Suppression of mTOR Signaling Pathways in Skeletal Muscle of

Feb 1, 2016 - Finishing Pigs by Increasing the Ratios of Ether Extract and Neutral ... and Akt (0.92 ± 0.01 vs 1.00 ± 0.05) were observed in pigs fe...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/JAFC

Suppression of mTOR Signaling Pathways in Skeletal Muscle of Finishing Pigs by Increasing the Ratios of Ether Extract and Neutral Detergent Fiber at the Expense of Starch in Iso-energetic Diets Changning Yu, Yanjiao Li, Bolin Zhang, Meng Lin, Jiaolong Li, Lin Zhang, Tianjiao Wang, Feng Gao,* and Guanghong Zhou Synergetic Innovation Center of Food Safety and Nutrition, Key Laboratory of Animal Origin Food Production and Safety Guarantee of Jiangsu Province, College of Animal Science and Technology, Nanjing Agricultural University, No. 1 Weigang Road, Nanjing, 210095 Jiangsu China ABSTRACT: Three iso-energetic and iso-nitrogenous diets were fed to finishing pigs for 28 days to investigate the mammalian target of rapamycin (mTOR) and ubiquitin−proteasome signaling pathways of skeletal muscle by altering compositions of dietary energy sources. Diet A, diet B, and diet C contained 44.1%, 37.6%, and 30.9% starch; 5.9%, 9.5%, and 14.3% ether extract (EE); and 12.6%, 15.4%, and 17.8% neutral detergent fiber (NDF), respectively. An increase of mRNA expression of MuRF1 (1.09 ± 0.10 vs 1.00 ± 0.08) and MAFbx (1.10 ± 0.06 vs 1.00 ± 0.11) and a decrease of concentrations of plasma insulin (8.2 ± 0.8 vs 10.8 ± 1.2) and glucose (5.76 ± 0.12 vs 6.43 ± 0.33) together with mRNA expression of IRS (0.78 ± 0.19 vs 1.01 ± 0.05) and Akt (0.92 ± 0.01 vs 1.00 ± 0.05) were observed in pigs fed diet C compared with diet A. Protein levels of total and phosphorylated mTOR (0.31 ± 0.04 vs 0.48 ± 0.03 and 0.39 ± 0.01 vs 0.56 ± 0.02), 4EBP1 (0.66 ± 0.06 vs 0.90 ± 0.09 and 0.60 ± 0.12 vs 0.84 ± 0.09), and S6K1 (0.66 ± 0.01 vs 0.89 ± 0.01 and 0.48 ± 0.03 vs 0.79 ± 0.02) were decreased; however, total and phosphorylated AMPK (0.96 ± 0.06 vs 0.64 ± 0.04 and 0.97 ± 0.09 vs 0.61 ± 0.09) were increased in pigs fed diet C compared with diet A. In conclusion, diet C suppressed the mTOR pathway and accelerated the ubiquitin−proteasome pathway in skeletal muscle of finishing pigs. KEYWORDS: dietary energy sources, mTOR pathway, ubiquitin−proteasome pathway, finishing pigs

■

INTRODUCTION Dietary starch is the major energy source for finishing pigs; dietary fiber and fat also provide energy in pigs.1−3 As we know, in the small intestine, starch can be digested to glucose and plays an important role in glucose and amino acid (AA) metabolism, especially in the utilization of AA for protein synthesis in skeletal muscle.4 Meanwhile, soybean oil is often used as an important energy source in diets of weanling, growing, and finishing pigs.2 Dietary soybean oil can improve feed efficiency and the apparent ileal digestibility of dietary AA in growing pigs.5 In addition, dietary fiber shows positive effects on gut health and satiety in pigs.6 A recent study of cardiac myocytes in vitro has shown that elevated glucose levels could stimulate protein synthesis independently of insulin.7 Dietary supplementation with fat may improve daily weight gain in growing−finishing pigs.8 Moreover, a minimum level of dietary fiber can maintain the physiological functions of pigs’ intestinal tracts.9 However, little information is available on the effects of different compositions of three energy sourcesstarch, crude fat, and neutral detergent fiber (NDF)on the signaling pathways of protein metabolism in skeletal muscle of finishing pigs. The mass of protein in muscle amounts to 50% of the whole body protein synthesis.10 A previous study reported that protein synthesis was stimulated by the species of AA and energy utilization in skeletal muscle.11 Protein synthesis in skeletal muscle is stimulated by feeding through the mammalian target of rapamycin (mTOR)-dependent pathway, which can © 2016 American Chemical Society

be regulated by exogenous nutrients signaling and endogenous factors, such as hormones (e.g., insulin) and growth factors (e.g., insulin-like growth factor-1 (IGF-1)).12,13 The mTOR signaling pathway involved in protein synthesis includes phosphatidylinositol-3-kinase (PI3K), protein kinase B1 (Akt) in upstream, mTOR protein, and ribosomal protein s6 kinase 1 (S6K1) and eIF4E-binding protein 1 (4E-BP1) in downstream.14 AMP-activated protein kinase (AMPK) is a major sensor of energy in cells and can be activated by glucose starvation or low energy level (high AMP/ATP ratio).15 Phosphorylated AMPK can directly affect translational initiation and protein synthesis in skeletal muscle via the mTOR signaling pathway.16 On the other hand, in terms of protein degradation in skeletal muscle of pigs, the ubiquitin− proteasome pathway plays a central role.17 Two specific E3 ubiquitin ligases, muscle ring finger 1 (MuRF1) and muscle atrophy F-box (MAFbx), involved in the ubiquitin−proteasome pathway are upregulated when protein degradation occurs in skeletal muscle. Furthermore, the Akt-signaling pathway links between the anabolic and catabolic reactions.18 Activation of the Akt-signaling pathway can downregulate the expression of the transcription factors MuRF1 and MAFbx by inhibiting the forkhead box O (FoxO) transcription factors family, FoxO1, Received: Revised: Accepted: Published: 1557

December 23, 2015 January 25, 2016 January 31, 2016 February 1, 2016 DOI: 10.1021/acs.jafc.5b06089 J. Agric. Food Chem. 2016, 64, 1557−1564

Article

Journal of Agricultural and Food Chemistry FoxO3, FoxO4, and FoxO6.19 However, whether the skeletal muscle protein synthesis and degradation in pigs fed different compositions of dietary energy sources are mediated through the regulation of mTOR and ubiquitin−proteasome signaling pathways is still unknown. Our previous study showed that diets with the lowest levels of starch and the highest levels of fat and NDF decreased average daily gain, average daily feed intake, and back fat depth in comparison to diets with the highest levels of starch and the lowest levels of fat and NDF in finishing pigs.20 According to the results mentioned above, the aims of this study were to further explore the effects of different compositions of dietary energy sources (starch, crude fat, and NDF) on the mTOR and ubiquitin−proteasome signaling pathways of skeletal muscle in finishing pigs. In addition, we aimed to further investigate whether the activation of translation initiation factors and protein metabolism signaling pathways in skeletal muscle of finishing pigs in response to different compositions of dietary energy sources were associated with glucose, insulin action, IGF-1, and/or AMPK.

■

Table 1. Composition and Nutrient Content of the Experimental Diets for Finishing Pigs diet treatmenta A

B

C

46.10 10.10 11.37 27.10 2.90

26.45 7.25 9.50 50.00 4.30

0.93 0.20 0.30 1.00

1.00 0.20 0.30 1.00

Calculated Nutrient Level (%) net energy (MJ/kg) 10.30 10.30 Lys 0.74 0.74 Met 0.22 0.23 Trp 0.16 0.17 Thr 0.52 0.52 calcium 0.52 0.52 available phosphorus 0.18 0.18

10.40 0.77 0.24 0.16 0.52 0.52 0.18

Analyzed Nutrient Level (%) 85.40 85.30 14.30 14.20 44.10 37.60 5.90 9.50 12.60 15.40 4.60 6.00

86.60 14.20 30.90 14.30 17.80 7.60

maize wheat bran soybean meal rice bran soybean oil lysine-HCl limestone dicalcium phosphate salt premixb

MATERIALS AND METHODS

Chemicals. Dietary dry matter, crude protein, EE (ether extract or crude fat, including fat, carotene, organic acid, chlorophyll, resin, and fat-soluble vitamins), NDF (the component of the plant cell wall, including cellulose, hemicellulose, lignin, and silica), and crude ash were analyzed by the AOAC procedures.21 The starch content was measured by American Association of Cereal Chemists (AACC) method 76-13.22 Animals and Diets. All experimental procedures were approved by the Animal Care and Use Committee of Nanjing Agricultural University. All 72 barrows (Duroc × Landrace × Yorkshire, DLY) used in this experiment had similar initial body weight (average BW = 65.0 ± 2.0 kg) and were fed the same diet before this experiment. The pigs were housed in solid concrete floor pens (3.40 m × 4.80 m) at an ambient temperature of 20−25 °C in an environmentally controlled room. Diets were fed in mash form, and pigs were allowed ad libitum access to feed and water. All experimental diets were formulated to meet the 2012 nutrient requirements of the National Research Council (NRC) for finishing pigs (Table 1). The pigs were uniformly divided into three iso-energetic and iso-nitrogenous diet treatment groups. Diet A contained 44.1% starch, 5.9% EE, and 12.6% NDF; diet B contained 37.6% starch, 9.5% EE, and 15.4% NDF; and diet C contained 30.9% starch, 14.3% EE, and 17.8% NDF. The traditional diet (diet A) was a positive control diet with 44.1% starch. The content of starch in diet B and diet C was reduced by approximately 15% and 30%, respectively, relative to the starch content in diet A. In diet B and diet C, dietary starch was replaced with crude fat and NDF. Each treatment had three replicates with eight pigs each. Sample Collection. At the end of a 28-day period of feeding, after a 12-h fast, eight pigs from each treatment (two or three pigs per pen) were randomly selected, weighed, and transported (approximately 30 min) to a slaughterhouse. Then pigs were electrically stunned, exsanguinated, scalded, depilated, labeled, eviscerated, and ripped down the midline accurately. Blood samples were taken into heparinized tubes and then centrifuged at 3000g for 10 min at 4 °C, and the supernatant (plasma) was stored at −20 °C for glucose, insulin, and IGF-1 analysis. The samples of Longissimus dorsi (approximately 5.0 g each) were then quickly frozen in liquid nitrogen and stored at −80 °C for quantitative polymerase chain reaction (PCR) and Western blot analysis. Plasma Glucose and Hormone Concentrations Assays. Plasma glucose concentration was determined by using a CX4 Auto Blood Biochemical Analyzer (Beckman Inc., Fullerton, CA, USA) according to the manufacturer’s instructions (Beijing North Institute of Biological Technology, Beijing, China). Plasma insulin concen-

dry matter crude protein starch EEc NDFd crude ash

Ingredients (%) 69.00 5.20 14.00 8.80 0.60 0.02 0.78 0.30 0.30 1.00

a

Diet A contained 44.1% starch, 5.9% EE, and 12.6% NDF; diet B contained 37.6% starch, 9.5% EE, and 15.4% NDF; and diet C contained 30.9% starch, 14.3% EE, and 17.8% NDF. bThe premix provided per kilogram of diet: 100 mg iron, 100 mg zinc, 30 mg manganese, 20 mg copper, 0.3 mg selenium, 0.5 mg iodine, 1720 μg retinyl acetate, 25 μg cholecalciferol, 8.0 mg DL-α-tocopheryl acetate, 3.0 mg menadione sodium bisulfate, 2.0 mg thiamin mononitrate, 6.0 mg riboflavin, 3.0 mg pyridoxine hydrochloride, 30 mg calcium pantothenate, 1.0 mg folic acid, 20 μg cyanocobalamin, and 300 mg choline. cEE, ether extract or crude fat. dNDF, neutral detergent fiber. tration was measured by using a porcine insulin RIA kit that used porcine insulin antibody and human insulin standards (Beijing North Institute of Biological Technology, Beijing, China). Plasma IGF-1 concentration was measured by using an IGF-1 ELISA kit (R&D Systems China Co., Ltd. Shanghai, China). RNA Isolation and Quantitative Real-Time PCR. The total RNA was extracted from frozen muscle samples using Trizol reagent (TaKaRa Biotechnology, Dalian, China) following the manufacturer’s instructions. Its purity and concentration were measured using a NanoDrop ND-1000 UV spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). RNA samples were then diluted in diethyl pyrocarbonate-treated water to reach the appropriate concentration. The total RNA was then converted into cDNA using a Prime Script RT reagent kit (TaKaRa Biotechnology, Dalian, China) following the manufacturer’s protocols. Real-time PCR was carried out for quantification of insulin receptor (IR), insulin receptor substrate (IRS), IGF-1, insulin-like growth factor-1 receptor (IGF-1R), Akt1, Foxo1, Foxo4, MuRF1, and MAFbx, and β-actin was used as the housing-keeping gene. The primer sequences for target genes are presented in Table 2. To ensure the integrity of the synthesized cDNA, samples were confirmed by visualizing PCR amplification 1558

DOI: 10.1021/acs.jafc.5b06089 J. Agric. Food Chem. 2016, 64, 1557−1564

Article

Journal of Agricultural and Food Chemistry Table 2. Primer Sequences for Real-Time PCR Analysis genea

GenBank IDb

β-actin

XM_003357928

IR

XM_003123154

IRS

NM_001244489

IGF-1

NM_214256

IGF-1R

XM_003361272

Akt

NM_001159776

FoxO1

NM_214014.2

FoxO4

NM_003135172.2

MuRF1

NM_001184756

MAFbx

NM_001044588

primer sequences (5′-3′)

product size (bp)

F: GGATGCAGAAGGAGATCACG R: ATCTGCTGGAAGGTGGACAG F: CATACCTGAACGCCAAGAAGTT R: GTCATTCCAAAGTCTCCGATTT F: CCCTACTATTTCCCACCAGAAG R: CATTTCCAGACCCTCCTCAG F: TCTTCAGTTCGTGTGCGGAG R: TTGGCAGGCTTGAGGGGT F: ATGGAGGAAGTGACAGGGACTA R: GTGGTGGTGGAGGTGAAGTG F: CCTGAAGAAGGAGGTCATCG R: TCGTGGGTCTGGAAGGAGTA F: CGGCATCATCTTCATCGTC R: CTGTCCTCCCACTCCAGGTA F: CTGTCCTACGCCGACCTCAT R: TTGCTGTCACCCTTATCCTTG F: GCTGGATTGGAAGAAGATGTAT R: AGGAAAGAATGTGGCAGTGTCT F: CCCTCTCATTCTGTCACCTTG R: ATGTGCTCTCCCACCATAGC

130 100 175 165 116 123 125 103 144 104

a

IR, insulin receptor; IRS, insulin receptor substrate; IGF-1, insulin-like growth factor 1; IGF-1R, insulin-like growth factor 1 receptor; Akt, protein kinase B, also named PKB; FoxO, Forkhead Box O; MAFbx, muscle atrophy F-box; MuRF1, muscle Ring finger 1. bGenBank Accession Number. products on a 1% agarose gel with ethidium bromide staining. The mRNA expression was measured by using an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with SYBR Premix Ex TaqII (TaKaRa Biotechnology, Dalian, China). All genes were run in the same cycling conditions as follows: one cycle at 95 °C for 30 s, 40 cycles of 95 °C for 5 s, followed by 60 °C for 34 s, and finial dissociation stage of 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s. Eight samples were used for each treatment, and each sample was measured in triplicate. Relative mRNA levels (arbitrary units) were calculated on the basis of PCR efficiency and threshold cycle (Ct) values as previously described. The mRNA level of each target gene in finishing pigs fed diet A was assigned a value of 1. Western Blot Analysis. The specific primary antibodies against AMPKα (Total and Thr172), S6K1 (Total and Thr389), 4E-BP1 (Total and Thr70), mTOR (Total and Ser2448), and β-actin were obtained from Cell Signaling Technology (Beverly, MA, USA). Frozen samples of muscle were powdered under liquid nitrogen using a mortar and pestle to collect supernatants. Protein concentrations in the supernatant fluid were determined by using a BCA protein assay kit (Sangon Biotec., Shanghai, China), and bovine serum albumin was used as a standard. All samples were adjusted to an equal concentration and were run at the same time in triple-wide gels to eliminate interassay variation. The samples were separated by electrophoresis on a 10% polyacrylamide gel for detection of S6K1, a 15% polyacrylamide gel for detection of 4E-BP1, or a 6% polyacrylamide gel for detection of mTOR. Proteins were electrophoretically transferred to a polyvinylidene difluoride (PVDF) membrane. The membrane was incubated with primary antibodies (1:1000) and blocked with 5% fat-free dry milk overnight at 4 °C. The primary antibody dilution buffer was 1 × TBS, 0.1% Tween-20 with 5% BSA. The membranes were washed three times with TBST (1 × Tris-buffered saline including 0.1% Tween 20), and then the membranes were incubated at room temperature for 3 h with a secondary antibody (horseradish peroxidase-conjugated goat antirabbit IgG, Cell Signaling Technology; 1:3000). The specific primary antibodies were AMPKα (Total and Thr172, 1:1000), S6K1 (Total and Thr389, 1:1000), 4E-BP1 (Total and Thr70, 1:1000), mTOR (Total and Ser2448, 1:1000), and β-actin (1:1000).23 The membrane was developed using Super Signal West Pico chemiluminescent substrate (Thermo Scientific, Waltham, MA, USA) and exposed to Kodak film. The band intensities were quantified by Scion Image software (Scion

Corp., Frederick, MD, USA). All protein measurements were normalized to β-actin protein, and all data are expressed as relative to those values from treatment with diet A.24 Statistical Analysis. All experimental data for each treatment were submitted to analysis of variance (ANOVA) with the SAS statistical program (Version 8.02, SAS Institute Inc., Cary, NC), and significant differences among treatments were compared by least-significancedifference (LSD) method multiple range tests. The results are expressed as means with their standard deviation. In statistical analysis, differences showing P < 0.05 were defined as significant. Assumptions of the test included a normal distribution of the data, equal variances, and randomization of the independent sample groups.

■

RESULTS Plasma Glucose and Hormone Concentrations Assays. The effects of different compositions of dietary energy sources on the concentrations of plasma glucose and hormone of finishing pigs are shown in Table 3. The concentrations of plasma insulin and glucose of finishing pigs in the diet C group were lower than those in the diet A group (P < 0.05), but no difference was observed in the concentrations of plasma insulin and glucose between finishing pigs fed diet A and diet B (P > Table 3. Effects of Diets with Low Levels of Starch and High Levels of Crude Fat and Fiber on the Concentrations of Glucose, Insulin, and IGF-1 in the Plasma of Finishing Pigs diet treatmenta A glucose (mmol/L) insulin (μU/mL) IGF-1b (ng/mL)

6.43 ± 0.33 10.8 ± 1.2x 44.2 ± 7.2

B x

C

6.21 ± 0.22 10.0 ± 0.8xy 37.7 ± 6.6

xy

5.76 ± 0.12y 8.2 ± 0.8y 37.3 ± 10.9

a

Diet A contained 44.1% starch, 5.9% EE, and 12.6% NDF; diet B contained 37.6% starch, 9.5% EE, and 15.4% NDF; and diet C contained 30.9% starch, 14.3% EE, and 17.8% NDF. The results are presented by mean values ± standard deviation (n = 8). Means within a row with no common superscripts, x and y, differ significantly (P < 0.05). bIGF-1, insulin-like growth factor-1. 1559

DOI: 10.1021/acs.jafc.5b06089 J. Agric. Food Chem. 2016, 64, 1557−1564

Article

Journal of Agricultural and Food Chemistry

FoxO1, FoxO4, MuRF1, and MAFbx between finishing pigs fed diet A and diet B (P > 0.05). Western Blot Analysis. The protein levels of total and phosphorylated AMPKα (Thr172) in skeletal muscle are shown in Figure 1. Finishing pigs fed diet C showed increased muscle protein levels of total and phosphorylated AMPKα (Thr172) in comparison to the diet A group (Figure 1) (P < 0.05). However, compared with the diet A group, finishing pigs fed diet B showed no effect on the protein abundances of phosphorylated AMPKα (Thr172) in skeletal muscle (Figure 1, panel II) (P > 0.05). The protein levels of total mTOR (I), phosphorylated mTOR (Ser2448) (II), total S6K1 (III), phosphorylated S6K1 (Thr389) (IV), total 4E-BP1 (V), and phosphorylated 4E-BP1 (Thr70) (VI) in skeletal muscle of finishing pigs are illustrated in Figure 2. Finishing pigs fed diet C showed decreased muscle protein levels of total and phosphorylated mTOR (Ser2448), total S6K1 and phosphorylated S6K1 (Thr389), and total 4EBP1 and phosphorylated 4E-BP1 (Thr70) in comparison to the diet A and diet B groups (Figure 2) (P < 0.05). However, the protein levels of total mTOR, total 4E-BP1, and phosphorylated 4E-BP1 (Thr70) did not differ between finishing pigs fed diet A and diet B (Figure 2) (P > 0.05). Moreover, compared with the diet B group, finishing pigs fed diet C also showed decreased protein levels of phosphorylated mTOR (Ser2448), total S6K1, and phosphorylated S6K1 (Thr389) in skeletal muscle.

0.05). In addition, there was no difference in the concentration of plasma IGF-1 among the three groups (P > 0.05). Relative mRNA Expression of IR, IRS, IGF-1, and IGF1R in Skeletal Muscle. As shown in Table 4, there was a Table 4. Effects of Diets with Low Levels of Starch and High Levels of Crude Fat and Fiber on IR, IRS, IGF-1, and IGF1Ra Gene Expression Levels in Skeletal Muscle of Finishing Pigs diet treatmentb A IR IRS IGF-1 IGF-1R

1.01 1.01 1.01 1.00

± ± ± ±

B x

0.07 0.05x 0.06 0.15

0.99 0.97 1.04 1.02

± ± ± ±

C x

0.08 0.25x 0.35 0.05

0.83 0.78 0.92 0.94

± ± ± ±

0.09y 0.19y 0.05 0.15

a

IR, insulin receptor; IRS, insulin receptor substrate; IGF-1, insulinlike growth factor 1; IGF-1R, insulin-like growth factor 1 receptor. b Diet A contained 44.1% starch, 5.9% EE, and 12.6% NDF; diet B contained 37.6% starch, 9.5% EE, and 15.4% NDF; and diet C contained 30.9% starch, 14.3% EE, and 17.8% NDF. The results are presented by mean values ± standard deviation (n = 8). Means within a row with no common superscript, x and y, differ significantly (P < 0.05).

significant decrease in the relative mRNA expression of skeletal muscle IR and IRS in finishing pigs fed diet C in comparison to diet A (P < 0.05). Besides, finishing pigs fed diet B showed no significant effect on the relative mRNA expression of skeletal muscle IR and IRS in comparison to diet A group (P > 0.05). Meanwhile, the relative mRNA expression of IGF-1 and IGF1R in skeletal muscle did not differ among the three groups (P > 0.05). Relative mRNA Expression of Akt, FoxO1, FoxO4, MuRF1, and MAFbx in Skeletal Muscle. The abundances of Akt, FoxO1, FoxO4, MuRF1, and MAFbx mRNAs in skeletal muscle of finishing pigs are illustrated in Table 5. Compared with the diet A group, finishing pigs fed diet C showed reduced relative mRNA expression of Akt but enhanced relative mRNA expression of FoxO1, FoxO4, MuRF1, and MAFbx in skeletal muscle (P < 0.05). However, no significant differences were found in the relative mRNA expression of skeletal muscle Akt,

■

DISCUSSION Muscle protein synthesis is mainly regulated by dietary amino acids. However, dietary energy also has effects on the muscle protein metabolism.25 In pigs, the dietary energy absorbed is then utilized for maintenance or retention of protein.26 In the present study, dietary energy sources absorbed by finishing pigs could affect the protein metabolism signaling pathways. Glucose is an important factor in protein metabolism signaling pathways, which can regulate the level of plasma insulin. The high levels of plasma insulin could stimulate cell growth, glucose disposal, and protein synthesis in skeletal muscle.27,28 In addition, IGF-1 also plays an important role in protein synthesis signaling pathways.29 In this study, diet B and diet C consisted of higher contents of EE and NDF because the part of dietary starch in these groups was replaced by fat and NDF. Therefore, the three dietary compositions provided different levels of glucose to stimulate insulin secretion. The results of this study showed that diets with the lowest levels of starch and the highest levels of fat and NDF (diet C group) decreased the concentrations of plasma insulin and glucose of finishing pigs in comparison to those fed diets with the highest levels of starch and the lowest levels of fat and NDF (diet A group). However, no difference in the concentration of plasma IGF-1 among the three groups was observed. Similar results were obtained by Van Amelsvoort and Weststrate.30 This was likely because the higher levels of dietary crude fat and NDF had negative effects on the growth performance of pigs by reducing the digestibility of organic matter (OM), crude protein (CP), crude fiber (CF), nitrogen-free extract (NFE), and total carbohydrate.31 Moreover, the higher levels of dietary fiber might reduce lipid digestibility.32 Protein synthesis can be mediated by the mTOR pathway.14 Meanwhile, the activation of mTOR can be moderated by upstream signaling molecules such as insulin or IGF-1.33 IR is necessary to mediate insulin action.34 IGF-1R is closely related

Table 5. Effects of Diets with Low Levels of Starch and High Levels of Crude Fat and Fiber on Akt, FoxO1, FoxO4, MAFbx, and MuRF1a Gene Expression Levels in Skeletal Muscle of Finishing Pigs diet treatmentb A Akt FoxO1 FoxO4 MAFbx MuRF1

1.00 1.00 1.00 1.00 1.00

± ± ± ± ±

B x

0.05 0.04y 0.05y 0.11y 0.08y

0.99 1.08 1.02 1.00 1.01

± ± ± ± ±

C x

0.05 0.06y 0.07y 0.07y 0.06x

0.92 1.20 1.17 1.10 1.09

± ± ± ± ±

0.01y 0.08x 0.04x 0.06x 0.10x

a

Akt, protein kinase B, also named PKB; FoxO, Forkhead Box O; MAFbx, muscle atrophy F-box; MuRF1, muscle ring finger 1. bDiet A contained 44.1% starch, 5.9% EE, and 12.6% NDF; diet B contained 37.6% starch, 9.5% EE, and 15.4% NDF; and diet C contained 30.9% starch, 14.3% EE, and 17.8% NDF. The results are presented by mean values ± standard deviation (n = 8). Means within a row with no common superscript, x and y, differ significantly (P < 0.05). 1560

DOI: 10.1021/acs.jafc.5b06089 J. Agric. Food Chem. 2016, 64, 1557−1564

Article

Journal of Agricultural and Food Chemistry

Figure 1. Abundances of total AMP-activated protein kinase α (AMPKα) (I) and phosphorylated AMPKα (Thr172) (II) in skeletal muscle of finishing pigs fed diets with different ratios of starch, crude fat, and NDF. β-Actin was used as a standard to normalize the signal. Data are mean values ± standard deviation (n = 8). Values marked with different letters differ significantly (P < 0.05). Diet A contained 44.1% starch, 5.9% EE, and 12.6% NDF; diet B contained 37.6% starch, 9.5% EE, and 15.4% NDF; and diet C contained 30.9% starch, 14.3% EE, and 17.8% NDF.

Figure 2. Abundances of total mammalian target of rapamycin (mTOR) (I) and phosphorylated mTOR (Ser2448) (II), total 70-kDaS6 kinase-1 (S6K1) (III) and phosphorylated S6K1 (Thr389) (IV), and total eukaryotic initiation factor (eIF) 4Ebinding protein 1 (4E-BP1) (V) and phosphorylated 4E-BP1 (Thr70) (VI) in skeletal muscle of finishing pigs fed diets with different ratios of starch, crude fat, and NDF. β-Actin was used as a standard to normalize the signal. Data are mean values ± standard deviation (n = 8). Values marked with different letters differ significantly (P < 0.05). Diet A contained 44.1% starch, 5.9% EE, and 12.6% NDF; diet B contained 37.6% starch, 9.5% EE, and 15.4% NDF; and diet C contained 30.9% starch, 14.3% EE, and 17.8% NDF.

blood.36 In the present study, the higher expression of Akt mRNA in skeletal muscle was related to the increased mRNA expression of IR and IRS in finishing pigs fed diets with the highest levels of starch and the lowest levels of fat and NDF (diet A group). Interestingly, although IGF-1/IGF-1R could stimulate skeletal muscle protein synthesis through the same pathway with insulin, there was no difference in the mRNA expression of IGF-1 and IGF-1R in skeletal muscle among the

to IR, which also plays an important role in the regulation of the protein synthesis signaling pathway. The binding of insulin or IGF-1 to their receptors can promote the tyrosine kinase activity of the insulin receptor and the recruitment and phosphorylation of IRS, resulting in the activation of downstream signaling effectors such as PI3K/Akt.29,35 Insulin stimulation of PI3K/Akt is a necessary step in the insulin signaling pathway that regulates the uptake of glucose from the 1561

DOI: 10.1021/acs.jafc.5b06089 J. Agric. Food Chem. 2016, 64, 1557−1564

Article

Journal of Agricultural and Food Chemistry three treatment groups (Table 4). These findings were consistent with the results of some previous studies,37,38 which reported that the IGF-1-mediated process might not stimulate skeletal muscle protein synthesis by increasing the glucose level. Therefore, the results of the present study suggested that different compositions of dietary energy sources regulated the signaling pathway of protein synthesis in skeletal muscle of finishing pigs via the modulation of insulin action, not IGF-1. Feeding stimulates protein synthesis in skeletal muscle of neonatal pigs through the mTOR-dependent pathway.11 The mTOR signaling pathway involved in protein synthesis includes insulin/IGF-1, glucose, PI3K, Akt, and AMPK in upstream, and mTOR protein, S6K1, and 4E-BP1 in downstream. The upstream elements, glucose or insulin/IGF-1, activate Akt, a serine/threonine kinase that could directly activate mTORC1 through phosphorylation.39 AMPK, a major sensor of cellular energy, is activated by glucose starvation and plays an important role in inhibition of translational initiation and protein synthesis.16 Downstream of mTOR signaling pathway, mTORC1 regulates translation via S6K1 and 4E-BP1.33 However, phosphorylation of mTOR on Ser2448 stimulates the activity of mTOR.40 Activated S6K1 will phosphorylate and activate ribosomal protein S6, which may further lead to an increase in the translation of mRNAs that encode the proteins of the translational apparatus, including ribosomal proteins and elongation factors.41 Phosphorylated 4E-BP1 will promote dissociation of 4E-BP1·eIF4E complex and sequent binding of eIF4E to eIF4G. Longissimus dorsi is a fast-twitch glycolytic muscle, and its protein synthesis can be stimulated by the postprandial rise in glucose in the neonatal pig.38 In this study, diets with the highest levels of starch and the lowest levels of fat and NDF (diet A group) increased the mRNA expression of IR, IRS, Akt, phosphorylated mTOR, 4E-BP1, and S6K1in skeletal muscle in comparison to diets with the lowest levels of starch and the highest levels of fat and NDF (diet C group). Wheatley et al.42 also demonstrated that protein synthesis in skeletal muscle of pigs was modulated by mTOR signaling pathway using the phosphorylated protein expression or the total protein expression to β-actin. There is evidence that glucose can stimulate phosphorylated 4E-BP1 and S6K1 in the mTORdependent manner.43 Insulin induces the phosphorylation of Akt and mTOR, which then results in increasing the phosphorylated 4E-BP1 and S6K1 in the cellular levels.44 Thus, we speculated that diets with the highest levels of starch and the lowest levels of fat and NDF (diet A group) stimulated protein synthesis through an mTOR-independent pathway in relation to insulin’s stimulatory action on glucose transport activity in finishing pigs. In addition, in this study, finishing pigs fed diets with the lowest levels of starch and the highest levels of fat and NDF (diet C group) stimulated the total and phosphorylated AMPK in skeletal muscle (Figure 1). Similar results were obtained by Oliver et al.,45 who reported that AMPK activation was decreased and mTOR activation was increased by feeding a low-fat liquid diet. Therefore, our results suggested that finishing pigs fed diets with the highest levels of starch and the lowest levels of fat and NDF (diet A group) could accelerate the protein synthesis signaling pathway in skeletal muscle by insulin and nutrient signaling, but diets with the lowest levels of starch and the highest levels of fat and NDF (diet C group) might suppress the protein synthesis signaling pathway in finishing pigs.

The ubiquitin−proteasome pathway is the primary intracellular system for protein degradation in skeletal muscle, and the muscle-specific ubiquitin ligases MuRF1 and MAFbx are rapidly upregulated when protein degradation occurs.17 The serine/threonine kinase Akt has emerged as a critical signaling node in cell signaling downstream of protein synthesis and protein degradation.46 Activation of the Akt pathway downregulates the expression of the transcription factors MuRF1 and MAFbx via inhibition of the FoxO family of transcription factors.47 FoxO phosphylation stimulates the expression of the E3 enzymes MuRF1 and MAFbx and protein degradation. In this study, finishing pigs fed diets with the lowest levels of starch and the highest levels of fat and NDF (diet C group) decreased the mRNA expression of Akt and increased the mRNA expression of FoxO1, FoxO4, MuRF1, and MAFbx in comparison to diets with the highest levels of starch and the lowest levels of fat and NDF (diet A group). However, compared with diets with the highest levels of starch and the lowest levels of fat and NDF (diet A group), feeding finishing pigs diets with intermediate levels of starch, fat, and NDF (diet B group) did not significantly affect the mRNA expression of Akt, FoxO1, FoxO4, MuRF1, and MAFbx in skeletal muscle (Table 5). These findings were similar to the results of Kousteni,48 who reported that insulin suppressed the activity of FoxO1 and the expression of MuRF1 and MAFbx, as well as the protein degradation signaling pathway, in lack of energy in skeletal muscle. In a 2012 study, Xu et al. also reported that the MuRF1- and MAFbx-mediated protein degradation signaling pathway was enhanced during the lack of energy in skeletal muscle.49 These data suggested that feeding finishing pigs diets with the lowest levels of starch and the highest levels of fat and NDF (diet C group) could activate the signaling pathway involved in skeletal muscle protein degradation. The data of feed intake, body weight gain, and body composition in this study have already been published,20 so the data of the growth performance and carcass traits in this experiment are not presented in the present paper. The published results showed that feeding finishing pigs isoenergetic and iso-nitrogenous diets containing low starch and high fat and NDF could decrease the feed intake, body weight gain, and back fat depth.20 This may be associated with the changes in muscle protein synthesis and degradation signaling pathway in finishing pigs. In this study, we found that feeding finishing pigs diets with the lowest levels of starch and the highest levels of fat and NDF (diet C group) suppressed the mTOR signaling pathway and accelerated the ubiquitin− proteasome pathway in skeletal muscle. In conclusion, finishing pigs fed diets with increasing ratios of NDF and EE at the expense of starch showed suppression of the mTOR signaling pathway and acceleration of the ubiquitin−proteasome pathway of skeletal muscle, resulting from decreased concentrations of plasma glucose and insulin, mRNA expression of insulin action signaling, and mTOR, S6K1, and 4EBP1 signaling, and increased AMPK signaling and mRNA expression of FoxO1, FoxO4, MuRF1, and MAFbx. These findings provide a molecular mechanism showing that different ratios of starch, crude fat, and NDF in diets have effects on the protein metabolism signaling pathways in skeletal muscle of finishing pigs. 1562

DOI: 10.1021/acs.jafc.5b06089 J. Agric. Food Chem. 2016, 64, 1557−1564

Article

Journal of Agricultural and Food Chemistry

■

(12) Yao, K.; Yin, Y. L.; Chu, W.; Liu, Z.; Deng, D.; Li, T.; Huang, R.; Zhang, J.; Tan, B.; Wang, W. Dietary arginine supplementation increases mTOR signaling activity in skeletal muscle of neonatal pigs. J. Nutr. 2008, 138, 867−872. (13) Yin, F.; Zhang, Z.; Huang, J.; Yin, Y. Digestion rate of dietary starch affects systemic circulation of amino acids in weaned pigs. Br. J. Nutr. 2010, 103, 1404−1412. (14) Wullschleger, S.; Loewith, R.; Hall, M. N. TOR signaling in growth and metabolism. Cell 2006, 124, 471−484. (15) Fujita, S.; Dreyer, H. C.; Drummond, M. J.; Glynn, E. L.; Cadenas, J. G.; Yoshizawa, F.; Volpi, E.; Rasmussen, B. B. Nutrient signalling in the regulation of human muscle protein synthesis. J. Physiol. 2007, 582, 813−823. (16) Bolster, D. R.; Crozier, S. J.; Kimball, S. R.; Jefferson, L. S. AMPactivated protein kinase suppresses protein synthesis in rat skeletal muscle through down-regulated mammalian target of Rapamycin (mTOR) signaling. J. Biol. Chem. 2002, 277, 23977−23980. (17) Lecker, S. H.; Goldberg, A. L.; Mitch, W. E. Protein degradation by the ubiquitin-proteasome pathway in normal and disease states. J. Am. Soc. Nephrol. 2006, 17, 1807−1819. (18) Léger, B.; Cartoni, R.; Praz, M.; Lamon, S.; Dériaz, O.; Crettenand, A.; Gobelet, C.; Rohmer, P.; Konzelmann, M.; Luthi, F. Akt signalling through GSK-3β, mTOR and Foxo1 is involved in human skeletal muscle hypertrophy and atrophy. J. Physiol. 2006, 576, 923−933. (19) Glass, D. J. Skeletal muscle hypertrophy and atrophy signaling pathways. Int. J. Biochem. Cell Biol. 2005, 37, 1974−1984. (20) Li, Y. J.; Li, J. L.; Zhang, L.; Yu, C. N.; Lin, M.; Gao, F.; Zhou, G. H.; Zhang, Y.; Fan, Y. F.; Nuldnali, L. Effects of dietary energy sources on post mortem glycolysis, meat quality and muscle fibre type transformation of finishing pigs. PLoS One 2015, 10, e0131958. (21) Horwitz, W.; Chichilo, P.; Reynolds, H. Official Methods of Analysis of the Association of Official Analytical Chemists; AOAC: Washington, DC, 1970; Vol. 46, p iv. (22) AACC International. Vitamins: Niacin and Niacinamide in Cereal Products. Approved Methods of Analysis, 11th ed.; Method 8650.02; American Association of Cereal Chemists: St. Paul, MN, 2000; DOI: 10.1094/AACCIntMethod-86-50.02 (23) Yi, D.; Hou, Y.; Wang, L.; Ouyang, W.; Long, M.; Zhao, D.; Ding, B.; Liu, Y.; Wu, G. L-Glutamine enhances enterocyte growth via activation of the mTOR signaling pathway independently of AMPK. Amino Acids 2015, 47, 65−78. (24) Yin, Y.; Yao, K.; Liu, Z.; Gong, M.; Ruan, Z.; Deng, D.; Tan, B.; Liu, Z.; Wu, G. Supplementing L-leucine to a low-protein diet increases tissue protein synthesis in weanling pigs. Amino Acids 2010, 39, 1477−1486. (25) Frank, J. W.; Escobar, J.; Suryawan, A.; Nguyen, H. V.; Kimball, S. R.; Jefferson, L. S.; Davis, T. A. Dietary protein and lactose increase translation initiation factor activation and tissue protein synthesis in neonatal pigs. Am. J. Physiol. Endocrinol. Metab. 2006, 290, E225− E233. (26) Van Milgen, J.; Noblet, J. Partitioning of energy intake to heat, protein, and fat in growing pigs. J. Anim. Sci. 2003, 81, E86−E93. (27) Vincent, M. A.; Clerk, L. H.; Lindner, J. R.; Klibanov, A. L.; Clark, M. G.; Rattigan, S.; Barrett, E. J. Microvascular recruitment is an early insulin effect that regulates skeletal muscle glucose uptake in vivo. Diabetes 2004, 53, 1418−1423. (28) O’Connor, P. M.; Bush, J. A.; Suryawan, A.; Nguyen, H. V.; Davis, T. A. Insulin and amino acids independently stimulate skeletal muscle protein synthesis in neonatal pigs. Am. J. Physiol-Endoc. M. 2003, 284, E110−E119. (29) Liu, G.; Wei, Y.; Wang, Z.; Wu, D.; Zhou, A. Effects of dietary supplementation with cysteamine on growth hormone receptor and insulin-like growth factor system in finishing pigs. J. Agric. Food Chem. 2008, 56, 5422−5427. (30) Van Amelsvoort, J.; Weststrate, J. A. Amylose-amylopectin ratio in a meal affects postprandial variables in male volunteers. Am. J. Clin. Nutr. 1992, 55, 712−718.

AUTHOR INFORMATION

Corresponding Author

*Tel.: 86-25-84399007. Fax: 86-25-84395314. E-mail: [email protected]. Funding

The present study was supported by National Key Basic Research Program of China (no. 2013CB127306), the Fundamental Research Funds for the Central Universities of China (KYZ201222), and the Three Agricultural Projects of Jiangsu Province of China (SX(2011)146). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED EE, ether extract or crude fat; NDF, neutral detergent fiber; AA, amino acid; mTOR, mammalian target of rapamycin; AMPK, AMP-activated protein kinase; 4E-BP1, eIF4E-binding protein 1; S6K1, ribosomal protein s6 kinase 1; IR, insulin receptor; IRS, insulin receptor substrate; IGF-1, insulin-like growth factor-1; IGF-1R, insulin-like growth factor-1 receptor; Akt, protein kinase B; FoxO1, Forkhead box O1; FoxO4, Forkhead box O4; MuRF1, muscle ring finger 1; MAFbx, muscle atrophy F-box; AID, apparent ileal digestibility; PI3K, phosphatidylinositol-3-kinase

■

REFERENCES

(1) Li, T. J.; Huang, R. L.; Wu, G. Y.; Lin, Y. C.; Jiang, Z. Y.; Kong, X. F.; Chu, W. Y.; Zhang, Y. M.; Kang, P.; Hou, Z. P.; Fan, M. Z.; Liao, Y. P.; Yin, Y. L. Growth performance and nitrogen metabolism in weaned pigs fed diets containing different sources of starch. Livest. Sci. 2007, 109, 73−76. (2) Owen, K.; Nelssen, J.; Goodband, R.; Weeden, T.; Blum, S. Effect of L-carnitine and soybean oil on growth performance and body composition of early-weaned pigs. J. Anim. Sci. 1996, 74, 1612−1619. (3) Urriola, P. E.; CervantesPahm, S. K.; Stein, H. H. Fiber in swine nutrition. Sustainable Swine Nutrition 2012, 255−276. (4) Lee, T. T.; Huang, Y. F.; Chiang, C. C.; Chung, T. K.; Chiou, P. W. S.; Yu, B. Starch characteristics and their influences on in vitro and pig prececal starch digestion. J. Agric. Food Chem. 2011, 59, 7353− 7359. (5) Zhou, X. L.; Kong, X. F.; Lian, G. Q.; Blachier, F.; Geng, M. M.; Yin, Y. L. Dietary supplementation with soybean oligosaccharides increases short-chain fatty acids but decreases protein-derived catabolites in the intestinal luminal content of weaned Huanjiang mini-piglets. Nutr. Res. (N. Y., NY, U. S.) 2014, 34, 780−788. (6) Bach Knudsen, K. E.; Hedemann, M. S.; Lærke, H. N. The role of carbohydrates in intestinal health of pigs. Anim. Feed Sci. Technol. 2012, 173, 41−53. (7) Yeshao, W.; Gu, J.; Peng, X.; Nairn, A. C.; Nadler, J. L. Elevated glucose activates protein synthesis in cultured cardiac myocytes. Metab., Clin. Exp. 2005, 54, 1453−60. (8) Feng, Z. M.; Li, T. J.; Wu, C. L.; Tao, L. H.; Blachier, F.; Yin, Y. L. Monosodium L-glutamate and dietary fat exert opposite effects on the proximal and distal intestinal health in growing pigs. Appl. Physiol., Nutr., Metab. 2015, 40, 353−363. (9) Noblet, J.; Le Goff, G. Effect of dietary fibre on the energy value of feeds for pigs. Anim. Feed Sci. Technol. 2001, 90, 35−52. (10) Garlick, P. J.; McNurlan, M. A. Measurement of protein synthesis in human tissues by the flooding method. Curr. Opin. Clin. Nutr. Metab. Care 1998, 1, 455−460. (11) Kimball, S. R.; Jefferson, L. S.; Nguyen, H. V.; Suryawan, A.; Bush, J. A.; Davis, T. A. Feeding stimulates protein synthesis in muscle and liver of neonatal pigs through an mTOR-dependent process. Am. J. Physiol.-Endocrinol. Metab. 2000, 279, E1080−E1087. 1563

DOI: 10.1021/acs.jafc.5b06089 J. Agric. Food Chem. 2016, 64, 1557−1564

Article

Journal of Agricultural and Food Chemistry (31) Soren, N.; Bhar, R.; Chhabra, A.; Mandal, A. Utilization of energy and protein in local Indian crossbred gilts fed diets containing different levels of rice bran. Asian-Australas. J. Anim. Sci. 2004, 17, 688−692. (32) Kil, D. Y.; Ji, F.; Stewart, L. L.; Hinson, R. B.; Beaulieu, A. D.; Allee, G. L.; Patience, J. F.; Pettigrew, J. E.; Stein, H. H. Effects of dietary soybean oil on pig growth performance, retention of protein, lipids, and energy, and the net energy of corn in diets fed to growing or finishing pigs. J. Anim. Sci. 2013, 91, 3283−3290. (33) Laplante, M.; Sabatini, D. M. mTOR signaling in growth control and disease. Cell 2012, 149, 274−293. (34) Pessin, J. E.; Saltiel, A. R. Signaling pathways in insulin action: molecular targets of insulin resistance. J. Clin. Invest. 2000, 106, 165− 169. (35) Laplante, M.; Sabatini, D. M. mTOR signaling at a glance. J. Cell Sci. 2009, 122, 3589−3594. (36) Saltiel, A. R.; Kahn, C. R. Insulin signalling and the regulation of glucose and lipid metabolism. Nature 2001, 414, 799−806. (37) Davis, T. A.; Fiorotto, M. L.; Burrin, D. G.; Vann, R. C.; Reeds, P. J.; Nguyen, H. V.; Beckett, P. R.; Bush, J. A. Acute IGF-1 infusion stimulates protein synthesis in skeletal muscle and other tissues of neonatal pigs. Am. J. Physiol-Endoc. M. 2002, 283, E638−E647. (38) Jeyapalan, A. S.; Orellana, R. A.; Suryawan, A.; O’Connor, P. M.; Nguyen, H. V.; Escobar, J.; Frank, J. W.; Davis, T. A. Glucose stimulates protein synthesis in skeletal muscle of neonatal pigs through an AMPK-and mTOR-independent process. Am. J.Physiol-Endoc. M. 2007, 293, E595−E603. (39) Nave, B.; Ouwens, M.; Withers, D.; Alessi, D.; Shepherd, P. Mammalian target of Rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation. Biochem. J. 1999, 344, 427−431. (40) Lynch, C. J.; Hutson, S. M.; Patson, B. J.; Vaval, A.; Vary, T. C. Tissue-specific effects of chronic dietary leucine and norleucine supplementation on protein synthesis in rats. Am. J. Physiol-Endoc. M. 2002, 283, E824−E835. (41) Fumagalli, S.; Thomas, G. S6 phosphorylation and signal transduction. Cold Spring Harbor Monograph Series 2000, 39, 695−718. (42) Wheatley, S.; El-Kadi, S.; Suryawan, A.; Boutry, C.; Orellana, R.; Nguyen, H.; Davis, S.; Davis, T. Protein synthesis in skeletal muscle of neonatal pigs is enhanced by administration of β-hydroxy-βmethylbutyrate. Am. J. Physiol-Endoc. M. 2014, 306, E91−E99. (43) Kimura, N.; Tokunaga, C.; Dalal, S.; Richardson, C.; Yoshino, K. i.; Hara, K.; Kemp, B. E.; Witters, L. A.; Mimura, O.; Yonezawa, K. A possible linkage between AMP-activated protein kinase (AMPK) and mammalian target of Rapamycin (mTOR) signalling pathway. Genes Cells 2003, 8, 65−79. (44) Timmerman, K. L.; Lee, J. L.; Dreyer, H. C.; Dhanani, S.; Glynn, E. L.; Fry, C. S.; Drummond, M. J.; Sheffield-Moore, M.; Rasmussen, B. B.; Volpi, E. Insulin stimulates human skeletal muscle protein synthesis via an indirect mechanism involving endothelial-dependent vasodilation and mammalian target of Rapamycin complex 1 signaling. J. Clin. Endocrinol. Metab. 2010, 95, 3848−3857. (45) Oliver, W.; Miles, J. A low-fat liquid diet increases protein accretion and alters cellular signaling for protein synthesis in 10-dayold pigs. J. Anim. Sci. 2010, 88, 2576−2584. (46) Manning, B. D.; Cantley, L. C. AKT/PKB signaling: navigating downstream. Cell 2007, 129, 1261−1274. (47) Egerman, M. A.; Glass, D. J. Signaling pathways controlling skeletal muscle mass. Crit. Rev. Biochem. Mol. Biol. 2014, 49, 59−68. (48) Kousteni, S. FoxO1, the transcriptional chief of staff of energy metabolism. Bone 2012, 50, 437−443. (49) Xu, J.; Ji, J.; Yan, X. H. Cross-talk between AMPK and mTOR in regulating energy balance. Crit. Rev. Food Sci. Nutr. 2012, 52, 373−381.

1564

DOI: 10.1021/acs.jafc.5b06089 J. Agric. Food Chem. 2016, 64, 1557−1564