Structural Revision and Biosynthesis of the Fungal Phytotoxins

Communication pubs.acs.org/jnp

Structural Revision and Biosynthesis of the Fungal Phytotoxins Phyllostictines A and B Francesco Trenti and Russell J. Cox* Institute for Organic Chemistry and BMWZ, Leibniz Universität Hannover, Schneiderberg 38, Hannover 30167, Germany S Supporting Information *

ABSTRACT: The structure of the fungal phytotoxins known as the phyllostictines has been revised to a series of bicyclic 3methylene tetramic acids. Genome sequencing of the producing organism Phyllostica cirsii has revealed a biosynthetic gene cluster responsible for the biosynthesis of the phyllostictines, and targeted knockout experiments have proven the link and produced an intermediate. hyllostictine A (1) is produced by a filamentous fungus known as Phyllostica cirsii, which is a pathogen of the weed species canada thistle (Cirsium arvense). 1 was originally isolated as part of a project to develop compounds active against problematic weed pests, and three major congeners, phyllostictines B−D (2−4) were also reported.1 These compounds display phytotoxicity vs Canada thistle and may be candidates for development as selective herbicides, although other reported activities include cytotoxicity vs human cell lines.2 Preliminary synthetic studies toward the construction of this family of compounds have been reported, but to date have not been fully successful.3 Our interest was stimulated by the highly unusual tricyclic structures reported for 1−4, in particular the unprecedented Z-α-(dihydrofuran-3(2H)-ylidene)-β-lactam core, which is common to 1−3.4 The biosynthesis of such compounds by known fungal polyketide, peptide, alkaloid, or terpene pathways seemed unlikely, raising the possibility of new types of biosynthetic processes in fungi. Since no biosynthetic investigations have been reported for this class of compounds, we set out to investigate their biosynthesis using a combination of traditional labeling and modern genome sequencing methods. In our hands P. cirsii produced compounds 1−4 under the reported fermentation conditions, although 3 and 4 were present in only trace amounts (liquid chromatography mass spectrometry, LCMS; see the Supporting Information (SI)). In particular, purification of 1 revealed its 1H and 13C NMR and HRMS data to be identical to those reported in the literature

P

(Table 1). Time-course analysis showed that 1 and congeners are produced after approximately 8 days of fermentation in static liquid media and continue to accumulate for around 20 days. We investigated the biosynthetic origin of the carbon atoms of 1 by supplementing producing cultures with either [1-13C] or [2-13C] acetate to a final concentration of 14.5 mM. Purification of 1 from these cultures and examination by 13C Table 1. 1D NMR Data for 1 and the Reassigned Structure 5a δC/ppm

δH/ppm CDCl3, 313 K

125 MHz 166.8 156.5 136.8 104.7 92.8 86.6 72.2 68.9 64.9 32.1 29.6 29.5 27.8 26.9 22.9 17.0 14.4

500 MHz

5.07 d, 1H J = 1.6 Hz 5.02 d, 1H, J = 1.6 Hz 4.04 m, 1H 4.47 3.91 1.30 1.30 1.30 1.81 1.58 1.30 1.25 0.89

br s, 1H s, 3H m m m, 1.26 m m, 1.37 m, 2H m; 1.37 m, 2H m s, 3H t, 3H, J = 7.0 Hz

literature assignment1

reassignment

3 2 1 12 14

1 4 3 5 17

11 5 15 MeO MeCH2N 7 8 10 9 6 Me-C(5) MeCH2N

8 7 6 16 11 13 14 9 10 12 18 15

a

See Scheme 1 for atom numbering. Not all signals could be accurately integrated due to overlap. Received: March 3, 2017 Published: May 3, 2017

Figure 1. Reported structures of the phyllostictines A−D (1−4). © 2017 American Chemical Society and American Society of Pharmacognosy

1235

DOI: 10.1021/acs.jnatprod.7b00183 J. Nat. Prod. 2017, 80, 1235−1240

Journal of Natural Products

Communication

NMR showed a good incorporation of label (see the SI). However, correlation of the labeled carbon resonances with their reported positions in 1 gave alarmingly inconsistent results. Instead of the expected alternating pattern of 1- and 2labeled positions, the labeling pattern was apparently random (Scheme 1A). Scheme 1. (A) Isotope Labeling Positions from [1-13C]- and [2-13C] Acetate Feeding Experiments into 1 and Selected HMBC (H to C) NMR Correlations for 1; (B) Incorporation of Isotopic Labels from SAM, L-Alanine, and Acetate Mapped onto the Reassigned Structure 5 and Selected HMBC (H to C) NMR Correlations for 5

Figure 2. Structures of 6 and related compounds.

alanine by a feeding experiment with [1-13C]-alanine, which specifically labeled the 4-carbon of 5. A similar feeding experiment using [methyl-13C]-methionine confirmed that the N-O-methyl and the 7-methyl are derived as expected from Sadenosyl methionine (Scheme 1B; see the SI for 13C spectra). A draft genome sequence of P. cirsii was generated by Illumina sequencing. The calculated genome size was 34 Mb, contained on approximately 300 scaffolds of average size 112 Kb (Scaffold N50 = 280 Kb). Interestingly, comparison of the internal transcribed spacer (ITS) sequence shows that the producing organism is more closely related to Phaeosphaeria species of fungi than to other characterized species of Phyllosticta (see the SI). Screening the scaffolds using antiSMASH11 revealed the presence of 32 putative biosynthetic gene clusters (BGCs), but only two instances of hybrid PKS− NRPS systems. One of these two BGCs contains an Omethyltransferase-encoding gene, possibly involved in the construction of the N-O-methyl moiety of 1, and we thus focused on this cluster for further study. This cluster (labeled phy) consists of 10 potential open reading frames encoding likely biosynthetic proteins (Table 2). Interestingly many of the closest homologues of the phy genes form part of a BGC in the fungal human pathogen Madurella mycetomatis (see the SI). Genetic manipulations of P. cirsii have not previously been described. We therefore developed a method based on the creation of protoplasts and their transformation using vectors with the hygromycin resistance gene hph derived from E. coli12 driven by the Aspergillus nidulans gpdA promoter (PgpdA).13 Initial work showed that P. cirsii is sensitive to hygromycin B at 25 μg/mL, and transformation of the protoplasts with a vector containing the hygromycin resistance cassette led to the creation of small numbers of hygromycin-resistant transformants after selection. In order to link the cluster to the biosynthesis of 5, we used the bipartite knockout (KO) strategy described by Nielsson and co-workers.14 Targetted KO of phyS, encoding the PKS−NRPS, by insertion of the hygromycin resistance cassette led to the creation of a single transformant that lacked the ability to produce 5 or any of the related phyllostictines B−D (Figure 3; see the SI). Attempts to knock out other genes in the cluster led to either no isolated transformants or, in the case of phyL6, which encodes a cytochrome P450 monooxygenase, a single transformant that was shown to produce the corresponding NH tetramic acid 12 (Figure 3), which we name phyllostictine E.

We reasoned that possible misassignment of carbon resonances, especially within the pentamethylene moiety of the 11-membered ring of 1, could be partly responsible. We therefore obtained HMBC and HSQC data for 1 in order to check the assignments, and this immediately showed that the previously reported structure of 1 must be incorrect. In particular, HMBC signals associated with the methyl attached to quaternary C-5, such as strong apparent 5-bond and 7/8 bond correlations to C-15 and C-11, respectively, but no observed 3-bond correlations to C-1 and C-6, are inconsistent with the claimed structure (Scheme 1A). Full structural elucidation using the 2D NMR data obtained in DMSO-d6 (see the SI) led to a revision of the structure to the N-O-methyl 3-methylene tetramic acid 5 (Scheme 1B). In particular, CH3-18 now correlates to C-6, C-7, and C-8. The methylene tetramic acid is confirmed by correlations between H-17 and C-3 and C-4, and correlation between OH-7 and C18 locates the methyl and OH as attached to the same carbon. Key correlations from H-6 to C-1, C-4, C-5, C-7, and C-8 confirm the bicyclic structure (Scheme 1B). Similar compounds have been reported previously, such as phaeosphaeride A (6) from an endophytic fungus closely related to Phaeosphaeria avenaria,5 pyranonigrin E (7) from Aspergillus niger,6 spirostaphylotrichin (8) from Staphylotrichum coccosporum,7 and paraphaeosphaerides A−C (9−11) from Paraphaeosphaeria neglecta FT462 (Figure 2).8 Using the newly determined structure, correlation with the 13 C labeling positions derived from acetate showed conclusively that phyllostictine A (5) is derived from a hexaketide fused to a 3-carbon and nitrogen-containing moiety forming the tetramic acid (Scheme 1B). This is entirely in accord with the observation that fungal tetramic acids are biosynthesized by hybrid polyketide synthase (PKS)−nonribosomal peptide synthetase (NRPS) systems.9,10 In this case the 3-carbon and nitrogen-containing moiety was confirmed to be derived from 1236



Communication

Table 2. Annotation of the Putative Phyllostictine (phy) Biosynthetic Gene Cluster

name

annotation

phyL9 phyL8 phyL7 phyL6 phyL5 phyL4 phyL3 phyL2 phyL1 phyS

monooxygenase oxygenase O-methyl transferase cytochrome P450 very-long-chain 3-oxoacyl-CoA reductase enoyl reductase; dehydrogenase toxin efflux transporter transcription factor oxidoreductase PKS−NRPS

nearest pBLAST hit Penicillium griseof ulvum Madurella mycetomatis Pyrenophora tritici repentis Madurella mycetomatis Phialophora attae Eutypa lata Rosellinia necatrix Madurella mycetomatis Aspergillus oryzae Madurella mycetomatis

PGRI_02982 MMYC01_206825 PTRG_04253 MMYC01_206826 AB675_8878 UCREL1_10570 MFS MMYC01_206820 GclD MMYC01_206823 (pksD)

predicted cofactor NAD/FAD 2-oxoglutarate/Fe(II) SAM haem-thiolate NAD(P) Zn+; NAD(P) Zn2+ FAD

Figure 3. HPLC ELSD chromatograms showing the extract from WT P. cirsii and results of ΔphyL6 and ΔphyS knockouts. *Unrelated compounds. See the SI for more details.

respectively. Since in the literature NMR data1 for phyllostictines C and D the methyl signal corresponding to C-18 is missing in both cases, we assume that these changes probably mean that phyllostictine C is the C-18 alcohol 13, consistent with a new carbon resonance at 68.1 ppm, and phyllostictine D is the corresponding C-18 aldehyde 14, consistent with the appearance of a carbon resonance at 210 ppm in the original literature data (Scheme 2). On the basis of the labeling studies and the analysis of the phy biosynthetic gene cluster we can propose a likely biosynthetic pathway for the synthesis of the phyllostictines and the closely related metabolites. In the first step a hybrid PKS−NRPS, aided by a trans-acting ER18 encoded by phyL4 (see the SI), produces a monomethylated β-keto unsaturated hexaketide or pentaketide from acetate and methionine and links this to alanine to form 15. The Dieckmann release domain (DKC, see the SI for predicted catalytic domains)19 of PhyS

The revised structure of phyllostictine A (5) shows that it is closely related to the known compound phaeosphaeride A (6), which has potent activity in the STAT3 pathway and shows some anticancer activities.15 Phyllostictine A (5) is a hexaketide, whereas phaeosphaeride A (6) is a pentaketide. The minor product phyllostictine B differs from 5 in being shorter by two methylenes. In our hands NMR data for phyllostictine B exactly matches that of phaeosphaeride A (6), and we thus conclude that these compounds are identical. Their specific rotations ([α]D = −99.8 and −93.6, respectively) are also very similar, and thus the absolute configurations must also be identical.16,17 Since 5 and 6 are the products of the same pathway, differing only in the chain length of the polyketide, we assume that the absolute configuration of 5 matches that of 6. We were unable to purify enough of phyllostictines C and D for full structural characterization, but HRMS analysis suggests that they must be a hydroxylated congener of 5 and its carbonyl homologue, 1237



Communication

Scheme 2. Proposed Biosynthesis of the Phyllostictines 5 and 6, (para)Phaeosphaerides 9−11, and Likely Structures of Phyllostictines C (13) and D (14)

gene clusters (Scheme 2). Phyllostictine A (6) is also structurally similar to pyronigrin E (7), for which the biosynthetic gene cluster and biosynthetic details are known.6 However, genes from the phy BGC show much lower homology to the pyronigrin E BGC than they do to the Madurella mycetomatis BGC. Chemical differences are also evident. For example 7 is derived from serine instead of alanine, and Dieckmann cyclization is catalyzed by a trans-acting hydrolase in the case of 7, which does not appear to be encoded in the phy cluster. Other differences include the fact that the exomethylene of 7 is introduced hydrolytically, whereas for 6 it is probably introduced oxidatively. Thus, it appears that despite their chemical similarities 6 and 7 have probably arisen by parallel evolution. Our results thus correct the structures of phyllostictines to the more commonly found tetramic acid class of fungal metabolites,21 which include the closely related phaeosphaeride A (6) and paraphaeosphaerides A−C (9−11). Furthermore, analysis of the ITS sequence of the producing organism suggests it is more closely related to species of Phaeosphaeria

then catalyzes cyclization and release to form a 3-methyl tetramic acid, 16. Oxidation at the 17-methyl and elimination then forms the 3-methylene tetramic acid 17 and is possibly catalyzed by the phyL8 encoded nonheme iron-dependent oxygenase. Formation of the tetrahydropyran 19 could involve epoxidation (possibly PhyL9) and then ring closure via 18. Alternatively, Michael addition followed by later hydroxylation at C-7 would lead to 19 via 20. The carbonyl at C-6 is reduced to give the known compounds 11 and 12, possibly by the NAD(P)H-dependent long-chain keto-reductase PhyL5. Our knockout results show that the last steps of biosynthesis are the N-hydroxylation and final O-methylation catalyzed by the phyL6 and phyL7 encoded proteins (P450 and SAM-dependent, respectively) to form 5 and 6. Genes involved in pyridone N-oxidation, for example in the cases of tenellin and desmethylbassianin,20 have been previously reported, but this is the first report of a gene involved in N-hydroxylation of a tetramic acid. The very close structural similarity between the phyllostictines and the (para)phaeosphaerides suggests that their producing organisms should contain highly homologous 1238



Communication

gene prediction.25,26 The whole genome sequence of P. cirsii was submitted to the Antibiotics and Secondary Metabolite Analysis Shell (antiSMASH)11 for the prediction of putative gene clusters. In total 32 gene clusters were described (Table S6.2), of which 14 clusters contain a type I polyketide synthase. Fungal Transformation and Knockout Protocol. A KO cassette consisting of two flanking regions of the target gene (TR and TL) + the hygromycin B resistance cassette was cloned into the pE-YA vector exploiting yeast recombination (strain CEN PK2). The KO cassette was split by PCR into two overlapping fragments (α and β) designed to break the resistance functionality. Fragments α and β were transformed simultaneously into protoplasts, and through homologous recombination the cassette was regenerated at the target gene. Conidia from sporulating plates were inoculated into 50 mL of GNB medium and incubated for 4−5 days at 28 °C in static conditions to avoid clumping. Germinated conidia were collected by filtration on Myracloth. A 10 mL amount of 10 mg/mL filter-sterilized Trichoderma lysing enzyme (TLE) was used to resuspend the cellular pellet. TLE was dissolved in 0.7 M NaCl. The tube was incubated at 30 °C with gentle mixing for 2−3 h. The protoplasts were released from hyphal strands by gentle pipetting with a wide-bore pipet and filtered by Miracloth. The filtrate was centrifugated at 3000g for 5 min to pellet the protoplasts. The cells were resuspended in 100 μL of solution I (0.7 M NaCl; 10 mM CaCl2; 50 mM Tris-HCl, pH 7.5). The concentration of the protoplast was assessed microspically (Bürker-Türk chamber). A total of 10 μg of α and β fragments was added to the solution and incubated on ice for 2 min. A 1 mL amount of solution II (60% (w/v) PEG 3350; 0.7 M NaCl; 10 mM Tris-HCl, pH 7.5) was added in the transformation mixture and incubated at room temperature for 20 min. A 5 mL amount of lukewarm molten CDZ/0.9S top medium (3.5% Czapek Dox broth; 0.9 M sorbitol; 0.05% adenine; 0.15% methionine; 0.1% (NH4)2SO4; 0.8% agar) was added to the transformation mixture and placed into a Petri dish after mixing. Plates were incubated overnight at 28 °C to let the protoplasts grow back the cell wall. The next day 10 mL of CD agar with 50 μg/mL hygromycin B was spread onto the plates in order to select the transformants. Single colonies were picked onto secondary plates with 50 μg/mL hygromycin B and analyzed under a UV-light microscope to detect fluorescence. The positive colonies were grown in liquid with no antibiotics. Fermentation and Extraction. P. cirsii was grown in static M1D medium (vide inf ra) for 14−20 days at 28 °C. During the fermentation the fungus was kept in the dark, although it is not a required condition to activate secondary metabolism. The fermentation was homogenized, and the cellular debris removed by paper filtration under vacuum. The supernatant was extracted twice with 1.5 volumes of ethyl acetate. The organic extract was dried (MgSO4) and evaporated in vacuo. The crude extract was either stored at −20 °C or dissolved in acetonitrile (10 mg·ml−1) for LCMS analysis and purification. M1D: Ca(NO3)2 1.2 mM; KNO3 0.79 mM; KCl 0.87 mM; MgSO4 3 mM; NaH2PO4 0.14 mM; sucrose 87.6 mM; ammonium tartrate 27.1 mM; FeCl3 7.4 μM; MnSO4 30 μM; ZnSO4 8.7 μM; H3BO3 22 μM; KI 4.5 μM; pH 5.5. Purification of compounds was generally achieved using a Waters mass-directed autopurification system comprising a Waters 2767 autosampler, a Waters 2545 pump system, and a Phenomenex Kinetex Axia column (5 μm, C18, 100 Å, 21.2 × 250 mm) equipped with a Phenomenex Security Guard precolumn (Luna C5 300 Å) eluted at 20 mL/min at ambient temperature. Solvent A is HPLC grade H2O + 0.05% formic acid; solvent B is HPLC grade CH3CN + 0.045% formic acid. The postcolumn flow was split (100:1), and the minority flow was made up with HPLC grade MeOH + 0.045% formic acid to 1 mL· min−1 for simultaneous analysis by diode array (Waters 2998), evaporative light scattering (Waters 2424), and ESI mass spectrometry in positive and negative modes (Waters SQD-2). Detected peaks were collected into glass test tubes. Combined tubes were evaporated under a flow of dry N2 gas and weighed, and residues dissolved directly in NMR solvent for NMR analysis.

and Parasphaeospharia, which also synthesize 6 and 9−11, and the organism should perhaps be renamed as Phaeosphaeria cirsii. Since this class of compounds possesses interesting and useful bioactivities, the discovery and manipulation of the biosynthetic gene cluster opens up the possibility of metabolic engineering to produce new and related compounds in either the producing organism itself or related fungi. Our results presented here show that new family members such as phyllostictine E (12) can be generated in this way. The revised structure should also allow more effective synthetic strategies to be devised for the construction of this class of compounds. Finally, analysis of the phy BGC has indicated that a highly similar BGC exists in the human pathogenic fungus Madurella mycetomatis (see the SI).22 Since phyllostictine A (6) itself and the analogous phaeosphaerides show distinct activities against human cell lines, it is an intriguing possibility that similar compounds biosynthesised by M. mycetomatis may be involved in human pathogenicity.

■

EXPERIMENTAL SECTION

General Experimental Procedures. The 1H NMR analysis was performed using Bruker DPX 200, Avance 400, DPX 400, and DRX 500 spectrometers. Resonances were assigned using two-dimensional NMR 1H,1H−COSY, 1H,13C-HSQC, and 1H,13C-HMBC experiments. Deuterated DMSO (ref 2.50 ppm/39.5 ppm) or CDCl3 (ref 7.26 ppm/77.4 ppm) were used as solvents and reference. The 13C NMR analysis was performed using Bruker Avance 400, DPX 400, and DRX 500 spectrometers. NMR data were processed using Topspin and MestReNova software packages. LC-MS data were obtained using a Waters LCMS system comprising a Waters 2767 autosampler, a Waters 2545 pump system, and a Phenomenex Kinetex column (2.6 μm, C18, 100 Å, 4.6 × 100 mm) equipped with a Phenomenex Security Guard precolumn (Luna C5 300 Å) eluted at 1 mL·min−1. Detection was by a Waters 2998 diode array detector between 200 and 600 nm and Waters 2424 evaporative light-scattering detector (ELSD) and Waters SQD-2 mass detector operating simultaneously in ES+ and ES− modes between m/ z 100 and 650. Solvents were (A) high-performance liquid chromatography (HPLC) grade H2O containing 0.05% formic acid; (B) HPLC grade MeOH containing 0.045% formic acid; and (C) HPLC grade CH3CN containing 0.045% formic acid. Gradients were as follows. Method 1: Kinetex/CH3CN: 0 min, 10% C; 10 min, 90% C; 12 min, 90% C; 13 min, 10% C; 15 min, 10% C. Strain Origin and Identification. P. cirsii was obtained as a gift from Dr. Maurizio Vurro (Istituto di Scienze delle Produzioni Alimentari, CNR, Bari, Italy).1 The internal transcribed spacer 5.8S (ITS 5.8S) was amplified from genomic DNA of Phyllosticta cirsii using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers. The PCR products were sequenced by the Sanger method by the Thermofin service facility. The P. cirsii ITS sequence was used to search the NCBI database (BLAST). Clustal Omega with default settings was used to align P. cirsii ITS within a collection of 20 ITS sequences from different organisms (including Phyllosticta spp., Phoma spp., Phaeosphaeria spp., and Leptosphaeria spp.) and also the distantly related Aspergillus oryzae and Saccaromyces cerevisiae as outliers. Results are presented in the SI. Genome Sequence and Cluster Assignment. To obtain the genomic DNA, cells were grown in 200 mL of potato dextrose broth (PDB) medium for 5 days. The liquid medium was removed, and mycelia were freeze-dried to remove all the water. Liquid nitrogen was used to grind the freeze-dried cells with a mortar and pestel. gDNA purification was performed using the GenElute plant genomic DNA miniprep kit (G2N350) from Sigma-Aldrich. Genomic DNA was sequenced on the MiSeq system (Illumina) in a paired-end sequencing run. Raw data were processed by an in-house software platform.23 After assembly of all sequence reads by applying the GS/De Novo/ Assembler version 2.8 software with default settings, the draft genome consisted of 303 scaffolds. The annotation of the draft genome was made within the GenDBE platform24 including AUGUSTUS 3.0.3 for 1239



Communication

Phyllostictine A (5): UV (diode array HPLC, H2O/CH3CN) λmax 262.6 nm; LCMS m/z 326.3 [M + H]+ (100), 348.3 [M + Na]+ (28), 308.3 [M + H − H2O]+ (34), 324.1 [M − H]− (7); HRESIMS m/z 326.1967 [M + H]+ (calcd for C17H28NO5+, 326.1967); 1H and 13C NMR see Table 1. Phyllostictine B (6): UV (diode array HPLC, H2O/CH3CN) λmax 262.6 nm; LCMS m/z 298.3 [M + H]+ (3), 320.2 [M + Na]+ (100), 280.2 [M + H − H2O]+ (30); HRESIMS m/z 298.1654 [M + H]+ (calcd for C15H24NO5+, 298.1811); 1H and 13C NMR see Table 1. Phyllostictine E (12): UV (diode array HPLC, H2O/CH3CN) λmax 259.6 nm; LCMS m/z 296.3 [M + H]+ (100), 318.3 [M + Na]+ (30), 278.3 [M + H − H2O]+ (42), 294.2 [M − H]− (100); HRESIMS m/z 296.1862 [M + H]+ (calcd for C16H26NO4+, 296.1862); 1H and 13C NMR see Table S4.4. The sequence of the phy cluster has been uploaded to GenBank with the accession number KY682688.

■

(8) Li, C.-S.; Ding, Y.; Yang, B.-J.; Miklossy, G.; Yin, H.-Q.; Walker, L. A.; Turkson, J.; Cao, S. Org. Lett. 2015, 17, 3556−3559. (9) Song, Z.; Cox, R. J.; Lazarus, C. M.; Simpson, T. J. ChemBioChem 2004, 5, 1196−1203. (10) Eley, K. L.; Halo, L. M.; Song, Z.; Powles, H.; Cox, R. J.; Bailey, A. M.; Lazarus, C. M.; Simpson, T. J. ChemBioChem 2007, 8, 289− 297. (11) Blin, K.; Medema, M. H.; Kazempour, D.; Fischbach, M. A.; Breitling, R.; Takano, E.; Weber, T. Nucleic Acids Res. 2013, 41, W204−W212. (12) Punt, P. J.; Oliver, R. P.; Dingemanse, M. A.; Pouwels, P. H.; van den Hondel, C. A. M. J. J. Gene 1987, 56, 117−124. (13) Redkar, R. J.; Herzog, R. W.; Singh, N. K. Appl. Environ. Microb. 1998, 64, 2229−2231. (14) Nielsen, M.; Albertsen, L.; Lettier, G.; Nielsen, J.; Mortensen, U. Fungal Genet. Biol. 2006, 43, 54−64. (15) Abzianidze, V. V.; Prokofieva, D. S.; Chisty, L. A.; Bolshakova, K. P.; Berestetskiy, A. O.; Panikorovskii, T. L.; Bogachenkov, A. S.; Holder, A. A. Bioorg. Med. Chem. Lett. 2015, 25, 5566−5569. (16) Kobayashi, K.; Kobayashi, Y.; Nakamura, M.; Tamura, O.; Kogen, H. J. Org. Chem. 2015, 80, 1243−1248. (17) Abzianidze, V. V.; Poluektova, E. V.; Bolshakova, K. P.; Panikorovskii, T. L.; Bogachenkov, A. S.; Berestetskiy, A. O. Acta Crystallogr. 2015, 71, 1−13. (18) Heneghan, M. N.; Yakasai, A. A.; Williams, K.; Kadir, K. A.; Wasil, Z.; Bakeer, W.; Fisch, K. M.; Bailey, A. M.; Simpson, T. J.; Cox, R. J.; Lazarus, C. M. Chem. Sci. 2010, 2, 972−972. (19) Liu, X.; Walsh, C. T. Biochemistry 2009, 48, 8746−8757. (20) Halo, L. M.; Heneghan, M. N.; Yakasai, A. A.; Song, Z.; Williams, K.; Bailey, A. M.; Cox, R. J.; Lazarus, C. M.; Simpson, T. J. J. Am. Chem. Soc. 2008, 130, 17988−17996. (21) Fisch, K. M. RSC Adv. 2013, 3, 18228−18247. (22) van Belkum, A.; Fahal, A.; van de Sande, W. W. Adv. Exp. Med. Biol. 2013, 764, 179−189. (23) Wibberg, D.; Andersson, L.; Tzelepis, G.; Rupp, O.; Blom, J.; Jelonek, L.; Pühler, A.; Fogelqvist, J.; Varrelmann, M.; Schlüter, A.; Dixelius, C. BMC Genomics 2016, 17, 245. (24) Rupp, O.; Becker, J.; Brinkrolf, K.; Timmermann, C.; Borth, N.; Pühler, A.; Noll, T.; Goesmann, A. PLoS One 2014, 9, 1−e85568. (25) Stanke, M.; Waack, S. Bioinformatics 2003, 19, ii215−25. (26) Stanke, M.; Schöffmann, O.; Mogenstern, B.; Waack, S. BMC Bioinf. 2006, 9, 62.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jnatprod.7b00183. All experimental and characterization details, NMR spectra of 5, 6, and 12, NMR spectra of 5 from labeling experiments, and bioinformatic information (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. ORCID

Russell J. Cox: 0000-0002-1844-0157 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS F.T. thanks the HSBDR doctoral training center for funding. R.J.C. thanks DFG for funding LCMS equipment. We thank Dr. M. Vurro (Istituto di Scienze delle Produzioni Alimentari, CNR, Bari, Italy) for the gift of P. cirsii. Sequencing and data assembly were performed by CeBiTeC at the University of Bielefeld, and Prof. J. Kalinowski and Dr. D. Wibberg are thanked for the sequencing and data assembly work. Dr. J. Fohrer is thanked for assistance with NMR spectroscopy. Dr. K. Williams is thanked for helpful discussions.

■

REFERENCES

(1) Evidente, A.; Cimmino, A.; Andolfi, A.; Vurro, M.; Zonno, M. C.; Cantrell, C. L.; Motta, A. Tetrahedron 2008, 64, 1612−1619. (2) Le Calvé, B.; Lallemand, B.; Perrone, C.; Lenglet, G.; Depauw, S.; Van Goietsenoven, G.; Bury, M.; Vurro, M.; Herphelin, F.; Andolfi, A.; Zonno, M. C.; Mathieu, V.; Dufrasne, F.; Van Antwerpen, P.; Poumay, Y.; David-Cordonnier, M.-H.; Evidente, A.; Kiss, R. Toxicol. Appl. Pharmacol. 2011, 254, 8−17. (3) Coe, S.; Pereira, N.; Geden, J. V.; Clarkson, G. J.; Fox, D. J.; Napier, R. M.; Neve, P.; Shipman, M. Org. Biomol. Chem. 2015, 13, 7655−7663. (4) Zonno, M. C.; Vurro, M.; Lucretti, S.; Andolfi, A.; Perrone, C.; Evidente, A. Plant Sci. 2008, 175, 818−825. (5) Maloney, K. N.; Hao, W.; Xu, J.; Gibbons, J.; Hucul, J.; Roll, D.; Brady, S. F.; Schroeder, F. C.; Clardy, J. Org. Lett. 2006, 8, 4067−4070. (6) Yamamoto, T.; Tsunematsu, Y.; Noguchi, H.; Hotta, K.; Watanabe, K. Org. Lett. 2015, 17, 4992−4995. Awakawa, T.; Yang, X.-L.; Wakimoto, T.; Abe, I. ChemBioChem 2013, 14, 2095−2099. (7) Sandmeier, P.; Tamm, C. Helv. Chim. Acta 1989, 72, 774−783. 1240


Structural Revision and Biosynthesis of the Fungal Phytotoxins

Recommend Documents