Subunit-Specific Modulatory Functions Are Conserved in an

Chapter 5

Downloaded by UNIV OF FLORIDA on December 20, 2017 | http://pubs.acs.org Publication Date (Web): October 24, 2017 | doi: 10.1021/bk-2017-1265.ch005

Subunit-Specific Modulatory Functions Are Conserved in an Interspecies Insect GABAB Receptor Heteromer S. Blankenburg,1 S. Balfanz,2 A. Baumann,2 and W. Blenau*,3 1Animal Physiology, Institute of Biology, Martin Luther University Halle-Wittenberg, Halle (Saale), D-06120, Germany 2Institute of Complex Systems – Cellular Biophysics (ICS-4), Forschungszentrum Jülich, Jülich, D-52425, Germany 3Poststraße 3A, Hohen Neuendorf, D-16540, Germany *E-mail: [email protected]. Phone: +49-3303-405 404.

GABAB receptors are seven-transmembrane G-protein-coupled receptors (GPCRs) for γ-aminobutyric acid (GABA), the most abundant inhibitory neurotransmitter in the central nervous system. They couple to a variety of signalling pathways and thereby serve diverse functions. In humans, GABAB receptors are implicated in a number of psychiatriac and neurological diseases. GABAB receptors function as obligate heteromers consisting of the two subunits, GB1 and GB2, whereby GB1 binds the ligand and GB2 is coupled to the G protein. This unique functional principle is phylogenetically conserved and can be found in both deuterostomes and protostomes. Nevertheless, remarkable differences in the pharmacological properties do exist between species. In this study, we aimed to investigate the functionality and the pharmacological profile of an interspecies GABAB receptor heteromer, consisting of the GB1 subunit from the American cockroach Periplaneta americana and the GB2 subunit of the fruit fly Drosophila melanogaster. Co-expression of both proteins in a heterologous expression system indeed lead to the formation of functional receptor heteromers. Activation of interspecies heterodimers

© 2017 American Chemical Society Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.

caused a dose-dependent decrease in the production of cAMP. Moreover, we demonstrate that GB2 modulates not only the potency but also the efficacy of ligand binding.


Introduction In both deuterostomes and protostomes, γ-aminobutyric acid (GABA) is the predominant inhibitory neurotransmitter in the central nervous system (CNS). Once released from the presynaptic terminal, GABA causes signals either by stimulating fast-acting ligand-gated ion channels (ionotropic GABAA receptors) or more slowly acting G-protein-coupled receptors (metabotropic GABAB receptors) (1). Ionotropic GABAA receptors belong to the Cys-loop ion channel superfamily (2) and serve as GABA-gated Cl--channels. In mammals, these channels are targets of important drugs with sedative and CNS-depressant activity. In arthropods, GABAA receptors containing subunits encoded by the Resistance to dieldrin gene or Rdl are the targets of an expanding number and variety of acaricides and insecticides, including cyclodienes, phenylpyrazoles, avermectins, and isoxazolines (3–6). It has been experimentally proven that GABAA receptor subunits and their splice variants differ in developmental expression and in their cellular and subcellular distribution (7–10). GABAB receptors are class C (or family 3) G-protein-coupled receptors (GPCRs). This group also includes metabotropic glutamate receptors, Ca2+-sensing receptors, sweet and umami taste receptors (1, 11). Within the GPCR superfamily, class C GPCRs stand out with their large N-terminal Venus flytrap domain (VFTD). To form a functional receptor, two structurally related GABAB receptor subunits, GB1 and GB2, have to form obligate heterodimers (12–14). It is experimentally well established that the VFTD of GB1 contains the agonist binding site, whereas GB2 provides coupling to a G protein and allosterically increases agonist affinity at GB1 (14, 15). Both subunits interact with each other via the extracellularly exposed N-terminal domains (16), the transmembrane domains (17, 18), and coiled-coil domains in the intracellularly located C terminus (13, 19). Heterodimers may dynamically self-assemble into tetramers (dimers of heterodimers) or even larger complexes, and associate with a range of trafficking, effector, and regulatory proteins (1, 20–22). Thus, the molecular complexity of GABAB receptors can be increased on different routes making GABAB receptors highly dynamic structures. Activated GB1/GB2 heteromers inhibit adenylyl cyclase activity via Gαi-subunits of heterotrimeric G proteins. This leads to reduced levels of intracellular cAMP ([cAMP]i). In addition to Gαi-dependent signalling, Gβγ-subunits may mediate inhibition of N-, P- or Q-type Ca2+ channels (23, 24) or activation of K+ channels, mainly inward rectifying Kir3 channels, upon GABAB receptor activation (13). Especially the ability of GABAB receptors to inhibit Ca2+ channels has a tremendous impact in controlling neurotransmitter release. In mammals, GABAB receptors play an important role in the etiology of diverse neurological disorders, including hyperalgesia, autism, and schizophrenia (25–28). In contrast to the situation in mammals, the current state of knowledge on arthropod GABAB receptors is still rather low. However, various modulatory effects of GABAergic 86 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.


interneurons on, e.g., olfactory perception (29), learning and memory (30), sleep (31), aggression (32), and feeding (33) have been reported in the the genetic model organism Drosophila melanogaster. Three GABAB receptor subunits (DmGB1, DmGB2 and DmGB3) have been molecularly characterized from this insect (34). Physiologically, D. melanogaster GABAB receptors are necessary for normal development (35), the regulation of carbohydrate and lipid metabolism (36), the modulation of olfactory processing (37, 38), the regulation of circadian activity (39) and sleep maintenance (40), and the behavior-impairing effects of ethanol (41). Interestingly, the distribution of the DmGB2 protein matches closely that of GABAA receptors (RDL immunoreactivity) in most areas of the fly brain (42). However, differences exist especially in the mushroom body lobes (42). In insects, the potential existence of GABAB receptors was initially documented in the American cockroach, Periplaneta americana, a very useful model in neurobiological, physiological, and toxicological studies (43, 44), after application of the GABAB receptor agonist 3-aminopropylphosphinic acid (3-APPA) to the abdominal ganglion (45). This treatment resulted in a hyperpolarization of the membrane potential and was resistant to picrotoxin, a specific GABAA receptor antagonist. Similarly, the GABAB receptor agonists 3-APPA and SKF 97541 induced hyperpolarization of the fast coxal depressor motor neuron (46). Further pharmacological experiments have shown that GABAB receptors are involved in saliva production and/or secretion in P. americana (47). The salivary duct nerve (SDN), which descends from the subesophageal ganglion, innervates the paired salivary glands. In addition to serotonergic fibers, the SDN contains two relatively thick axons, the dopaminergic salivary neuron (SN)1 and the GABAergic SN2 (47–50). When GABA is applied during electrical stimulation of the SDN, the electrical and secretory response of the exocrine cells is enhanced, whereas GABA has no apparent effect without simultaneous electrical stimulation. Because GABAB receptor agonists mimicked and GABAB receptor antagonists blocked these effects (47), GABA has been suggested to act presynaptically via GABAB receptors either on serotonergic and/or dopaminergic nerve fibers (47). Recently, we have unraveled the molecular structure and protein localization of two cockroach GABAB receptor subunits, PeaGB1 and PeaGB2 (51). Activation of heterologously expressed PeaGB1/PeaGB2 heteromers results in specific inhibition of adenylyl cyclase activity (51). PeaGB1-like immunoreactivity has been detected in GABAergic fibers innervating the salivary glands suggesting that GABAB receptors act as autoreceptors in SN2 of P. americana (51). In the present study, we aimed to investigate the potential influence of an orthologous GB2-subunit on the functional and pharmacological properties of P. americana GABAB receptors. Therefore, the pharmacological profile of an interspecies PeaGB1/DmGB2 heteromer was characterized. Activation of heterologously expressed PeaGB1/DmGB2 heteromers resulted in the inhibition of adenylyl cyclase activity. Receptor activation was also achieved by established GABAB receptor agonists. Specific GABAB receptor antagonists but not GABAA receptor antagonists were able to block efficiently GABA-evoked receptor activation. These data demonstrate that individual subunits of these obligate heteromeric membrane proteins can be substituted for orthologous and eventually 87 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.

even distantly related GABAB receptor subunits. Nevertheless, our data suggests that even small changes on the amino acid level can alter receptor properties.

Materials and Methods Animals


American cockroaches (Periplaneta americana) were reared under a 12 hours light-dark cycle at 24-26°C. Four to six weeks old adult male cockroaches were used.

Sources of Receptor-Encoding cDNA Clones In a previous study, we had cloned full-length cDNAs encoding cockroach PeaGB1 and PeaGB2 receptor subunits using a PCR-based strategy (51). The template for amplification reactions was cDNA synthesized from mRNA isolated from brain tissue (51). In the current study, we used a cDNA encoding the B2 subunit from Drosophila melanogaster (DmGB2) (34).

Construction of Expression Vectors For expression of PeaGB1 and PeaGB2 receptors in mammalian cells both cDNAs were modified with a Kozak consensus motif (CCACC) (52) immediately 5´ to the initiating ATG codon by PCR. A hemagglutinin A epitope tag (HA-tag) was added at the 3´-end of PeaGB2-encoding cDNA facilitating evaluation of transfection efficiency and receptor protein expression. The PeaGB1- and PeaGB2-encoding constructs (51) were cloned into pcDNATM6/myc-His A and pcDNA3.1(+) vectors (Life Technologies, Karlsruhe, Germany), respectively. A similar modification strategy has been applied to obtain an expression construct for DmGB2. A Kozak consensus motif was introduced in front of the initiating ATG codon of DmGB2 and a sequence motif coding for the HA-tag was fused to the 3’-end of the cDNA by PCR. The following primers (TIB Molbiol, Berlin, Germany) were used: 5´-CAGGATCCGCCACCATGTTCCGGCCAAG-3´ (sense); 5´GATCAGCGGCCGCCTAAGCGTAATCTGGAACATCGTATGGGTACAAGT ACTCGACGATATCGC-3´ (antisense). The nucleotide sequence coding for the HA-tag is underlined. The PCR product was digested with restriction enzymes BamHI/NotI and cloned into pcDNA3.1(+) vector (Life Technologies). All constructs were verified by DNA sequencing.

Generation of Cell Lines Expressing GABAB Receptor Subunits As in our previous study (51), human embryonic kidney (HEK) 293 cells expressing a variant of the A2-subunit of the olfactory cyclic nucleotide-gated 88 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.

(CNG) ion channel (flpTM cells) (53) were used for transfection. Approximately 7.5 µg of each receptor-encoding construct (PeaGB1 and DmGB2) were simultaneously introduced into ~4×105 cells in a 5 cm Petri dish by a modified calcium-phosphate method (54). Stably transfected cells were selected in the presence of the antibiotics blasticidin (10 µg/ml; PeaGB1) and G418 (1 mg/ml; DmGB2). Cell colonies were individually isolated and grown to higher density. Expression of receptor subunits was analyzed by immunocytochemistry and Western blotting with anti PeaGB1-specific (51) and anti-HA antibodies (Roche, Mannheim, Germany), respectively.


Functional and Pharmacological Characterization of GABAB Receptors The ability of PeaGB1/PeaGB2 (51) and PeaGB1/DmGB2 receptors to modulate intracellular cAMP concentrations ([cAMP]i) was monitored indirectly by the cAMP-dependent activation of the CNG channel in flpTM cells. The channel is opened by increasing [cAMP]i. This causes an influx of Ca2+ ions that can be detected with the Ca2+-sensitive fluorescent dye Fluo-4. Inhibition of adenylyl cyclase activity results in diminished Ca2+-dependent Fluo-4 signals that can be monitored and quantified. Briefly, approximately 7,500 cells were seeded per well in 96-well plates and grown for 24 h in medium containing DMEM GlutaMAX I (Life Technologies), 10% (v/v) fetal bovine serum, and antibiotics. The growth medium was discarded and cells were incubated for 1 h in extracellular solution (ES; in mM: 120 NaCl, 5 KCl, 2 CaCl2, 2 MgCl2, 10 glucose, 10 HEPES, pH 7.4) with 3 mM probenecid, 2 µM Fluo-4 AM (Life Technologies), and 0.02% (w/v) Pluronic®F127. Afterwards, the loading solution was exchanged for ES. The fluorescence reader FluoStar Omega (BMG Labtech, Ortenberg, Germany) was used for measurements. Fluo-4 was excited at 485 nm, and the emitted light was measured at 520 nm. After the basal fluorescence in each well had reached a stable value, test solutions containing 100 μM 3-isobutyl-1-methylxanthine (IBMX), 10 μM NKH 477 (activator of membrane-bound adenylyl cyclases), and various concentrations of ligands in ES were added. The agonists GABA, 3-aminopropylphosphinic acid (3-APPA), SKF 97541, and baclofen were tested in concentrations ranging from 10-9 to 10-4 M. Potential antagonists were measured in the presence of a constant concentration of 1 µM GABA. The antagonists CGP 52432, CGP 54626, CGP 55845, bicuculline, and picrotoxin (mixture of picrotoxinin and picrotin) were tested in a concentration range from 10-9 to 10-4 M. Measurements were performed in octuplicate with two to three independent biological replicates. The Fluo-4 fluorescence was recorded automatically. Measurements were edited with MARS Data Analysis Software (BMG Labtech). The relative change in fluorescence was normalized to values obtained with test solution containing no ligand (NKH 477 = 100%). For antagonists, a starting value of 25% was taken from the concentration response curve obtained with GABA (1 µM) and scaled to 100% as the value obtained with 10 µM NKH 477 without adding GABA. Data were analyzed using Prism 5.04 software (GraphPad, San Diego, CA, USA) and displayed using CorelDRAW X6. 89 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.


Western Blot and Immunodetection Membrane proteins of non-transfected and PeaGB1/DmGB2-transfected flpTM cells were extracted and de-glycosylated with PNGase F (New England Biolabs, Frankfurt, Germany). Western Blotting was performed as described in our previous work (51). Membrane proteins (7.5 µg) were separated by SDS-polyacrylamide (14%) gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Roth, Karlsruhe, Germany). After blocking for 30 min at room temperature with 5% (w/v) dry milk in Tris-buffered saline with Tween 20 (TBS-T; 10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.01% (w/v) Tween 20), membranes were incubated with rat-anti-HA (Roche, Mannheim, Germany; dilution 1:5,000 in TBS-T) at 4°C overnight. Membranes were washed three times for 5 min with TBS-T, followed by 3 min with urea solution (2 M urea, 0.1 M glycine and 1% (v/v) Triton X-100) and a final 5 min wash with TBS-T. Incubation with horseradish peroxidase-conjugated secondary antibody (goat-anti-rat-HRP; Jackson Immuno Research Laboratories, West Grove, PA, USA; 1:10,000 dilution in TBS-T) was performed for one hour at room temperature. After three further washing steps with TBS-T, an enhanced chemiluminescence detection system (Super Signal West Pico Chemiluminescent Substrate; Thermo Scientific, Bonn, Germany) was applied to visualize protein bands.

Immunocytochemistry The protein expression of the PeaGB1/DmGB2-transfected flpTM cell line was investigated by immunocytochemistry. Cells, which were seeded on cover slips in a 24-well plate, were washed with PBS twice and fixed for 15 min in 4% (w/ v) paraformaldehyde. After three additional washing steps with PBS for 10 min, cells were incubated 30 min in blocking solution (10% (w/v) normal goat serum, 0.125% (w/v) Triton-X-100 in PBS). The primary antibodies rabbit-anti-PeaGB1 and rat-anti-HA were applied at a dilution of 1:1000 and 1:100, respectively. Cells were washed after one hour with PBS (3×10 min) and incubated 1 h with goatanti-rabbit-Alexa488 (1:50; Thermo Fisher Scientific, Waltham, MA, USA) and goat-anti-rat-Cy3 (1:200; Jackson Immuno Research Laboratories, West Grove, PA, USA). After three final washing steps with PBS for 15 min each, the cover slips were embedded on object slides with Mowiol (33.3% (v/v) glycerol, 16.7% (v/v) Mowiol 4-88, 2% (v/v) n-propyl-galate in PBS). Fluorescence images were acquired with Zeiss LSM 510 confocal microscopes (Carl Zeiss, Jena, Germany).

Results In contrast to other GPCRs, like biogenic amine receptors, metabotropic GABA receptors are only functional as heterodimers. In a previous study, we have shown that the subunits PeaGB1 and PeaGB2 from Periplaneta americana are necessary and sufficient to constitute a metabotropic GABA receptor that 90 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.

inhibits cAMP production. The affinity of the heteromeric receptor was quite high, with an EC50 for GABA of about 85 nM (51). We were interested whether subunits could be exchanged for orthologues originating from another species and used a GB2 subunit from Drosophila melanogaster (DmGB2) to constitute an interspecies PeaGB1/DmGB2 receptor heteromer and to examine its functional and pharmacological properties.


Molecular Properties of GABAB Receptor Subunits GABAB receptor subunits clearly assemble in two clades containing either GB1 or GB2 subunits (55–57). At the level of primary sequence similarity, a further separation becomes evident when comparing sequences from chordates and ecdysozoans, i.e. receptor subunits form phylogenetically ordered sub-clades (51). A comparison of the amino acid sequences of DmGB2, PeaGB2, (mouse) MmGB2, and PeaGB1 is depicted in Figure 1. With 1220 and 1267 amino acid residues DmGB2 and PeaGB2, respectively, are much larger in size than MmGB2 (940 residues) and PeaGB1 (833 residues). Based on the alignment, we calculated the percentage of identical and conservatively substituted residues which is summarized in Table 1. With 64.6% similarity, DmGB2 and PeaGB2 receptors share the closest phylogentic relationship supporting our previous phylogenetic analysis (51). All proteins share the typical transmembrane topology of G-protein-coupled receptors with seven segments completely spanning the membrane. The predicted position of these segments is indicated in Figure 1. An alpha-helical coiled-coil domain which is a putative dimerization motif was uncovered using Paircoil (58) and is present both in DmGB2 (amino acid position 738-778) and in PeaGB2 (747-779). Residues for post-translational modifications including N-glycosylation or palmitoylation are also conserved. Seven residues in the N-terminus of PeaGB2 and four residues in the N-terminus of DmGB2 are likely candidates for adding sugar moieties. Interestingly, three of them (N80DTQ, N169WTR, and N370TSF in DmGB2) are conserved between both receptor subunits. Palmitoylation of cysteine resides in the C-terminal loop of the receptors have been described to result in forming a fourth intracellular loop prone to interact with the corresponding G protein. Using CSS Palm 4.0, such residues were detected in both DmGB2 (C1207, C1214) and PeaGB2 (C1254, C1261). Receptor sensitivity is frequently modulated by phosphorylation of residues located in the intracellular loops. Consensus motifs which can be phosphorylated by protein kinase C are present at a similar position in DmGB2 (T541WR) and PeaGB2 (T734WR). Additionally, three potential phosphorylation sites for protein kinase A can be found in the C-terminal loops of both receptors (DmGB2: R737RDS, R958RQS and R1022RTS; PeaGB2: R742RDS, R1016RRS, and R1040RTS) suggesting similar modes of post-translational modification of the receptor’s functional properties. Four cysteine residues known to be necessary for the correct GABAB receptor folding (59), have been identified in DmGB2 and in PeaGB2 (Figure 1) (51). 91 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.


92 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.




Figure 1. Amino acid sequence alignment of DmGB2 (accession no. AAK13421.1), orthologous receptors from Periplaneta americana (no. CDK37792.1) and Mus musculus (no. Q80T41.2), and P. americana GB1 (no. CDK37791.1). Identical residues are shown as white letters against black. Conservatively substituted residues are labeled by a grey background. Putative transmembrane domains are indicated by dark gray bars and the putative coiled coil domain by a light gray bar. The amino acid position of the last residue per row is given on the right. Consensus sites for post-translational modifications and conserved amino acid residues for DmGB2 are indicated: ▵ - N-glycosylation motif, ■ - phosphorylation site for protein kinase C, □ phosphorylation site for protein kinase A, ○ - C-palmitoylation site; ● - cysteine residue forming disulfide bridges.


Table 1. Amino Acid Identity/Similarity between GABA Receptor Subunits: PeaGB1, PeaGB2, DmGB2, and MmGB2 PeaGB1

PeaGB2

DmGB2

100%

PeaGB2

22.0% / 37.0%

100%

DmGB2

21.8% / 36.1%

50.9% / 64.6%

100%

MmGB2

29.2% / 47.8%

28.3% / 42.1%

27.4% / 41.5%

100%


PeaGB1

MmGB2

Figure 2. Western blot analysis of DmGB2 expression in a PeaGB1/DmGB2-transfected cell line and non-transfected cells. Membrane fractions were prepared by hypotonic lysis. Membrane proteins were treated either with (+) or without (-) PNGase F to test for receptor glycosylation. Per lane, 7.5 µg protein were separated by SDS-PAGE and blottetd to polyvinylidene difluoride (PVDF) membranes. Blots were probed with rat α-HA antibodies. The sizes of marker proteins in kDa are given on the left margin. 95 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.


PeaGB1/DmGB2 Is a Functional Metabotropic GABA Receptor A flpTM cell line co-expressing PeaGB1 and DmGB2 was established. In advance of characterizing the pharmacological properties of the receptor, expression of the DmGB2 subunit was proven by Western blotting and immunohistochemical staining. An HA-tag had been engineered to the C-terminus of DmGB2 to facilitate immunolabeling. Membrane fractions of the cell line expressing PeaGB1/DmGB2 heteromers and from non-transfected control cells were separated by SDS-PAGE and transferred onto PVDF membrane. Incubation with specific α-HA antibodies led to the detection of a ~140 kDa protein band in samples obtained from PeaGB1/DmGB2 expressing cells only (Figure 2). The size of the protein nicely corresponds to the calculated molecular mass of 138.0 kDa for DmGB2. In a sample treated with PNGase F to remove N-linked glycosylation, the size of the protein was slightly smaller indicating that DmGB2 in fact undergoes post-translational modification. In samples obtained from non-transfected cells, no protein was detected.

Figure 3. Immunohistochemical localization of PeaGB1 and DmGB2 in PeaGB1/DmGB2-expressing cells using differential interference contrast (I) and laser confocal microscopy (II). PeaGB1/DmGB2-transfected (A, C) and non-transfected cells (B) were incubated with anti-PeaGB1 antibodies. PeaGB1 immunoreactivity was detected in the cytoplasm and at the plasma membrane (displayed by arrows). No staining was detected in non-transfected cells. (D) The antibody directed against the HA-tag of DmGB2 predominantly labeled the plasma membrane (arrow). Size bars in (A, B) represent 50 µm, size bars in (C, D) represent 10 µm. 96 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.


After having shown the presence and correct size of DmGB2 in the cell line, immunocytochemical staining was performed to examine the distribution of DmGB2 and PeaGB1 in the cell line as well as in non-transfected control cells. A previously established antibody (51) was used to locate PeaGB1 whereas rat α-HA antibodies were applied to detect the HA-tagged DmGB2 receptor. While no immunosignals were observed in control cells, specific signals were registered with both antibodies in the PeaGB1/DmGB2 receptor-expressing cell line (Figure 3). Receptor proteins were detected both in the plasma membrane and in subcellular compartments, most likely representing the endoplasmic reticulum and/or the Golgi apparatus. The functionality and pharmacology of the PeaGB1/DmGB2 receptor heteromer was investigated indirectly by monitoring changes in CNG channel activity with the Ca2+-sensitive dye Fluo-4. GABAB receptors are known to suppress the activity of adenylyl cyclases. This in turn leads to a closure of cAMP-dependent Ca2+-permeable CNG channels co-expressed in the cell line (see: Materials and Methods). On a background of the adenylyl cyclase activator NKH 477 (10 µM), different GABA concentrations were tested. In PeaGB1/DmGB2-expressing cells, increasing GABA concentrations led to a reduction of the Fluo-4 fluorescence up to 75% (Figure 4A). Similar results were obtained for the cell line constitutively expressing PeaGB1/PeaGB2 receptors (Figure 4B) (51). In contrast, GABA application did not cause effects in non-transfected cells (Figure 4A). The half maximal effective concentration (EC50) for GABA on the interspecies PeaGB1/DmGB2 receptor heteromer was 18 nM (logEC50 = -7.75±0.1, mean±SD) as compared to 85 nM (logEC50 = -7.10±0.05, mean±SD) on the PeaGB1/PeaGB2 heteromer. Known GABAB receptor agonists and antagonists (Figure 5) were used to examine the pharmacological profile of the PeaGB1/DmGB2 receptor. The agonists 3-APPA, SKF 97541, and baclofen led to a dose-dependent reduction of the Fluo-4 fluorescence (Figure 4C). The EC50 values for 3-APPA and SKF 97541 were 0.102 µM (log EC50 = -6.99±0.13) and 0.121 µM (logEC50 = -6.92±0.14), respectively. Because of a non-sigmoidal concentration-response curve, an EC50 value could not be determined for baclofen (Figure 4C). The antagonists were investigated in the presence of 10 µM NKH 477 and 1 µM GABA on PeaGB1/DmGB2-expressing cells. Three compounds, CGP 55845, CGP 54626, and CGP 52432 led to a dose-dependent increase of the Fluo-4 fluorescence (Figure 4D). The IC50 values calculated from the concentration response curves for CGP 55845, CGP 54626, and CGP 52432 are 0.97 µM (logIC50 = -6.02±0.14), 1.06 µM (logIC50 = -5.97±0.09), and 14.3 µM (logIC50 = -4.85±0.15), respectively. In contrast to these compounds, the well-established GABAA receptor antagonists picrotoxin and bicuculline did not elicit any change in fluorescence (data not shown).



Figure 4. Pharmacological characterization of PeaGB1/DmGB2 receptors. (A) Concentration response curve obtained with GABA on PeaGB1/DmGB2-expressing (filled circles) and non-transfected cells (diamonds). Ligands were measured in the presence of 10 µM NKH 477. (B) Concentration response curve obtained with GABA on PeaGB1/DmGB2-expressing (black circles) and PeaGB1/PeaGB2-expressing cells (gray circles). Ligands were measured in the presence of 10 µM NKH 477. (C) Concentration response curves on PeaGB1/DmGB2-expressing cells using the agonists 3-APPA (open squares; broken line), SKF 97541 (open diamonds), and baclofen (gray circles). For comparison, the concentration response curve obtained for GABA is taken from (A, B). Agonists were measured in the presence of 10 µM NKH 477. (D) Concentration response curves on PeaGB1/DmGB2-expressing cells using the antagonists CGP 55845 (diamonds, broken line), CGP 54626 (open squares), and CGP 52432 (gray circles). The antagonists were measured in the presence of 10 µM NKH 477 and 1 µM GABA. Measurements were performed in octuplicate with two to three biological replicates.



Figure 5. Structures of high-affinity GABAB receptor agonists (upper row) and antagonists (lower row).

Discussion In insects, as in mammals, GABAergic neurotransmission is mediated by both ionotropic GABAA receptors and metabotropic GABAB receptors. Due to its importance as insecticide targets, GABAA receptors have been pharmacologically well characterized in a large number of insect species (10). In contrast, insect GABAB receptors have been studied in detail only in the genetic model organism D. melanogaster (34), and more recently in the American cockroach P. americana (51). A truncated cDNA encoding only a partial GB1-subunit of a GABAB receptor has been cloned from the tobacco budworm Heliothis virescens (60). The aim of the current study was to examine whether a GB2-subunit from D. melanogaster could functionally substitute for the P. americana GB2-subunit in a heteromeric GABAB receptor formed by PeaGB1 and DmGB2. Pharmacological Properties of the Interspecies PeaGB1/DmGB2 Receptor Heteromer In order to assess putative effects of GABAB receptor subunit 2 on ligand potency and efficacy, we examined the pharmacological profile of the interspecies PeaGB1/DmGB2 receptor heteromer in a cell line constitutively co-expressing 99 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.


the receptor subunits. Application of the natural ligand GABA resulted in a sigmoidal concentration-response curve saturating at GABA concentrations ≥10-6 M. Functionally, receptor activation caused a decrease in [cAMP]i, a cognate property of GABAB receptors. Therefore, the DmGB2 subunit can adequately replace the PeaGB2 subunit. The comparison of the EC50 values for GABA on PeaGB1/DmGB2 and PeaGB1/PeaGB2 expressing cells revealed a fourfold higher potency of the ligand at the PeaGB1/DmGB2 heteromer (18 nM vs. 85 nM; see: Table 2). Notably, the EC50 values for PeaGB1/DmGB2 and PeaGB1/PeaGB2 are much lower than the values determined for human GABAB receptors (2.8 µM; see Table 2) and for DmGB1/DmGB2 receptors (∼ =20 µM; Mezler et al., 2001). Whether this discrepancy results from the fact that the pharmacological profile of DmGB1/DmGB2 receptors has been derived from electrophysiological recordings (34) rather than, like in the present study, by a cell-based assay directly examining the dynamics of the affected second messenger, remains an open question. Alternatively, the GB1 subunit from D. melanogaster might possess a significantly lower ligand affinity compared to other orthologous subunits. Nevertheless, the DmGB2 subunit is ideally suited in transferring its modulatory and functional coupling properties to an interspecies receptor heteromer built from distantly related insect species. Similar findings have been made in a previous study examining interspecies combinations of GABAB receptor subunits (61). In addition to the potency, the efficacy of PeaGB1/DmGB2 receptors to inhibit adenylyl cyclase activity in the cell line was also higher than in PeaGB1/PeaGB2 expressing cells. Intracellular cAMP was reduced to 25% of the control value in PeaGB1/DmGB2- but only to 40% in PeaGB1/PeaGB2-expressing cells (see: Figure 4B). Similar to GABA, the synthetic GABAB receptor agonists 3-APPA and SKF 97541 (Figure 5) reduced adenylyl cyclase activity in PeaGB1/DmGB2expressing cells, yet with reduced potency compared to GABA (see: Table 2). For the DmGB1/DmGB2 receptor, data are available for SKF 97541 (34). With 40 µM, the EC50 value is about three orders of magnitude larger than at PeaGB1/DmGB2 or PeaGB1/PeaGB2 receptors (see: Table 2) while mammalian receptors respond to SKF 97541 also in the low nanomolar range. As expected, typical GABAA receptor antagonists, e.g., bicuculline and picrotoxin, were ineffective at the PeaGB1/DmGB2 heteromer. In contrast, established GABAB receptor antagonists efficiently suppressed GABA-evoked receptor activity and led to an increase of [cAMP]i back to original values obtained with 10 µM NKH 477. Two compounds, CGP 54626 and CGP 55845 had similar potencies in the low to sub-micromolar range on both PeaGB1/DmGB2 and PeaGB1/PeaGB2 heteromers. A third compound, CGP 52432, was less potent with IC50 values between 14 and 22 µM (see: Table 2). Although these ligands are more potent at human GABAB receptors (62) the rank order of potency is well conserved (see: Table 2).


Table 2. Pharmacological Characteristics of Different GABAB Receptors* EC50/IC50 value Ligand

GABA

PeaGB1/DmGB2

PeaGB1/GB2

DmGB1/GB2

Human GB1a/GB2

18 nM

85 nM

20 µM

2.8 µM

3-APPA

102 nM

93 nM

?

620 nM

SKF97541

121 nM

72 nM

40 µM

830 nM

(±)-Baclofen

unquantifiable

unquantifiable

-

7.4 µM

CGP52432

14.3 µM

22 µM

-

31 nM

CGP54626

1.06 µM

0.64 µM

0.5 µM

1.4 nM

CGP55845

0.97 µM

0.68 µM

0.5 µM

3.0 nM

Picrotoxin

-

-

-

-

Bicuclline

-

-

-

-


Agonists

Antagonists

*

Half-maximal effective concentrations of agonists (EC50) and antagonists (IC50) are displayed for PeaGB1/DmGB2 (this study), PeaGB1/PeaGB2 (51), DmGB1/DmGB2 (34), and human GB1a/GB2 (62); -, no effect; ?, no pharmacological data available.

How To Explain Differences in Potency and Efficacy of Ligands Mediated by Exchanging Orthologous GB2 Subunits? In order to constitute functional GABAB receptors, two homologous subunits have to interact via their large extracellular N-terminal and their transmembrane domains. Therefore, amino acid differences in these regions most likely affect the function and/or activity profile of a given receptor heteromer. With 67.3 and 80.1%, sequence identity and similarity, respectively, in the extracellular N-terminus and the transmembrane domains, the primary structures of DmGB2 and PeaGB2 are closely related (Figure 1). The greatest differences between these orthologous subunits are present in the C-terminal region (Figure 1). However, even subtle differences in the amino acid sequence may result in changes of the secondary structure of the protein. Such structural differences in the extracellular domain(s) may modulate the interaction between GB1 and GB2 subunits which can lead to a change in ligand sensitivity of the GB1 subunit. In addition, subunit interaction after ligand binding may be affected as well. It has been experimentally 101 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.


shown that, depending on the ligand, the extracellular domain of GB2 selectively stabilizes the agonist-bound conformation of GB1 (63). In mammals, the amino acid residue Y118 clearly participates in the interaction of the extracellular domains (63). This residue is conservatively substituted by a phenylalanine both in P. americana and in D. melanogaster. Whether this phenylalanine or residues in the proximity of this position are involved in the interaction of insect GB2 subunits with GB1 subunits has to be proven in future experiments applying site directed mutagenesis strategies. Alternative to effects resulting from changes in the interaction of extracellular domains, receptor signaling properties might also be modulated by the efficacy of G protein coupling to GB2 subunits. It is worth mentioning that important amino acid residues and secondary structures leading to functional receptor heterodimers are phylogenetically well-conserved. This notion is evolutionary supported by the fact that GB receptors evolved approximately 899 million years ago (56). After a duplication event at 573-565 million years ago, GABAB receptor subunits as studied in this contribution arose. By then the GB1 subunit kept its functional properties, whereas the GB2 subunit retained its structure while loosing the ligand-binding ability (56). In summary, our data have shown that the GB2 subunit of metabotropic GABAB receptors substantially contributes to receptor activation. Receptor functionality is not limited to the presence of receptor subunits from the same species. The GB2 subunit from D. melanogaster was able to replace its P. americana orthologue to constitute a functional interspecies receptor heteromer with remarkably high affinity for GABA. This result is in line with previous findings having shown that interspecies GABAB receptor heteromers consisting of GB1 from the rat (Rattus norvegicus) and GB2 of D. melanogaster assemble to functional entities (61). As the pharmacological properties of GABAB receptor heteromers may differ between insect species, these GPCRs might turn out as interesting alternatives to GABAA receptors which are favored as insectidide targets. Due to the task sharing functions of both subunits with GB1 serving in ligand binding and GB2 in transmitting the binding signal into a cellular response, one may envision different routes to disturb GABAB receptor signaling in pest insects. Obviously, synthetic or natural compounds acting as specific antagonists would be superior to block GABAB receptor’s activity. However, because even mammalian and non-mammalian interspecies heteromers form functional receptors (61), uncovering antagonists acting preferentially on pest insects is a challenging task. Our data also reveal that there is an (evolutionary) adjusted and therefore unique interplay of both GB subunits within a given species. This finding may be used to target specifically GABAB receptors of insect pests and disease vectors by impeding subunit interaction in a receptor heteromer. This could be achieved by peptides or synthetic compounds once the interacting surface areas have been mapped precisely on individual GABAB receptor heteromers. The use of receptor sequences from completely sequenced genomes in combination with in silico receptor modelling will certainly provide necessary data on the protein’s interacting surfaces. Based on this information, rational drug design strategies can be initiated with the ultimate goal to impair GABAB receptor activity in pest insects without harming other species. 102 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.

Acknowledgments The DmGB2 cDNA was kindly provided by Dr. K. Raming (Bayer AG, Agricultural Centre, Molecular Target Research, Monheim, Germany).

References 1.


2.

3.

4. 5. 6. 7.

8.

9.

10.

11. 12.

13.

14.

Pin, J. P.; Bettler, B. Organization and functions of mGlu and GABAB receptor complexes. Nature 2016, 540, 60–68. Olsen, R. W.; Sieghart, W. International union of pharmacology. LXX. subtypes of γ-aminobutyric acidA receptors: classification on the basis of subunit composition, pharmacology, and function. Update. Pharmacol. Rev. 2008, 60, 243–260. Ozoe, Y.; Asahi, M.; Ozoe, F.; Nakahira, K.; Mita, T. The antiparasitic isoxazoline A1443 is a potent blocker of insect ligand-gated chloride channels. Biochem. Biophys. Res. Commun. 2010, 391, 744–749. Ozoe, Y. γ-Aminobutyrate- and glutamate-gated chloride channels as targets of insecticides. Adv. Insect Physiol. 2013, 44, 211–286. Casida, J. E.; Durkin, K. A. Novel GABA receptor pesticide targets. Pestic. Biochem. Physiol. 2015, 121, 22–30. Ffrench-Constant, R. H.; Williamson, M. S.; Davies, T. G.; Bass, C. Ion channels as insecticide targets. J. Neurogenet. 2016, 30, 163–177. Simon, J.; Wakimoto, H.; Fujita, N.; Lalande, M.; Barnard, E. A. Analysis of the set of GABAA receptor genes in the human genome. J. Biol. Chem. 2004, 279, 41422–41435. Ffrench-Constant, R. H.; Mortlock, D. P.; Shaffer, C. D.; MacIntyre, R. J.; Roush, R. T. Molecular cloning and transformation of cyclodiene resistance in Drosophila: an invertebrate γ-aminobutyric acid subtype A receptor locus. Proc. Natl. Acad. Sci. U.S.A. 1991, 88, 7209–7213. Gisselmann, G.; Plonka, J.; Pusch, H.; Hatt, H. Drosophila melanogaster GRD and LCCH3 subunits form heteromultimeric GABA-gated cation channels. Br. J. Pharmacol. 2004, 142, 409–413. Buckingham, S. D.; Biggin, P. C.; Sattelle, B. M.; Brown, L. A.; Sattelle, D. B. Insect GABA receptors: splicing, editing, and targeting by antiparasitics and insecticides. Mol. Pharmacol. 2005, 68, 942–951. Bockaert, J.; Pin, J. P. Molecular tinkering of G Protein-Coupled Receptors: an evolutionary success. EMBO J. 1999, 18, 1723–1729. Kaupmann, K.; Malitschek, B.; Schuler, V.; Heid, J.; Froestl, W.; Beck, P.; Mosbacher, J.; Bischoff, S.; Kulik, A.; Shigemoto, R.; Karschin, A.; Bettler, B. GABAB-receptor subtypes assemble into functional heteromeric complexes. Nature 1998, 396, 683–687. White, J. A.; Wise, A.; Main, M. J.; Green, A.; Fraser, N. J.; Disney, G. H.; Barnes, A. A.; Emson, P.; Foord, S. M.; Marshall, F. H. Heterodimerization is required for the formation of a functional GABAB receptor. Nature 1998, 396, 679–682. Marshall, F. H.; Jones, K. A.; Kaupmann, K.; Bettler, B. GABAB receptors the first 7TM heterodimers. Trends Pharmacol. Sci. 1999, 20, 396–399. 103

Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.


15. Galvez, T.; Duthey, B.; Kniazeff, J.; Blahos, J.; Rovelli, G.; Bettler, B.; Prézeau, L.; Pin, J. P. Allosteric interactions between GB1 and GB2 subunits are required for optimal GABAB receptor function. EMBO J. 2001, 20, 2152–2159. 16. Margeta-Mitrovic, M.; Jan, Y. N.; Jan, L. Y. Ligand-induced signal transduction within heterodimeric GABAB receptor. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 14643–14648. 17. Schwarz, D. A.; Barry, G.; Eliasof, S. D.; Petroski, R. E.; Conlon, P. J.; Maki, R. A. Characterization of γ-aminobutyric acid receptor GABAB(1e), a GABAB(1) splice variant encoding a truncated receptor. J. Biol. Chem. 2000, 275, 32174–32181. 18. Monnier, C.; Tu, H.; Bourrier, E.; Vol, C.; Lamarque, L.; Trinquet, E.; Pin, J. P.; Rondard, P. Trans-activation between 7TM domains: implication in heterodimeric GABAB receptor activation. EMBO J. 2011, 30, 32–42. 19. Kuner, R.; Köhr, G.; Grünewald, S.; Eisenhardt, G.; Bach, A.; Kornau, H. C. Role of heteromer formation in GABAB receptor function. Science 1999, 283, 74–77. 20. Schwenk, J.; Metz, M.; Zolles, G.; Turecek, R.; Fritzius, T.; Bildl, W.; Tarusawa, E.; Kulik, A.; Unger, A.; Ivankova, K.; Seddik, R.; Tiao, J. Y.; Rajalu, M.; Trojanova, J.; Rohde, V.; Gassmann, M.; Schulte, U.; Fakler, B.; Bettler, B. Native GABAB receptors are heteromultimers with a family of auxiliary subunits. Nature 2010, 465, 231–235. 21. Comps-Agrar, L.; Kniazeff, J.; Nørskov-Lauritsen, L.; Maurel, D.; Gassmann, M.; Gregor, N.; Prézeau, L.; Bettler, B.; Durroux, T.; Trinquet, E.; Pin, J. P. The oligomeric state sets GABAB receptor signalling efficacy. EMBO J. 2011, 30, 2336–2349. 22. Comps-Agrar, L.; Kniazeff, J.; Brock, C.; Trinquet, E.; Pin, J. P. Stability of GABAB receptor oligomers revealed by dual TR-FRET and drug-induced cell surface targeting. FASEB J. 2012, 26, 3430–3439. 23. Chen, G.; van den Pol, A. N. Presynaptic GABAB autoreceptor modulation of P/Q-type calcium channels and GABA release in rat suprachiasmatic nucleus neurons. J. Neurosci. 1998, 18, 1913–1922. 24. Vigot, R.; Barbieri, S.; Bräuner-Osborne, H.; Turecek, R.; Shigemoto, R.; Zhang, Y. P.; Luján, R.; Jacobson, L. H.; Biermann, B.; Fritschy, J. M.; Vacher, C. M.; Müller, M.; Sansig, G.; Guetg, N.; Cryan, J. F.; Kaupmann, K.; Gassmann, M.; Oertner, T. G.; Bettler, B. Differential compartmentalization and distinct functions of GABAB receptor variants. Neuron 2006, 50, 589–601. 25. Prosser, H. M.; Gill, C. H.; Hirst, W. D.; Grau, E.; Robbins, M.; Calver, A.; Soffin, E. M.; Farmer, C. E.; Lanneau, C.; Gray, J.; Schenck, E.; Warmerdam, B. S.; Clapham, C.; Reavill, C.; Rogers, D. C.; Stean, T.; Upton, N.; Humphreys, K.; Randall, A.; Geppert, M.; Davies, C. H.; Pangalos, M. N. Epileptogenesis and enhanced prepulse inhibition in GABAB1-deficient mice. Mol. Cell. Neurosci. 2001, 17, 1059–1070. 26. Schuler, V.; Lüscher, C.; Blanchet, C.; Klix, N.; Sansig, G.; Klebs, K.; Schmutz, M.; Heid, J.; Gentry, C.; Urban, L.; Fox, A.; Spooren, W.; Jaton, A. L.; Vigouret, J.; Pozza, M.; Kelly, P. H.; Mosbacher, J.; Froestl, W.; 104 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.

27.


28.

29.

30. 31.

32.

33.

34. 35.

36.

37. 38.

39.

40.

Käslin, E.; Korn, R.; Bischoff, S.; Kaupmann, K.; van der Putten, H.; Bettler, B. Epilepsy, hyperalgesia, impaired memory, and loss of pre- and postsynaptic GABAB responses in mice lacking GABAB(1). Neuron 2001, 31, 47–58. Fatemi, S. H.; Folsom, T. D.; Reutiman, T. J.; Thuras, P. D. Expression of GABAB receptors is altered in brains of subjects with autism. Cerebellum 2009, 8, 64–69. Selten, M. M.; Meyer, F.; Ba, W.; Vallès, A.; Maas, D. A.; Negwer, M.; Eijsink, V. D.; van Vugt, R.; van Hulten, J. A.; van Bakel, N. H.; Roosen, J.; van der Linden, R. J.; Schubert, D.; Verheij, M. M.; Kasri, N. N.; Martens, G. J. Increased GABAB receptor signaling in a rat model for schizophrenia. Sci. Rep. 2016, 6, 34240. Wilson, R. I.; Laurent, G. Role of GABAergic inhibition in shaping odorevoked spatiotemporal patterns in the Drosophila antennal lobe. J. Neurosci. 2005, 25, 9069–9079. Liu, X; Krause, WC; Davis, RL GABAA receptor RDL inhibits Drosophila olfactory associative learning. Neuron 2007, 56, 1090–1102. Agosto, J.; Choi, J. C.; Parisky, K. M.; Stilwell, G.; Rosbash, M.; Griffith, L. C. Modulation of GABAA receptor desensitization uncouples sleep onset and maintenance in Drosophila. Nat. Neurosci. 2008, 11, 354–359. Yuan, Q.; Song, Y.; Yang, C. H.; Jan, L. Y.; Jan, Y. N. Female contact modulates male aggression via a sexually dimorphic GABAergic circuit in Drosophila. Nat. Neurosci. 2014, 17, 81–88. Pool, A. H.; Kvello, P.; Mann, K.; Cheung, S. K.; Gordon, M. D.; Wang, L.; Scott, K. Four GABAergic interneurons impose feeding restraint in Drosophila. Neuron 2014, 83, 164–177. Mezler, M.; Müller, T.; Raming, K. Cloning and functional expression of GABAB receptors from Drosophila. Eur. J. Neurosci. 2001, 13, 477–486. Dzitoyeva, S.; Gutnov, A.; Imbesi, M.; Dimitrijevic, N.; Manev, H. Developmental role of GABAB(1) receptors in Drosophila. Brain Res. Dev. Brain Res. 2005, 158, 111–114. Enell, L. E.; Kapan, N.; Söderberg, J. A.; Kahsai, L.; Nässel, D. R. Insulin signaling, lifespan and stress resistance are modulated by metabotropic GABA receptors on insulin producing cells in the brain of Drosophila. PLoS One 2010, 5, e15780. Olsen, S. R.; Wilson, R. I. Lateral presynaptic inhibition mediates gain control in an olfactory circuit. Nature 2008, 452, 956–962. Lei, Z.; Chen, K.; Li, H.; Liu, H.; Guo, A. The GABA system regulates the sparse coding of odors in the mushroom bodies of Drosophila. Biochem. Biophys. Res. Commun. 2013, 436, 35–40. Hamasaka, Y.; Wegener, C.; Nässel, D. R. GABA modulates Drosophila circadian clock neurons via GABAB receptors and decreases in calcium. J. Neurobiol. 2005, 65, 225–240. Gmeiner, F.; Kołodziejczyk, A.; Yoshii, T.; Rieger, D.; Nässel, D. R.; Helfrich-Förster, C. GABAB receptors play an essential role in maintaining sleep during the second half of the night in Drosophila melanogaster. J. Exp. Biol. 2013, 216, 3837–3843. 105

Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.


41. Dzitoyeva, S.; Dimitrijevic, N.; Manev, H. γ-Aminobutyric Acid B Receptor 1 Mediates behavior-impairing actions of alcohol in Drosophila: adult RNA Interference and pharmacological evidence. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 5485–5490. 42. Enell, L; Hamasaka, Y.; Kolodziejczyk, A.; Nässel, D. R. γ-Aminobutyric acid (GABA) sgnaling components in Drosophila: immunocytochemical localization of GABAB receptors in relation to the GABAA receptor subunit RDL and a vesicular GABA transporter. J. Comp. Neurol. 2007, 505, 18–31. 43. Walz, B.; Baumann, O.; Krach, C.; Baumann, A.; Blenau, W. The aminergic control of cockroach salivary glands. Arch. Insect Biochem. Physiol. 2006, 62, 141–152. 44. Stankiewicz, M.; Dąbrowski, M.; de Lima, M. E. Nervous system of Periplaneta americana cockroach as a model in toxinological studies: a short historical and actual view. J. Toxicol. 2012, 143740. 45. Hue, B. Functional assay for GABA receptor subtypes of a cockroach giant interneuron. Arch. Insect Biochem. Physiol. 1991, 18, 147–157. 46. Bai, D.; Sattelle, D. A GABAB receptor on an identified insect motor neurone. J. Exp. Biol. 1995, 198, 889–894. 47. Rotte, C.; Witte, J.; Blenau, W.; Baumann, O.; Walz, B. Source, topography and excitatory effects of GABAergic innervation in cockroach salivary glands. J. Exp. Biol. 2009, 212, 126–136. 48. Elia, A. J.; Ali, D. W.; Orchard, I. Immunochemical staining of tyrosine hydroxylase (TH)-like material in the salivary glands and central nerve cord of the cockroach, Periplaneta americana (L.). J. Insect Physiol. 1994, 40, 671–683. 49. Davis, N. T. Serotonin-immunoreactive visceral nerves and neurohemal system in the cockroach Periplaneta americana (L.). Cell Tissue Res. 1985, 240, 593–600. 50. Baumann, O.; Dames, P.; Kühnel, D.; Walz, B. Distribution of serotonergic and dopaminergic nerve fibers in the salivary gland complex of the cockroach Periplaneta americana. BMC Physiol. 2002, 2, 9. 51. Blankenburg, S.; Balfanz, S.; Hayashi, Y.; Shigenobu, S.; Miura, T.; Baumann, O.; Baumann, A.; Blenau, W. Cockroach GABAB receptor subtypes: molecular characterization, pharmacological properties and tissue distribution. Neuropharmacology 2015, 88, 134–144. 52. Kozak, M. Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Res. 1984, 12, 857–872. 53. Wachten, S.; Schlenstedt, J.; Gauss, R.; Baumann, A. Molecular identification and functional characterization of an adenylyl cyclase from the honeybee. J. Neurochem. 2006, 96, 1580–1590. 54. Chen, C.; Okayama, H. High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 1987, 7, 2745–2752. 55. Calver, A. R.; Michalovich, D.; Testa, T. T.; Robbins, M. J.; Jaillard, C.; Hill, J.; Szekeres, P. G.; Charles, K. J.; Jourdain, S.; Holbrook, J. D.; Boyfield, I.; Patel, N.; Medhurst, A. D.; Pangalos, M. N. Molecular cloning 106 Gross et al.; Advances in Agrochemicals: Ion Channels and G Protein-Coupled Receptors (GPCRs) as Targets for Pest ... ACS Symposium Series; American Chemical Society: Washington, DC, 2017.

56.

57.


58.

59.

60.

61.

62.

63.

and characterisation of a novel GABAB-related G-Protein Coupled Receptor. Mol. Brain. Res. 2003, 110, 305–317. Cao, J.; Huang, S.; Qian, J.; Huang, J.; Jin, L.; Su, Z.; Yang, J.; Liu, J. Evolution of the class C GPCR venus flytrap modules involved positive selected functional divergence. BMC Evol. Biol. 2009, 9, 67. Romaus-Sanjurjo, D.; Fernández-López, B.; Sobrido-Cameán, D.; BarreiroIglesias, A.; Rodicio, M. C. Cloning of the GABAB receptor subunits B1 and B2 and their expression in the central nervous system of the adult sea lamprey. Front. Neuroanat. 2016, 10, 118. Berger, B.; Wilson, D. B.; Wolf, E.; Tonchev, T.; Milla, M.; Kim, P. S. Predicting coiled coils by use of pairwise residue correlations. Proc. Natl. Acad. Sci. U.S.A. 1995, 92, 8259–8263. Galvez, T.; Parmentier, M. L.; Joly, C.; Malitschek, B.; Kaupmann, K.; Kuhn, R.; Bittiger, H.; Froestl, W.; Bettler, B.; Pin, J. P. Mutagenesis and modeling of the GABAB receptor extracellular domain support a venus flytrap mechanism for ligand binding. J. Biol. Chem. 1999, 274, 13362–13369. Pregitzer, P.; Schultze, A.; Raming, K.; Breer, H.; Krieger, J. Expression of a GABAB-receptor in olfactory sensory neurons of sensilla trichodea on the male antenna of the moth Heliothis virescens. Int. J. Biol. Sci. 2013, 9, 707–715. Dupuis, D. S.; Relkovic, D.; Lhuillier, L.; Mosbacher, J.; Kaupmann, K. Point mutations in the transmembrane region of GABAB2 facilitate activation by the positive modulator N,N′-Dicyclopentyl-2-methylsulfanyl-5-nitropyrimidine-4,6-diamine (GS39783) in the absence of the GABAB1 subunit. Mol. Pharmacol. 2006, 70, 2027–2036. Green, A.; Walls, S.; Wise, A.; Green, R. H; Martin, A. K.; Marshall, F. H. Characterization of [3H]-CGP54626A binding to heterodimeric GABAB receptors stably expressed in mammalian cells. Br. J. Pharmacol. 2000, 131, 1766–1774. Geng, Y.; Xiong, D.; Mosyak, L.; Malito, D. L.; Kniazeff, J.; Chen, Y.; Burmakina, S.; Quick, M.; Bush, M.; Javitch, J. A.; Pin, J. P.; Fan, Q. R. Structure and functional interaction of the extracellular domain of human GABAB receptor GBR2. Nat. Neurosci. 2012, 15, 970–978.


Subunit-Specific Modulatory Functions Are Conserved in an

Recommend Documents