Tethered PEG Crowdedness Determining Shape and Blood

Aug 5, 2013 - Japan Science and Technology Agency, PRESTO, 4-1-8 Honcho, ... t.u-tokyo.ac.jp, (K.O) osada@bmw. ... by poly(ethylene glycol) (PEG) onto...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/Macromolecules

Tethered PEG Crowdedness Determining Shape and Blood Circulation Profile of Polyplex Micelle Gene Carriers Theofilus A. Tockary,† Kensuke Osada,‡,⊥,* Qixian Chen,† Kaori Machitani,† Anjaneyulu Dirisala,‡ Satoshi Uchida,§ Takahiro Nomoto,‡ Kazuko Toh,§ Yu Matsumoto,§ Keiji Itaka,§ Koji Nitta,∥ Kuniaki Nagayama,∥ and Kazunori Kataoka†,‡,§,* †

Department of Materials Engineering and ‡Department of Bioengineering, Graduate School of Engineering, and §Division of Clinical Biotechnology, Center for Disease Biology and Integrative Medicine, Graduate School of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyoku, Tokyo 113-8656, Japan ⊥ Japan Science and Technology Agency, PRESTO, 4-1-8 Honcho, Kawaguchi, Saitama 332-0012, Japan ∥ Okazaki Institute for Integrative Bioscience, National Institutes of Natural Sciences, 5-1 Higashiyama, Myodaijicho, Okazaki, Aichi 444-8787, Japan S Supporting Information *

ABSTRACT: Surface modification by poly(ethylene glycol) (PEG) onto gene carrier prepared through the electrostatic assembly of pDNA and polycation (polyplex) is a widely acknowledged strategy to advance their systemic application. In this regard, PEG crowdedness on the polyplex surface should give important contribution in determining blood circulation property; however its accurate quantification has never been demonstrated. We report here the first successful determination of PEG crowdedness for PEGylated polyplexes (polyplex micelle) formed from PEG−poly(L-lysine) block copolymers (PEG−PLys) and plasmid DNA (pDNA). Tethered PEG chains were found to adopt mushroom and even squeezed conformation by modulating PEG crowdedness through PLys segment length. Energetic analysis was conducted on the polyplex micelle to elucidate effect of PEG crowdedness on shape and clarify its essential role in regulating packaging structure of pDNA within the polyplex micelle. Furthermore, the PEG crowdedness significantly correlated to blood retention profile, approving its critical role on both shape and systemic circulation property.

■

decreases by either the decrease of PEG fraction,12 or by the increase in the polymerization degree (DP) of polycation segment of block copolymer,13 both of which coincide with decrease in the number of tethered PEG on the core. Despite these critical roles of the PEG crowdedness in the polyplex micelle, numerical value of PEG density (σ) as well as the information about tethered PEG conformation, according to our best knowledge, has not been identified. This is because the two requirements for σ calculation have been missing, namely the surface area of the core for PEG tethering and number of tethered PEG chains. To this point, we have revealed detailed packaging structure of pDNA in the recent study for rodshaped polyplex micelles based on PEG−poly(L-lysine) block copolymer (PEG−PLys),14 which offered the necessary geometrical information to calculate the core surface area and ultimately σ. Briefly, single pDNA molecule is packaged within a polyplex micelle core into rod structure through highly

INTRODUCTION Surface modification by poly(ethylene glycol) (PEG) is acknowledged as a powerful strategy to fabricate biocompatible materials, with characteristic feature of PEG to minimize adverse biointerfacial interaction.1,2 This strategy brought forth remarkable success in development of nanotechnology-based drug delivery system, where PEG layer provides not only colloidal stability but also stealthiness in biological milieu.3−6 Taking this advanced approach, we have developed PEGmodified gene delivery system, namely polyplex micelles,7,8 prepared from polyion complexation between PEG−polycation block copolymers and plasmid DNA (pDNA), as potential delivery system for systemic application.9,10 Herein, characteristic of tethered PEG, more specifically PEG crowdedness, on the polyplex micelle should play a crucial role as a critical parameter affecting circulation profile in bloodstream, because it determines the extent of interaction with serum proteins in the blood.1,11 Furthermore, our recent findings imply another important aspect of the tethered PEG crowdedness in determining the packaging structure of pDNA within the core of polyplex micelles, from the observation that their size © XXXX American Chemical Society

Received: May 25, 2013 Revised: July 19, 2013

A

dx.doi.org/10.1021/ma401093z | Macromolecules XXXX, XXX, XXX−XXX

Macromolecules

Article

with ZPC TEM phase plate. All observations were performed at a magnification of 25 000 with a CCD camera. Determination of Binding Number of PEG−PLys to pDNA by Ultracentrifuge. Polyplex micelle solution prepared from alexa-labeled PEG−PLys, placed in thick wall polycarbonate tube 343776 (Beckman Coulter, Inc., Fullerton, CA), and was rotated at 50,000 g using ultracentrifuge (Optima TLX, Beckman Coulter, Inc., Fullerton, CA, USA) equipped with TLA-120.1 rotor for 3 h in order to completely separate free PEG−PLys from binding PEG−PLys to pDNA. At this condition, polyplex micelles were confirmed by analytical ultracentrifuge (Beckman XL-I ultracentrifuge, Beckman Coulter, Inc., Fullerton, CA, USA) to be completely sedimented,15 while leaving free PEG−PLys at the upper solution. The fluorescence of the upper solution was then measured at 702 nm, which is the maximum emission peak of Alexa Fluor 680. The value was converted to concentration using a standard curve of free PEG−PLys. Monitoring of the Retention of Polyplex Micelles in Blood Circulation Using Intravital Real-Time Confocal Laser Scanning Microscopy (IVRTCLSM). The retention of polyplex micelles in blood circulation was evaluated using IVRTCLSM in live mice.18 All picture/ movie acquisitions were performed using a Nikon A1R confocal laser scanning microscope system attached to an upright ECLIPSE FN1 (Nikon Corp., Tokyo, Japan) equipped with a 20× objective, 640 nm diode laser, and a band-pass emission filter of 700/75 nm. The pinhole diameter was set to result in a 10 μm optical slice. In detail, 8-week-old female BALB/c mice (Charles River Laboratories, Yokohama, Japan) were anesthetized with 2.0−3.0% isofurane (Abbott Japan Co., Ltd., Tokyo, Japan) using a Univenter 400 Anaesthesia Unit (Univentor Ltd., Zejtun, Malta). Mice were then subjected to lateral tail vein catheterization with a 30-gauge needle (Becton, Dickinson and Co, Franklin Lakes, NJ) connected to a nontoxic medical grade polyethylene tube (Natsume Seisakusho Co., Ltd., Tokyo, Japan). Anesthetized mice were placed onto a temperature-controlled pad (Thermoplate; Tokai Hit Co., Ltd., Shizuoka, Japan) integrated into the microscope stage and maintained in a sedated state throughout the measurement. After that, polyplex micelles prepared from Cy5-labeled pDNA were injected (volume =200 μL, pDNA concentration =100 ng/μL) via the tail vein 10 s after the start of video capture. Ear lobe dermis was observed without surgery and was fixed beneath a coverslip with a single drop of immersion oil. Data was acquired in video mode at snapshots every 5 min. The experiment was performed 4 times for each sample in separate animals. Video data was analyzed by selecting regions of interest (ROIs) within blood vessels or extravascular skin tissue. First, the background fluorescence intensity was determined from video captured during the 10 s before sample injection, and then the average fluorescence intensity per pixel for each time point was determined using the Nikon NIS-Elements C software provided by the manufacturer. The background value was then subtracted from the average pixel intensities measured after micelle injection to create background-corrected intensities for each time point. The circulation of polyplex micelles was monitored by following the fluorescence intensity from the vein subtracted by the fluorescence from the tissue background. All animal experimental procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals as stated by the guidelines of The University of Tokyo. Blood Circulation of Polyplex Micelles Evaluated by Real-Time Quantitative PCR (RT-PCR). The retention of polyplex micelles in blood circulation was evaluated by RT-PCR. In detail, polyplex micelles from pCAG-Luc2 (volume =200 μL, pDNA concentration = 33.3 ng/μL) were injected from tail vein of female 8-week-old Balb/c mice (Charles River Laboratories, Yokohama, Japan), and blood was collected from the heart 3 min after the injection, followed by the extraction of DNA using DNeasy blood and tissue extraction kit (Qiagen, Hilden, Germany). The extracted DNA encoding luciferase was then quantified by RT-PCR, using an ABI Prism 7500 Sequence Detector (Applied Biosystems, Foster City, CA, USA), and a primer pair (forward: GGCTGGCAGAAGCTATGAAG, and reverse: CAAGCTATTCTCGCTGCACA). The 100% values were determined for each sample by performing RT-PCR using the blood sample containing 3.0 ng/μL of pDNA, based on the assumption that the

regulated folding fashion, with the rod length (ln) at DNA folding number n being quantized to multiples of 1/(2(n + 1)) of the pDNA contour length. Moreover, the number of tethered PEG chains on single pDNA can be determined using ultracentrifuge analysis,15 thereby fulfilling the requirements to estimate σ. These findings brought us to the present study to calculate σ for the first time for the polyplex micelles prepared from a series of PEG−PLys of varying PLys DP,13 clarifying major role of σ on polyplex micelle shape, in terms of energetic contribution of the tethered PEG chains, as well as on blood circulation property.

■

MATERIALS AND METHODS

Materials. A series of PEG−PLys block copolymers with PEG Mn 12K (Mw/Mn = 1.02) and different PLys DP was synthesized as previously reported.13 PLys DP was determined to be 19, 39, and 70 by comparing 1H NMR integration ratios between methylene protons of PEG chain (CH2CH2O) and methylene protons of lysine unit ((CH2)3CH2NH3). All polymers had molecular weight distribution Mw/Mn < 1.05 from gel permeation chromatography (GPC) evaluation using TOSOH HLC-8220. Alexa-labeled PEG−PLys for determination of the number of binding PEG−PLys to pDNA was prepared by reacting PEG−PLys with Alexa Fluor 680 carboxylic acid succinimidyl ester according to manufacturer’s instruction. Removal of unreacted labels was carried out using PD-10 desalting column (GE Healthcare Life Sciences, U.K.). Successful labeling of PEG−PLys was confirmed using GPC with UV, IR, and fluorescence detector. Alexa labeling efficiency was determined to be approximately 1 alexa label per 40 PLys DP for all PEG−PLys block copolymers. Plasmid DNA pBR322 (base pair (bp) 4361) was commercially obtained (Takara Shuzo Co., Ltd., Japan), while pCAG-Luc2 was obtained by amplification in Escherichia coli, extracted and purified using NucleoBond Xtra Maxi Plus Endotoxin Free kit (Qiagen Science Co., Inc., Germany). pCAG-Luc2 was labeled with Cy5 using Label IT Tracker Nucleic Acid Localization Kits (Mirus Bio Co., USA), and used for blood circulation study. Methods. Preparation of Polyplex Micelles. Polyplex micelles were prepared by fast mixing of PEG−PLys solution into pDNA solution at N/P ratio 2 (residual molar ratio between amines of the PLys segment (N), and phosphates of the pDNA (P)) in HEPES buffer 10 mM pH 7.3 (Invitrogen Co., USA) (final pDNA concentration: 33.3 ng/μL for in vitro assay, and 100 ng/μL for in vivo assay). Transmission Electron Microscopy (TEM) Observation. TEM observation was conducted using a H-7000 electron microscope (Hitachi, Tokyo, Japan) operated at 75 kV acceleration voltage. The samples were prepared by adding equivolume of uranyl acetate solution (2% (w/v)) into polyplex micelles solution. Carbon-coated 400 mesh copper grid (Nisshin EM, Japan), which was previously glow-discharged using an Eiko IB-3 ion coater (Eiko Engineering Co. Ltd., Japan), was then dipped into each mixture for 30 s, and then allowed to dry on a piece of filter paper. Rod length distributions of the folded pDNA within the polyplex micelles were obtained by measuring long axis of the rods from the TEM images using ImageJ software (available online at http://rsb.info.nih.gov/ij/download. html). Zernike Phase Contrast (ZPC) Cryo-TEM Observation. ZPC cryoTEM was carried out according to procedure reported elsewhere.16,17 Briefly, a drop of the sample was placed onto a copper microgrid, which had 1−5 μm holes in it. Most of the liquid was removed with blotting paper, leaving a thin film stretched over the holes. The specimen was instantly shock-frozen by plunging into liquid ethane, which was cooled to 90 K by liquid nitrogen into a temperaturecontrolled freezing unit (Zeiss, Oberkochen, Germany). The remaining ethane was removed with blotting paper, and the specimen was transferred to the electron microscope (JEOL 2200FS, Japan) B

dx.doi.org/10.1021/ma401093z | Macromolecules XXXX, XXX, XXX−XXX

Macromolecules

Article

blood volume in the mice is 2 mL, and pDNA solution is diluted 11 times after i.v. injection. All animal protocols were conducted with the approval of the Animal Care and Use Committee, University of Tokyo, Japan.

Table 1. Dimension of Rod-Shaped Polyplex Micelles Composed of Folded DNA as a Bundle

■

RESULTS AND DISCUSSION PEG density (σ) was evaluated for polyplex micelles prepared by mixing PEG−PLys of PLys DP 19, 39, or 70 (PEG Mn was fixed at 12K) into pDNA solution at N/P 2. Core surface area, which is one of the two requirements to calculate σ, was estimated based on the quantized folding of pDNA (Scheme 1), which determines the length14 and cross section of rod Scheme 1. Geometrical Dimension of Rod-Shaped Polyplex Micellea

folding number n

no. of folded DNA segment in a bundle

lengtha (nm) ln

perimeterb (nm) 2πrn

surface areac (nm2) An

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32

730 365 243 183 146 122 104 91.3 81.1 73.0 66.4 60.8 56.2 52.1 48.7 45.6

15.6 21.7 27.0 30.8 33.9 36.9 40.0 43.0 45.2 48.3 50.5 52.1 54.3 56.4 58.2 60.4

11 440 7974 6617 5707 5036 4597 4296 4071 3832 3708 3553 3383 3290 3201 3103 3044

a Determined according to the quantized folding scheme. bShortest distance made by a tightly tied string around the folded rods (Figure S1). cCalculated from eq 1.

As a unimodal distribution of n was not obtained for the samples of polyplex micelles, number-average surface area ⟨A⟩ was used, and was obtained by considering the frequency of n ( f n) using the following equation: ⟨A⟩ =

a

DNA is packaged by n-times folding in core of the polyplex micelle as a bundle with length of ln and radius of rn (see Supporting Information, Figure S1).

× A n)

(2)

where empirical f n were determined from rod length distribution measured from TEM images (Figure 1, parts a and b). When assigning polyplex micelles to a certain n, it is

polyplex micelles. In this folding scheme, pDNA is folded into rod shape of n-times folding within the polyplex micelle. As a result, rod lengths are regulated into multiples of 1/(2(n + 1)) of pDNA contour length, while the orthogonal cross section is a bundle of 2(n+1) number of double-stranded DNA (see Supporting Information (Figure S1)). Following this scheme, the unfolded rod of pDNA (pBR322, 4361 bp) (termed as standard rod)14 was obtained by simply collapsing pDNA circularity into a rod with length of half the pDNA contour length (1/2 × 4361 bp ×0.338 (nm/bp) = 737 nm), and then considering the shortening of the rod caused by the inherent superhelicity of the pDNA so that the length of the standard rod was estimated to be 730 nm (l0). Thus, rod lengths with n times folding are 730 nm (n = 0), 365 nm (n = 1), 243.3 nm (n = 2), 182.5 nm (n = 3), 146 nm (n = 4), 121.7 nm (n = 5), 104.3 nm (n = 6), and so on (Table 1). For simplicity, the rods at every folding number n were treated as cylinders with length of ln and a radius of rn (Scheme 1). The series of rn (Table 1) were obtained from peripheral length of the bundled folded DNA19 (as the shortest distance formed by a tight string around the bundle) (Figure S1) divided by 2π, with DNA interhelical spacing being 3.04 nm according to small-angle Xray scattering (SAXS) measurement for PLys/DNA complexes.20 Thereafter, core surface area of the folded pDNA at folding number n (An) (Table 1) was given by the surface of the cylinder side plus the area of both of its ends, A n = [ln × 2πrn]+2[πrn 2]

∑ (fn

Figure 1. Packaging structure of pDNA within polyplex micelles of PLys 19, 39, and 70. (a) Representative TEM images. (b) Rod length distribution by measuring long axis. Vertical lines in part b represent the theoretical length (ln) obtained from quantized folding scheme.

(1) C

dx.doi.org/10.1021/ma401093z | Macromolecules XXXX, XXX, XXX−XXX

Macromolecules

Article

the number of tethered PEG chains was determined (Table 3) using the following equation:

important to note that the rod length is 83.7% of the actual length when observed by TEM on grid of collodion membrane with uranyl acetate staining.21 On this note, rod lengths from the TEM observation should be distributed at 611 nm (n = 0), 305 nm (n = 1), 204 nm (n = 2), 152 nm (n = 3), 122 nm (n = 4), 102 nm (n = 5), 87 (n = 6), 76 nm (n = 7), and so on. All samples satisfied this distribution with polyplex micelles from shorter PLys DP forming the longer rods, and vice versa. The rods from each sample were then grouped into each folding number n according to its proximity to a theoretical length. Accordingly, ⟨A⟩ was estimated for polyplex micelles of PLys 19, 39, and 70 (Table 2). Note that we have previously

number of tethered PEG chains per pDNA = (fed number of PEG − PLys − number of unbound PEG‐PLys to pDNA) /number of pDNA

Table 3. Physical Description of PEG Shell of Polyplex Micelles

Table 2. Population of Folding Number n within Polyplex Micelles of PLys 19, 39, and 70, Average Rod Length, and Average Surface Area

binding number of PEGa binding N/P ⟨σ⟩ (chains/nm2) πRg2⟨σ⟩ ⟨L⟩/2Rg PEG height ⟨H⟩ (nm)b monomer volume fraction Φf (%) osmotic pressure Π (105 dyn/cm2)

population (%)

a b

folding number (n)

PLys 19 (counts: 97)

PLys 39 (counts: 196)

PLys 70 (counts: 121)

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 av rod lengtha (nm) av surface areab (nm2)

0 8.2 29.9 27.8 15.5 14.4 4.1 0 0 0 0 0 0 0 0 0 162.3 5844

0 2 5.6 28.1 23 15.3 9.7 7.1 5.6 1.5 0.5 1.5 0 0 0 0 120.1 5045

0 0.8 3.3 8.3 17.4 14.9 9.1 5.8 11.6 10.7 3.3 5.8 5.8 0 2.5 0.8 69.4 4388

(3)

PLys 19

PLys 39

PLys 70

436 ± 31.2 0.95 0.075 5.2 0.39 12.4 ± 1.6 3.1

258 ± 10.4 1.15 0.051 3.5 0.47 10.9 ± 1.8 3.0

168 ± 2.5 1.35 0.038 2.6 0.55 9.6 ± 2.0 3.1

1.1

1.1

1.1

a

Determined by ultracentrifuge analysis. bDetermined from ZPC cryoTEM images.

Finally, number-average PEG tethering density ⟨σ⟩ was determined for the polyplex micelles in terms of number of PEG chains in unit area (chains/nm2) (Table 3). We found higher ⟨σ⟩ settles on polyplex micelles of shorter PLys DP. Then, ⟨σ⟩ was converted to reduced tethering density πRg2⟨σ⟩, defined as the number of chains that occupies an area covered by an isolated polymer chain (πRg2), because it is often used to obtain physical insight on PEG crowdedness and conformation.22 The πRg2⟨σ⟩ was calculated by noting that Rg (=0.181 × (Mn of PEG/44.06)0.58 (in nm))11,23 for PEG in water is 4.7 nm for Mn 12K, and thus πRg2 is 69 nm2 (Table 3). Tethered PEG can be assigned into 4 possible conformations from these πRg2⟨σ⟩ values (Scheme 2): (1) isolated mushroom24,25 (πRg2σ ≤ 1), (2) overlapping mushroom (3) squeezed, and (4) scalable brush regime, characterized by tethered PEG height (H) scaling as σ1/3. The boundary between overlapping mushroom and squeezed conformation was reported to be approximately πRg2σ = 3,22,26 and boundary between squeezed and scalable brush conformation to be at least above 6 (Scheme 2), although these numerical values were not determined directly for PEG in water. Nevertheless, referring these obtained πRg2⟨σ⟩ values with the boundaries, it is quite likely that the PEG on polyplex micelles of PLys 70 (πRg2⟨σ⟩ = 2.6) are overlapping mushrooms, while PEG on polyplex micelles of PLys 19 (πRg2⟨σ⟩ = 5.2) and 39 (πRg2⟨σ⟩ = 3.5) are squeezed. This prediction of PEG conformation was confirmed by interesting images from Zernike phase contrast (ZPC) cryoTEM16,17 observed at locally concentrated region of the polyplex micelles sample, that may provide direct information on H for comparison to the theoretical H of PEG mushroom, which is 2Rg (9.4 nm for PEG with Mn 12K). These ZPC cryoTEM images showed polyplex micelles were stacked in a periodic alignment (Figure 2). As DNA was selectively seen while PEG was invisible due to low electron density on the ZPC cryo-TEM images, it is reasonable to assume the space between DNA (dark lines) was filled by the tethered PEG

Obtained by considering population of folding number ( f n). Obtained from eq 2.

reported the morphology of polyplex micelles of PLys 70 as unregulated structure or collapse structure based on AFM observation as they were found as globular shape; however, TEM images revealed that short rod-shaped structures were indeed included (Figure 1a). It should be noted that TEM images revealed only the DNA core itself, and not the PEG palisade due to lower affinity of uranyl acetate to PEG, while AFM images may probe the PEG palisade of the polyplex micelles to some extent so that it looked somewhat round in shape. In this work, the polyplex micelles of PLys 70 were treated as rod structure as the structure that is apparently depicted as rods were found to be more than half among all complexes. Number of tethered PEG chains in a polyplex micelle is the second of the two requirements to determine σ. This was obtained from ultracentrifuge analysis as previously reported.15 In brief, polyplex micelle solution was prepared from Alexa 680labeled PEG−PLys. The polyplex micelles were then centrifuged to sediment pDNA-bound PEG−PLys, leaving only free PEG−PLys in the solution. Using a standard curve to convert relative fluorescence unit into polymer concentration, D

dx.doi.org/10.1021/ma401093z | Macromolecules XXXX, XXX, XXX−XXX

Macromolecules

Article

Scheme 2. PEG Height as a Function of πRg2σ Obtained from Direct Observation from ZPC Cryo-TEM and Theoretical Height Assuming Scalable Brusha

confirm that PEG for polyplex micelles of PLys 19 and PLys 39 were not in the scalable brush regime but really in squeezed conformation, the empirically measured ⟨H⟩ was compared against the theoretical H for brush on cylindrical surface27 (Hbrush ∼ 0.181(PEG Mn/44.06)3/4σ1/4(rn/0.181)1/4), which gave 14.4 nm for PLys 19, 13.5 nm for PLys 39, and 12.9 nm for PLys 70. As the empirically obtained ⟨H⟩ from ZPC cryoTEM for both PLys 19 and PLys 39 was lower than these theoretical value of Hbrush, it indicates that the tethered PEG for PLys 19 and PLys 39 were indeed in the squeezed regime, concurrently proving reasonability of our ⟨σ⟩ estimation. The obtained σ and tethered PEG conformation may provide explanation on dependence of pDNA packaging shape within polyplex micelles upon changing of PLys DP (Figure 1). Although we have previously reported that rods become longer with decreasing PLys DP,13 or equivalently with increasing of tethered PEG chain number as PEG−PLys associates with pDNA through electrostatic interaction, an explanation for this has not been provided. Here, we have revealed that polyplex micelles of lower PLys DP had higher ⟨σ⟩. This is simply understood by noting that lower PLys DP resulted the polyplex micelle to have more tethered PEG chains as seen in Table 3, which is reasonable because the self-assembly process is mainly driven by electrostatic interaction. However, as the number of tethered PEG increases, number-average surface area ⟨A⟩, which is the other key parameter for ⟨σ⟩, also increases (Table 2) by the increase of rod length (Figure 1b). To this point, there must be intricate correlation between rod length and σ. Principally, DNA condensation, which is the essence of pDNA packaging, is driven by the need to minimize surface energy (Esurface) by reducing contact area between the condensed pDNA and water molecules because the unfavorable Esurface develops by the loss of DNA charges upon polyion complexation.28 Thus, from the standpoint of the Esurface, shorter rod is more favorable as the surface area decreases with increased folding times n as presented in Table 1. On the other hand, decrease in surface area reduces PEG available space and induce PEG crowding; thus shorter rod is unfavorable for tethered PEG. Eventually, it is reasonable to assume that the Esurface and PEG crowdedness control the polyplex micelle structure, i.e. PEG crowdedness compensate the cost of Esurface. Accordingly, it was expected that long rod retains higher PEG crowdedness and vice versa, which is consistent to the trend of average rod length obtained by considering the frequency of polyplex micelles at each folding number and ⟨σ⟩ of the polyplex micelles against PLys DP (Table 2). To understand how PEG crowdedness sustained high Esurface cost of the long rods, PEG osmotic pressure Π should be principally considered because increasing PEG content into a restricted volume causes an outward expansion force. The Π for PEG Mn above 1.5K was given as a function of monomer volume fraction (Φf),

The PEG conformation associated with πRg2σ proposed by ref 22 is also shown in the scheme: isolated mushroom (a), overlapping mushroom (b), squeezed (c), and scalable brush (d). a

Figure 2. ZPC cryo-TEM of polyplex micelles of PLys 19, 39, and 70 observed at locally condensed region. (a) Representative images. (b) Width distribution between parallel adjacent rods.

chains. Hence, by measuring for average width of the spaces (⟨W⟩) between two parallel dark lines, and dividing ⟨W⟩ by 2, we obtained the number-average PEG height (⟨H⟩) (Table 3). Consistent to the prediction from πRg2⟨σ⟩, ⟨H⟩ for PLys 70 was 9.6 ± 2.0 nm, which numerically agrees with the height of PEG in mushroom conformation (9.4 nm). On the contrary, ⟨H⟩ for polyplex micelles of PLys 19 (⟨H⟩ = 12.4 ± 1.6 nm), and PLys 39 (⟨H⟩ = 10.9 ± 1.8 nm) exhibited higher values than mushroom height, suggesting that these PEG chains were in squeezed conformation. Thus, ⟨H⟩ was reasonably measured from the ZPC cryo-TEM images because it fitted well with the predicted conformation from the πRg2⟨σ⟩ values. In order to

log Π = 1.57 + 2.75(ρPEG monomer Φf )0.21

(4)

29

Φf = (number of tethered PEG per DNA × M n of PEG/ρPEG monomer NA)/⟨Vocc , PEG⟩

(5,)

where number-average occupied volume by PEG, ⟨Vocc,PEG⟩ E

dx.doi.org/10.1021/ma401093z | Macromolecules XXXX, XXX, XXX−XXX

Macromolecules

Article

S2), implying that possible scheme of clearance from blood circulation might be primarily due to the recognition by reticuloendothelium systems (RES), initiated by adsorption of particular proteins called opsonins present in blood,32 as this is the major blood clearance mode.33 In this aspect, PEG modulation to crowdedness inhibiting protein adsorption is key issue to prolong the circulation period. Regarding this, inhibition of protein adsorption onto a PEG modified surface had been examined using serum,11 where the PEG crowdedness was discussed based on density parameter L/2Rg, which is the ratio of closest distance between two neighboring polymer tethering sites located in a square lattice (L) to 2Rg.34 It was reported that inhibition of protein adsorption started when PEG chains enter overlapping mushroom region at L/2Rg = 1, and maximized when PEG chains are already above squeezed upward region at L/2Rg < 0.47.11 Converting the values of PEG crowdedness of each polyplex micelles into ⟨L⟩/2Rg (Table 3) using

=∑ (fn × (Vtotal , n − Vcore , n)) =∑ (fn × (([ln × π (rn + ⟨H ⟩)2 ] + [4/3π (rn + ⟨H ⟩)3 ]) − ([ln × π(rn)2 ]))) (6)

Interestingly, Π was found to be the same for all polyplex micelles (Table 3). This suggested that there may be a critical Φf of tethered PEG crowdedness, and it has already been reached to that level for all polyplex micelles, including for PLys 70. Above this critical point, the tethered chains may select upward growth rather than maintaining overcrowded mushroom conformation,30 as this was evidenced from the H measurement from the ZPC cryo-TEM images (Figure 2). Eventually, the final Φf was the same, which resulted in the same Π value. This shows that while Esurface increased with decrease of PLys DP, the PEG contribution from Π (ΠdVocc,PEG) to free energy to sustain long rods remained constant for all PLys DP. To this point, there must be another PEG contribution to compensate the high Esurface, most probably in entropic terms, because the squeezing of PEG chains unfavorably decreases conformational entropy (Sconf,PEG), as was the case for polyplex micelles of PLys 19 and PLys 39. These squeezed chains have the tendency to revert back to original mushroom conformation, which gives rise to entropic elasticity in lateral direction (T dSconf,PEG). Note that entropic elasticity actually already exists even in mushroom conformation, but it increases with increasing PEG crowdedness, and becomes particularly significant when chains are forced to squeeze. This combination of increasing entropic contribution (TdSconf,PEG) and osmotic pressure work (ΠdVocc,PEG) will act as a counterbalance to the Esurface. Furthermore, rigidity of the folded DNA bundle also counteract against compaction in the form of deformation energy (Gl dl), with G as the modulus of rigidity. Accordingly, rod structure could be analytically described by considering the balance between free energy for anticompaction from PEG (dFanti‑compaction, PEG = Π(dVocc,PEG) − T(dSconf,PEG)) and the free energy for DNA compaction (dFcompaction, DNA = Gl dl − dEsurface)). From a functional viewpoint, the demonstrated quantitative PEG crowdedness investigation opened the possibility to clarify correlation between PEG modification and blood circulation property of the polyplex micelles. Before proceeding to this study, it is worth to note that polyplex micelles were essentially formed by charge neutralization, although accurate binding number of polymer chains (Table 3) did not exactly correspond to N/P = 1 for the polyplex micelles. In this regard, it was suspected that net charge of polyplex cores might be slightly different, and could potentially influence blood circulation profile. However, the ζ-potential for all polyplex micelles was close to neutral (see Supporting Information) because of PEG shielding, and therefore the small difference in core composition was unlikely to give critical consequences on circulation time. As another prerequisite to this study, we also needed to confirm that polyplex micelles are stable enough and do not dissociate in the blood solution. Thus, stability of polyplex micelles in serum was examined by evaluating protectivity of pDNA against nucleases using real-time PCR (RT-PCR) because it had been reported that polyplex micelle provides increased resistance of its pDNA cargo against nucleases,31 so that decrease in protection against nucleases is an indication of polyplex micelle dissociation. Following the evaluation, polyplex micelles were found to be stable (Figure

⟨L⟩ 1 1 = 2R g 2R g √⟨σ ⟩

(7)

better blood circulation was expected for polyplex micelles of PLys 19 and 39, while limited circulation for polyplex micelles of PLys 70. To verify this, blood circulation of the polyplex micelles was examined using intravital real time confocal scanning microscopy (IVRTCLSM),18 which allows in situ monitoring of fluorescence labeled carriers. Polyplex micelles prepared with Cy5 labeled pDNA were injected into mouse-tail vein, and observed at the ear lobe, where the extent of quenching of Cy5 in each sample of polyplex micelles were comparable (see Supporting Information, Figure S3); thus blood circulation profile for each polyplex micelle was directly compared by monitoring Cy5 fluorescence intensity. Apparently, polyplex micelles of lower PLys DP showed better retention in blood circulation than that of higher PLys DP (Figure 3a), validating the above prediction from the PEG crowdedness. Noteworthy, fluorescence intensity of PLys 70 exhibited appreciably lower than others from the initial stage. This suggests that substantial fraction of the polyplex micelles had already been removed from the blood at the early stage. Possibly, this might be due to the above-mentioned RESmediated clearance from the blood compartment, because polyplex micelles of PLys 70 with mushroom PEG were the most susceptible, among the three samples, to protein adsorption, resulting in opsonization and finally removal by RES, while polyplex micelles of shorter PLys DP with squeezed PEG conformation might experience less opsonization. To clarify the retention amount out of injected polyplex micelles at the early stage, blood circulation was further examined using real time PCR (RT-PCR) to quantify the circulating DNA for PLys 19 and 70, as representative of squeezed and mushroom conformation, respectively, by collecting blood at 3 min after injection into the tail vein. Apparently, polyplex micelles of PLys 70 were less retained in the blood compartment than polyplex micelles of PLys 19 (Figure 3b), as is consistent with the IVRTCLSM result, and concurrently supporting that substantial amount of PLys 70 had been eliminated at the early stage. Nevertheless, the profile showed that there were some polyplex micelles still circulating with showing similar decay profile to other polyplex micelles (Figure 3a). This suggested that there may be also certain fractions of polyplex micelles of PLys 70 that were less susceptible for the rapid F

dx.doi.org/10.1021/ma401093z | Macromolecules XXXX, XXX, XXX−XXX

Macromolecules

Article

sulfate,35 a strong polyanion, exists abundantly in the glomerular basement membrane (GBM),36 which can cause complex dissociation. As kidney is characterized by glomerulus capillaries under high pressure, polyplex micelles passing through this organ experience substantial shear stress against heparan sulfate, which may cause destabilization of polyplex micelles, eventually resulting high susceptibility to nuclease attack. Furthermore, the destabilized polyplex micelles will become more susceptible for RES capture. In regards to preventing the possible dissociation of polyplex micelles at the kidney, crowded PEG such as squeezed conformation can still be useful because it may also function as a barrier to avoid polyanion contact with the polyion complex core so that the polyplex micelles are prevented from destabilization, although apparently the crowdedness of the squeezed conformation may not be enough to totally avoid this destabilization. Nevertheless, in all these possible clearance scenarios from the blood, designing a crowded PEG shell is beneficial to prolong blood circulation of electrostatically assembled gene carriers. To manage these issues, adopting a strategy, which allows further PEG crowding based on the above-mentioned governing principle of polyplex micelle structure until possibly even brush conformation, together with an effort to avoid the destabilization of the electrostatically formed assembly will be promising to prolong the circulation of polyplex micelles aiming for systemic application of gene therapy.

■

CONCLUSIONS PEG density for pDNA polyplex micelles has been successfully estimated for the first time based on the quantized folding scheme of pDNA within rod-shaped polyplex micelle, opening a comprehensive understanding on the effect of σ on shape and retention time in blood circulation. σ increased with decreasing PLys DP, driving PEG conformation from overlapping mushroom for PLys DP 70 to upward squeezed conformation for PLys DP 39 and 19. The PEG crowdedness analysis suggested that PEG steric repulsion works as counterpart to DNA condensation and their energetic balances played major role in determining the shape. Furthermore, the PEG crowdedness had a deep correlation with blood circulation profile, and better retention time in blood circulation was obtained for the polyplex micelles with PEG of squeezed conformation. Therefore, regulating PEG crowdedness into squeezed or possibly brush region will provide essential contribution to fabricate gene carriers for systemic use, where the demonstrated study on factors to determine polyplex micelle structure will provide the critical principles in designing gene carriers.

Figure 3. Blood circulation for polyplex micelles (a) Blood circulation profile of polyplex micelles prepared by Cy5-labeled pDNA, observed by IVRTCLSM on the ear of mice (all three curves have p value