AG, and EG were 0.20, 0.44, and 2.4 nmol/h/mg protein, respectively (Figure 5). The rates of glucuronidation were well correlated with the excretion rates 1275

DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278

Article

Molecular Pharmaceutics

Figure 8. Effects of shRNA-mediated MRP4 knock-down on glucuronide excretion and cellular glucuronidation. Effects of MRP4 knock-down on the excretion profile of (A) genistein glucuronide (GG), (B) apigenin glucuronide (AG), and (C) emodin glucuronide (EG). Effects of MRP4 knock-down on cellular glucuronidation (or f met) of (D) genistein, (E) apigenin, and (F) emodin. Effects of MRP4 knock-down on the intracellular level of (G) GG, (H) AG, and (I) EG. *p < 0.05; ***p < 0.001.

Figure 9. Hydrolysis of genistein glucuronide (A), apigenin glucuronide (B), and emodin glucuronide (C) by HeLa1A1 cell lysate.

contribute to improved understanding of and predicting of drug disposition in vivo. The finding that knock-down of efflux transporters led to reduced glucuronidation represented one aspect of glucuronidation-transport interplay. We also found that the

glucuronides (GG, AG, and EG) can be hydrolyzed back to the parent compounds (aglycones) within the cells (Figure 9). Hence, we proposed that the deglucuronidation (or futile recycling) mediated by β-glucuronidase was involved in glucuronidation-transport interplay, contributing to reduced 1276

DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278

Article

Molecular Pharmaceutics production of glucuronides.18 It was envisioned that a pharmacokinetic model was of great value to aid in a better mechanistic understanding of the glucuronidation-transport interplay. It was noteworthy that the changes in intracellular levels of glucuronides were compound- and transporter-dependent (Figures 5−8). An increase in intracellular glucuronides (e.g., GG increased in Figure 8G) was usually observed when the efflux transporter activity was blocked.32,37 However, the intracellular concentrations of GG, AG, and EG remained the same or decreased (except for GG against MRP4) in the transporter knock-down cells. The reduced or unchanged intracellular glucuronide levels most likely were the result of increased impact of β-glucuronidase activity in cells with efflux transporter knock-down as opposed to control cells. Our results suggested that deglucuronidation was a critical determinant to intracellular accumulation of drug glucuronides. In summary, following introduction of UGT1A1 to HeLa cells and generation of the HeLa1A1 cells that were active in catalyzing glucuronidation reactions, we established four stable transporter knock-down cell lines (i.e., HeLa1A1-BCRPshRNA, HeLa1A1-MRP1-shRNA, HeLa1A1-MRP3-shRNA, and HeLa1A1-MRP4-shRNA cells) by transfection of shRNA plasmids using lentiviral transfection method. The knock-down cells showed identical expression of UGT1A1 but decreased expression of the target transporter. All these cell lines were functional in generating glucuronides from the aglycones genistein, apigenin, and emodin. In addition, we demonstrated that knock-down of transporters led to reduced glucuronidation, providing direct evidence that there was a strong dependence of cellular glucuronidation on the efflux transporters. Further, it was revealed that excretion of GG and AG was contributed by multiple efflux transporters, whereas excretion of EG was contributed by BCRP only. Therefore, the newly established cell lines were an excellent tool to determine exact contributions of efflux transporters to glucuronide excretion and to study the glucuronidationtransport interplay.

■

inhibition constant; MRP, multidrug resistance-associated protein; MS, mass spectroscopy; P-gp, P-glycoprotein; QTOF, quadrupole time-of-flight; shRNA, short hairpin RNA; UDPGA, uridine diphosphoglucuronic acid; UGT, UDP-glucuronosyltransferase; UPLC, ultra performance liquid chromatography; Vm, maximal velocity

■

(1) Costa, A.; Sarmento, B.; Seabra, V. An evaluation of the latest in vitro tools for drug metabolism studies. Expert Opin. Drug Metab. Toxicol. 2014, 10 (1), 103−119. (2) Kola, I.; Landis, J. Can the pharmaceutical industry reduce attrition rates? Nat. Rev. Drug Discovery 2004, 3 (8), 711−716. (3) Prentis, R. A.; Lis, Y.; Walker, S. R. Pharmaceutical innovation by the seven UK-owned pharmaceutical companies (1964−1985). Br. J. Clin. Pharmacol. 1988, 25 (3), 387−396. (4) Ortiz de Montellano, P. R. Cytochrome P450: Structure, Mechanism, and Biochemistry; Kluwer Academic/ Plenum: New York, 2005. (5) Jancova, P.; Anzenbacher, P.; Anzenbacherova, E. Phase II drug metabolizing enzymes. Biomed. Pap. 2010, 154 (2), 103−16. (6) Wienkers, L. C.; Heath, T. G. Predicting in vivo drug interactions from in vitro drug discovery data. Nat. Rev. Drug Discovery 2005, 4 (10), 825−33. (7) DeGorter, M. K.; Xia, C. Q.; Yang, J. J.; Kim, R. B. Drug transporters in drug efficacy and toxicity. Annu. Rev. Pharmacol. Toxicol. 2012, 52, 249−73. (8) Giacomini, K. M.; Huang, S. M.; Tweedie, D. J.; Benet, L. Z.; Brouwer, K. L.; Chu, X.; Dahlin, A.; Evers, R.; Fischer, V.; Hillgren, K. M.; Hoffmaster, K. A.; Ishikawa, T.; Keppler, D.; Kim, R. B.; Lee, C. A.; Niemi, M.; Polli, J. W.; Sugiyama, Y.; Swaan, P. W.; Ware, J. A.; Wright, S. H.; Yee, S. W.; Zamek-Gliszczynski, M. J.; Zhang, L. Membrane transporters in drug development. Nat. Rev. Drug Discovery 2010, 9 (3), 215−36. (9) Cummins, C. L.; Salphati, L.; Reid, M. J.; Benet, L. Z. In vivo modulation of intestinal CYP3A metabolism by P-glycoprotein: studies using the rat single-pass intestinal perfusion model. J. Pharmacol. Exp. Ther. 2003, 305 (1), 306−14. (10) Lau, Y. Y.; Wu, C. Y.; Okochi, H.; Benet, L. Z. Ex situ inhibition of hepatic uptake and efflux significantly changes metabolism: hepatic enzyme-transporter interplay. J. Pharmacol. Exp. Ther. 2004, 308 (3), 1040−5. (11) Lam, J. L.; Okochi, H.; Huang, Y.; Benet, L. Z. In vitro and in vivo correlation of hepatic transporter effects on erythromycin metabolism: characterizing the importance of transporter-enzyme interplay. Drug Metab. Dispos. 2006, 34 (8), 1336−44. (12) Salphati, L. Transport-metabolism interplay. Mol. Pharmaceutics 2009, 6 (6), 1629−30. (13) Benet, L. Z. The drug transporter-metabolism alliance: uncovering and defining the interplay. Mol. Pharmaceutics 2009, 6 (6), 1631−43. (14) Pang, K. S.; Maeng, H. J.; Fan, J. Interplay of transporters and enzymes in drug and metabolite processing. Mol. Pharmaceutics 2009, 6 (6), 1734−55. (15) Endres, C. J.; Endres, M. G.; Unadkat, J. D. Interplay of drug metabolism and transport: a real phenomenon or an artifact of the site of measurement? Mol. Pharmaceutics 2009, 6 (6), 1756−65. (16) Zhang, L.; Zhang, Y.; Huang, S. M. Scientific and regulatory perspectives on metabolizing enzyme-transporter interplay and its role in drug interactions: challenges in predicting drug interactions. Mol. Pharmaceutics 2009, 6 (6), 1766−74. (17) Siissalo, S.; Laine, L.; Tolonen, A.; Kaukonen, A. M.; Finel, M.; Hirvonen, J. Caco-2 cell monolayers as a tool to study simultaneous phase II metabolism and metabolite efflux of indomethacin, paracetamol and 1-naphthol. Int. J. Pharm. 2010, 383 (1−2), 24−9. (18) Wu, B. Pharmacokinetic interplay of phase II metabolism and transport: a theoretical study. J. Pharm. Sci. 2012, 101 (1), 381−93.

ASSOCIATED CONTENT

S Supporting Information *

Kinetic profiles for glucuronidation reactions mediated by HeLa1A1 cell lysate. This material is available free of charge via the Internet at http://pubs.acs.org.

■

REFERENCES

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Author Contributions §

These authors contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the Young Scientist Special Projects in biotechnological and pharmaceutical field of 863 Program (SS2015AA020916).

■

ABBREVIATIONS USED BCRP/Bcrp, breast cancer resistance protein; CYP, cytochrome P450; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum; Km, Michaelis−Menten constant; Ksi, substrate 1277

DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278

Article

Molecular Pharmaceutics

bioavailability of emodin. Toxicol. Appl. Pharmacol. 2012, 65 (3), 316−24. (38) Tang, L.; Singh, R.; Liu, Z.; Hu, M. Structure and concentration changes affect characterization of UGT isoform-specific metabolism of isoflavones. Mol. Pharmaceutics 2009, 6 (5), 1466−82. (39) Wu, B.; Xu, B.; Hu, M. Regioselective glucuronidation of flavonols by six human UGT1A isoforms. Pharm. Res. 2011b, 28 (8), 1905−18. (40) Hallifax, D.; Houston, J. B. Binding of drugs to hepatic microsomes: comment and assessment of current prediction methodology with recommendation for improvement. Drug Metab. Dispos. 2006, 34 (4), 724−726. (41) Liu, Y.; Hu, M. Absorption and metabolism of flavonoids in the caco-2 cell culture model and a perused rat intestinal model. Drug Metab. Dispos. 2002, 30 (4), 370−7. (42) Andlauer, W.; Kolb, J.; Stehle, P.; Fürst, P. Absorption and metabolism of genistein in isolated rat small intestine. J. Nutr. 2000, 130 (4), 843−6. (43) Teng, Z. H.; Zhou, S. Y.; Yang, R. T.; Liu, X. Y.; Liu, R. W.; Yang, X.; Zhang, B. L.; Yang, J. Y.; Cao, D. Y.; Mei, Q. B. Quantitation assay for absorption and first-pass metabolism of emodin in isolated rat small intestine using liquid chromatography-tandem mass spectrometry. Biol. Pharm. Bull. 2007, 30 (9), 1628−33. (44) Liu, W.; Tang, L.; Ye, L.; Cai, Z.; Xia, B.; Zhang, J.; Hu, M.; Liu, Z. Species and gender differences affect the metabolism of emodin via glucuronidation. AAPS J. 2010, 12 (3), 424−36. (45) Yang, Z.; Zhu, W.; Gao, S.; Yin, T.; Jiang, W.; Hu, M. Breast cancer resistance protein (ABCG2) determines distribution of genistein phase II metabolites: reevaluation of the roles of ABCG2 in the disposition of genistein. Drug Metab. Dispos. 2012, 40 (10), 1883−93.

(19) Jeong, E. J.; Liu, X.; Jia, X.; Chen, J.; Hu, M. Coupling of conjugating enzymes and efflux transporters: impact on bioavailability and drug interactions. Curr. Drug Metab. 2005, 6 (5), 455−68. (20) Liu, Z.; Hu, M. Natural polyphenol disposition via coupled metabolic pathways. Expert Opin. Drug Metab. Toxicol. 2007, 3 (3), 389−406. (21) Quan, E.; Wang, H.; Dong, D.; Zhang, X.; Wu, B. Characterization of chrysin glucuronidation in UGT1A1-overexpressing HeLa cells: elucidating the transporters responsible for efflux of glucuronide. Drug Metab. Dispos. 2015, 43, 443−43. (22) Tukey, R. H.; Strassburg, C. P. Human UDP-glucuronosyltransferases: metabolism, expression, and disease. Annu. Rev. Pharmacol. Toxicol. 2000, 40, 581−616. (23) Nagar, S.; Blanchard, R. L. Pharmacogenetics of uridine diphosphoglucuronosyltransferase (UGT) 1A family members and its role in patient response to irinotecan. Drug Metab. Rev. 2006, 38 (3), 393−409. (24) Fujita, K.; Sparreboom, A. Pharmacogenetics of irinotecan disposition and toxicity: a review. Curr. Clin. Pharmacol. 2010, 5 (3), 209−17. (25) Liu, H.; Wu, Z.; Ma, Z.; Wu, B. Glucuronidation of macelignan by human liver microsomes and expressed UGT enzymes: identification of UGT1A1 and 2B7 as the main contributing enzymes. Biopharm. Drug Dispos. 2014, 35, 513−24. (26) Rio, D. C.; Ares, M., Jr; Hannon, G. J.; Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb. Protoc. 2010, 2010 (6), pdb.prot5439. (27) Liu, H.; Sun, H.; Lu, D.; Zhang, Y.; Zhang, X.; Ma, Z.; Wu, B. Identification of glucuronidation and biliary excretion as the main mechanisms for gossypol clearance: in vivo and in vitro evidence. Xenobiotica 2014, 44 (8), 696−707. (28) Fu, J.; Liu, H.; Xing, H.; Sun, H.; Ma, Z.; Wu, B. Comparative analysis of glucuronidation of ethanol in treeshrews, rats and humans. Xenobiotica 2014, 44 (12), 1067−73. (29) Sun, H.; Wang, H.; Liu, H.; Zhang, X.; Wu, B. Glucuronidation of capsaicin by liver microsomes and expressed UGT enzymes: reaction kinetics, contribution of individual enzymes and marked species differences. Expert Opin. Drug Metab. Toxicol. 2014, 10 (10), 1325−36. (30) Hutzler, J. M.; Tracy, T. S. Atypical kinetic profiles in drug metabolism reactions. Drug Metab. Dispos. 2002, 30 (4), 355−62. (31) Wu, B. Substrate inhibition kinetics in drug metabolism reactions. Drug Metab. Rev. 2011, 43 (4), 440−56. (32) Jiang, W.; Xu, B.; Wu, B.; Yu, R.; Hu, M. UDPglucuronosyltransferase (UGT) 1A9-overexpressing HeLa cells is an appropriate tool to delineate the kinetic interplay between breast cancer resistance protein (BRCP) and UGT and to rapidly identify the glucuronide substrates of BCRP. Drug Metab. Dispos. 2012, 40 (2), 336−45. (33) Wu, B.; Jiang, W.; Yin, T.; Gao, S.; Hu, M. A new strategy to rapidly evaluate kinetics of glucuronide efflux by breast cancer resistance protein (BCRP/ABCG2). Pharm. Res. 2012, 29 (11), 3199−208. (34) Ahlin, G.; Hilgendorf, C.; Karlsson, J.; Szigyarto, C. A.; Uhlén, M.; Artursson, P. Endogenous gene and protein expression of drugtransporting proteins in cell lines routinely used in drug discovery programs. Drug Metab. Dispos. 2009, 37, 2275−2283. (35) Xu, H.; Kulkarni, K. H.; Singh, R.; Yang, Z.; Wang, S. W.; Tam, V. H.; Hu, M. Disposition of naringenin via glucuronidation pathway is affected by compensating efflux transporters of hydrophilic glucuronides. Mol. Pharmaceutics 2009, 6 (6), 1703−15. (36) Matsson, P.; Pedersen, J. M.; Norinder, U.; Bergström, C. A.; Artursson, P. Identification of novel specific and general inhibitors of the three major human ATP-binding cassette transporters P-gp, BCRP and MRP2 among registered drugs. Pharm. Res. 2009, 26 (8), 1816− 31. (37) Liu, W.; Feng, Q.; Li, Y.; Ye, L.; Hu, M.; Liu, Z. Coupling of UDP-glucuronosyltransferases and multidrug resistance-associated proteins is responsible for the intestinal disposition and poor 1278

DOI: 10.1021/mp5008019 Mol. Pharmaceutics 2015, 12, 1268−1278