Article pubs.acs.org/biochemistry
Structural and Functional Effects of Cardiomyopathy-Causing Mutations in the Troponin T‑Binding Region of Cardiac Tropomyosin Alexander M. Matyushenko,†,‡ Daniil V. Shchepkin,§ Galina V. Kopylova,§ Katerina E. Popruga,†,‡ Natalya V. Artemova,† Anastasia V. Pivovarova,† Sergey Y. Bershitsky,§ and Dmitrii I. Levitsky*,†,∥ †
A. N. Bach Institute of Biochemistry, Research Center of Biotechnology, Russian Academy of Sciences, Leninsky Prospect 33, Moscow 119071, Russian Federation ‡ Department of Biochemistry, School of Biology, Moscow State University, Lenin Hills 1, bld 12, Moscow 119234, Russian Federation § Institute of Immunology and Physiology, Russian Academy of Sciences, Pervomayskaya Street 106, Yekaterinburg 620049, Russian Federation ∥ A. N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Lenin Hills 1, bld 40, Moscow 119234, Russian Federation ABSTRACT: Hypertrophic cardiomyopathy (HCM) is a severe heart disease caused by missense mutations in genes encoding sarcomeric proteins of cardiac muscle. Many of these mutations are identified in the gene encoding the cardiac isoform of tropomyosin (Tpm), an α-helical coiled-coil actin-binding protein that plays a key role in Ca2+-regulated contraction of cardiac muscle. We employed various methods to characterize structural and functional features of recombinant human Tpm species carrying HCM mutations that lie either within the troponin T-binding region in the C-terminal part of Tpm (E180G, E180V, and L185R) or near this region (I172T). The results of our structural studies show that all these mutations affect, although differently, the thermal stability of the C-terminal part of the Tpm molecule: mutations E180G and I172T destabilize this part of the molecule, whereas mutation E180V strongly stabilizes it. Moreover, various HCM-causing mutations have different and even opposite effects on the stability of the Tpm−actin complexes. Studies of reconstituted thin filaments in the in vitro motility assay have shown that those HCM-associated mutations that lie within the troponin T-binding region of Tpm similarly increase the Ca2+ sensitivity of the sliding velocity of the filaments and impair their relaxation properties, causing a marked increase in the sliding velocity in the absence of Ca2+, while mutation I172T decreases the Ca2+ sensitivity and has no influence on the sliding velocity under relaxing conditions. Finally, our data demonstrate that various HCM mutations can differently affect the structural and functional properties of Tpm and cause HCM by different molecular mechanisms.
I
mutations and from 4 to 11 mutations associated with DCM have been identified in Tpm1.1.2,3 Tpm is an actin-binding protein that forms a ropelike structure along the entire length of the actin filament and plays, together with the troponin (Tn) complex, a key role in Ca2+regulated contraction of striated muscles.4−6 According to recent views, Tpm serves as a “gatekeeper” for actin−myosin interaction.7 In the absence of Ca2+, it sterically blocks the myosin-binding sites on actin, and Ca2+ binding to Tn during muscle activation leads Tpm to move away from the blocking (B) position and allows binding of myosin heads to actin.5,6,8 In terms of structure, the Tpm molecule is a typical α-helical coiled-coil dimer whose amino acid sequence contains a heptad repeat (a-b-c-d-e-f-g) in which residues at positions a and d are
nherited cardiomyopathies are severe heart diseases in all age groups. Clinical consequences of these diseases are very diverse and can vary from relatively mild hypertrophy and hypertension to severe hypertrophy leading to complete heart dysfunction and sudden death. Both hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) are mainly caused by autosomal dominant inheritance of missense mutations in genes encoding sarcomeric proteins of cardiac muscle. HCM is characterized by an abnormally thickened left ventricular wall and an abnormally thickened interventricular septum and diastolic dysfunction, and DCM is characterized by a dilated left ventricle and systolic dysfunction.1 Cardiomyopathic mutations have been found in all genes encoding the proteins of the thin filament in the sarcomere (actin, tropomyosin, troponin I, troponin C, and troponin T). Among them, numerous mutations have been identified in the TPM1 gene encoding the cardiac isoform of tropomyosin (Tpm), Tpm1.1 or α-Tpm. From 11 to 17 HCM-causing © XXXX American Chemical Society
Received: September 29, 2016 Revised: December 1, 2016 Published: December 8, 2016 A
DOI: 10.1021/acs.biochem.6b00994 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
reaching 30 years of age, but the symptom progressively turned to DCM at the age of 40.2,25 In this work, we applied various methods and approaches to characterize structural and functional features of recombinant human cardiac Tpm mutants L185R and I172T. Moreover, we for the first time investigated the properties of Tpm carrying mutation E180V. The widely studied E180G Tpm mutant was chosen as a control for these experiments besides wild-type (WT) Tpm.
hydrophobic and form a hydrophobic core of the molecule while residues at positions e and g, which are typically of opposite charge, form electrostatic interchain interactions and additionally stabilize the coiled-coil structure.6,9 Thus, the structure of the Tpm molecule is strictly determined by its sequence, and therefore, even single-amino acid substitutions (e.g., mutations associated with inherited cardiomyopathies) can significantly affect the structural and functional properties of Tpm.2,3,6 Among numerous cardiomyopathy-causing mutations in the TPM1 gene, five HCM-causing mutations (I172T, D175N, E180G, E180V, and L185R) lie within or near the area of residues 175−190.2,3 This area is one of the two troponin Tbinding regions in the Tpm1.1 molecule (so-called TnT2binding region that binds the C-terminal part of TnT), and it plays an important role in the interaction of the Tn complex with Tpm.10,11 To date, the effects of two HCM-causing mutations in this region, D175N and E180G, on the structural and functional properties of Tpm are the most studied in comparison with the others. Structural studies have shown that mutation E180G, unlike D175N, decreases the thermal stability (i.e., increases the flexibility) of the C-terminal part of Tpm and also essentially destabilizes the actin−Tpm complex.12 In vitro studies showed that this mutation causes a significant decrease in the actin binding affinity of Tpm12−14 and an increase in the Ca2+ sensitivity of the thin filament sliding velocity measured with an in vitro motility assay.13,15 In vivo studies of transgenic mice expressing Tpm with mutation D175N or E180G showed that one of them (D175N) causes only a mild hypertrophy,16 whereas the other mutation (E180G) leads to severe cardiac hypertrophy in mice and their death.17 A significant difference between the effects of mutations D175N and E180G on the contractile properties of cardiac muscle was also observed in experiments with cardiac myocytes18 and permeabilized fibers from the heart of transgenic rats19 expressing Tpm with these mutations. Thus, structural and functional properties of Tpm with mutations D175N and E180G whose association with inherited HCM was discovered more than 20 years ago20 have been intensively studied. Much less is known about the effects on the Tpm properties of two other HCM-causing mutations in the TnT2-binding region, L185R and I172T, which were first identified ∼10 years later.21,22 One of these mutations, L185R, was discovered in a family suffering from HCM, some of whose members suddenly died in childhood,21 and another one, I172T, was found in a single patient with a family history of sudden cardiac death at the age of 53 and identified as hypothetically HCM-causing.22 However, little is known about the influence of these mutations on the structure and functional properties of Tpm. The results of a recently published study showed that both L185R and I172T mutations increase, although rather slightly, the thermal stability of Tpm, and mutation L185R (but not I172T) causes an increase in the actin binding affinity of Tpm.23 Both these Tpm mutations were shown to increase the Ca2+ sensitivity of the ATPase activity of myosin in the presence of reconstituted thin filaments23 or in myofibrils.24 As for mutation E180V, its influence on the structural and functional properties of Tpm remains unknown because the properties of Tpm with this mutation have not yet been investigated. However, this mutation is of particular interest because its clinical consequence can change with age: a patient with the E180V mutation was diagnosed to have HCM until
■
EXPERIMENTAL PROCEDURES Protein Preparations. All Tpm species used in this work were recombinant proteins that have an Ala-Ser N-terminal extension to imitate naturally occurring N-terminal acetylation of native Tpm.26 Human Tpm1.1 E180V, E180G, L185R, and I172T mutants were prepared in bacterial expression plasmid pMW17227 by polymerase chain reaction-mediated sitedirected mutagenesis using Pfu DNA polymerase (SibEnzyme, Novosibirsk, Russia). The following oligonucleotides were used for mutagenesis: GAACGTGCAGGGGAGCGG for E180G, GAACGTGCAGTGGAGCGG for E180V, GCTGGTCATCACTGAGAGCGAC for I172T, and GCTGAGCGCTCAGAAGGC for L185R (mutant codons are underlined). The polymerase chain reaction products were cloned and sequenced to verify the substitutions. Protein expression and purification were performed as described previously.28 Rabbit skeletal muscle actin and bovine cardiac troponin were prepared by established standard methods.29,30 F-Actin polymerized by the addition of 2 mM MgCl2 and 100 mM KCl was further stabilized by the addition of a 1.5-fold molar excess of phalloidin (Sigma-Aldrich). For the in vitro motility assay, Factin was labeled with a 2-fold molar excess of TRITCphalloidin (Sigma-Aldrich). Porcine cardiac myosin was prepared from the left ventricle by the standard method.31 All Tpm species were reduced before experiments by being heated at 60 °C for 45 min in the presence of 15 mM βmercaptoethanol or 2 mM DTT. After such a procedure, all Tpm samples were in the fully reduced state.12,32 In all the experiments, the solution contained 2 mM DTT to prevent disulfide cross-linking between Cys190 residues in two chains of the Tpm homodimers. CD Measurements. Far-UV CD spectra of Tpm species (1.0 mg/mL) were recorded at 5 °C on a Chirascan circular dichroism spectrometer (Applied Photophysics) in 0.02 cm cells. Thermal unfolding was measured by following the molar ellipticity of Tpm at 222 nm over a temperature range from 5 to 70 °C at a constant heating rate of 1 °C/min. All measurements were performed in 30 mM Na-Pi buffer (pH 7.3) containing 100 mM NaCl. The reversibility of the unfolding− refolding process was assessed by reheating the Tpm sample immediately after it had cooled from the previous temperature scan. The thermal unfolding of all Tpm species was fully reversible. Differential Scanning Calorimetry (DSC). DSC experiments were performed as described previously12,32−34 on a DASM-4M differential scanning microcalorimeter (Institute for Biological Instrumentation RAS, Pushchino, Russia) at a heating rate of 1 °C/min in 20 mM Na-Pi buffer (pH 7.3) containing 100 mM NaCl and 1 mM MgCl2. The protein concentration was 2.0 mg/mL. The reversibility of the heat sorption curves was assessed by reheating the sample immediately after it had cooled from the previous scan. All Tpm samples were fully reduced before DSC experiments as B
DOI: 10.1021/acs.biochem.6b00994 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
30−50 thin filaments. The filament sliding velocities were measured and analyzed using GMimPro.38 Movement of 5−15 filaments in each field was tracked in at least 10 frames, and filaments moving at a uniform speed (i.e., the standard deviation of the frame-to-frame speed was
