Tetrahedral DNA Nanostructure-Delivered DNAzyme for Gene

Subscriber access provided by Iowa State University | Library

Biological and Medical Applications of Materials and Interfaces

Tetrahedral DNA Nanostructure-delivered DNAzyme for Gene Silencing to Suppress Cell Growth Lingxian Meng, Wenjuan Ma, Shi-Yu Lin, Sirong Shi, Yanjing Li, and Yun-Feng Lin ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b22444 • Publication Date (Web): 30 Jan 2019 Downloaded from http://pubs.acs.org on February 5, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Tetrahedral DNA Nanostructure-delivered DNAzyme for Gene Silencing to Suppress Cell Growth

Lingxian Meng†, Wenjuan Ma†, Shiyu Lin, Sirong Shi, Yanjing Li, Yunfeng Lin* State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041, P.R. China

*Corresponding author: Yunfeng Lin State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041, P.R. China Tel: +86-28-85503487; fax: +86-28-85582167; e-mail: [email protected] †Lingxian

Meng and Wenjuan Ma contributed equally to this work.

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract

DNAzymes are synthetic oligonucleotides that are capable of target mRNA cleavage to exert gene-silencing activity and considered as promising therapeutic agents. Dz13 is a DNAzyme that cleaves the mRNA of c-Jun and suppresses the growth of squamous cell carcinomas. However, DNAzymes exhibit low cellular uptake efficacy and require a suitable drug delivery system. In this study, we directly added the Dz13 sequence to the 5′- end of single-stranded DNA to form modified tetrahedral DNA nanostructures (TDN-Dz13). TDNs were used to deliver the single-stranded DNAzyme Dz13 into cells. Dz13 delivered by the TDNs showed high cellular uptake efficiency and still maintained intracellular gene-silencing activity to cleave the target c-Jun mRNA, which reduced cell proliferation. This study may help finding a convenient approach for the delivery of DNAzymes to regulate target genes.

Keywords: DNA nanomaterial, drug delivery, DNAzymes, gene-silence, c-Jun, proliferation


Page 2 of 23

Page 3 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction DNA enzymes, or DNAzymes, are catalytically active, single-stranded, synthetic oligonucleotides that are capable to target and bind with mRNA, and then cleave the mRNA at predetermined phosphodiester linkages.1 Unlike siRNA or antisense oligonucleotides, DNAzymes are composed entirely of DNA and contain a catalytic domain. DNAzymes have been discovered as a variety of gene targets.2 And Dz13 is a DNAzyme that cleaves the mRNA of c-Jun. The c-Jun protein is a prototypic member of the activator protein 1 family of transcription factors, which is closely correlated with cell proliferation, transformation, and apoptosis.3-4 Activator protein-1 is also a target for suppressing tumors and cell differentiation.5-7 It has been demonstrated that Dz13 suppresses the growth of squamous cell carcinomas by inhibiting the overexpression c-Jun mRNA as well as the downstream c-Jun protein expression.8-11 Dz13 as well as other DNAzymes are considered as promising therapeutic agents for many diseases.12-14 However, they exhibit low cellular uptake efficacy and require a suitable drug delivery system. Tetrahedral DNA nanostructures (TDNs) have gained attention in both the biological and biomedical fields because of their prominent mechanical rigidity, high structural stability, advanced biocompatibility, convenient synthesis, and uncomplicated modification of functional groups.15-21 Moreover, TDNs have been considered as a promising delivery system for achieving advanced cell permeability without transfection agents.22-23 The sequences of therapeutic oligonucleotide drugs can easily be incorporated to TDNs.21,

24-25

In this study, we employed TDNs to deliver the



DNAzyme Dz13 (TDN-Dz13) by directly adding the Dz13 sequence to the 5′- end of one ssDNA to form Dz13 modified TDNs and evaluated the intracellular gene silencing effects on the target mRNA. We hypothesized that TDN-Dz13 had the ability to transport DNAzyme Dz13 into cells and inhibit cell proliferation.

Results and Discussion Synthesis, characterization of TDN-Dz13. The c-Jun mRNA targeting DNAzyme Dz13 was showed in Figure 1A. With 9+9– nucleotide arms for recognizing and binding to a specific mRNA, Dz13 cleaves the mRNA of c-Jun through a de-esterification reaction12. The sequence of Dz13 was linked to the 5′- end of S3 (S3-Dz13) (Table 1), and TDN-Dz13 was synthesized with S1, S2, S3-Dz13, and S4 through the same procedure as TDNs in our previous studies15, 26. Each face of TDN-Dz13 was formed by one ssDNA, and each ssDNA was combined with the other three ssDNAs by highly specific Watson-Crick base pairing, leaving the extended Dz13 sequence at the apex of the tetrahedron (Figure 1B). To confirm the successful synthesis of TDN-Dz13, polyacrylamide gel electrophoresis (8%, PAGE) was conducted to separate the DNA samples based on their mobilities (Figure 1C). TDN-Dz13 moved more slowly than TDNs because of the added Dz13 sequence, which suggested that TDN-Dz13 was successfully synthesized. To determine the size of the TDN-Dz13, dynamic light scattering (DLS) was employed and found that TDN-Dz13 have a hydrodynamic diameter of approximately 14 nm (Figure 1D), which was different with the size of TDNs and suggested the successful


Page 4 of 23

Page 5 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


synthesis of TDN-Dz13. We also used atomic force microscopy (AFM) to determine the average size of the nanostructure. The results revealed that the height and width of TDN-Dz13 were approximately 2 nm and 15 nm, respectively (Figure 1E). These results indicated that the TDN-Dz13 were successfully fabricated and that their characteristics were not influenced by the extended Dz13 sequence.

Cellular uptake of TDN-Dz13. TDN-Dz13 and free Dz13 were modified with Cy5. After A431 cell were incubated with Cy5-TDN-Dz13 or free Cy5-Dz13 for 12 h, a confocal laser microscope was used to capture images (Figure 2A). The Cy5 fluorescence signal in TDN-Dz13 treated cells was much stronger than that in Dz13-treated A431 cells. The result showed that TDNDz13 were internalized by A431 cells, while free Dz13 was not. We also employed flow cytometry to quantitatively analyze the uptake of TDN-Dz13 by A431 cells after 12 h incubation of Cy5-labeled TDN-Dz13 or free Dz13. As shown in Figure 2B, Cy5 fluorescence in TDN-Dz13 treated A431 cells was approximately three times stronger than free Dz13 treated A431 cells. Single-stranded DNA usually cannot be absorbed by cells27, while TDNs have been demonstrated to exert easy penetration through the cell membrane without transfection agents. 22-23,28 And the Dz13 sequence was transported into A431 cells with high uptake efficiency because of the high cell permeability of TDNs.

The cell growth suppression of A431 by TDN-Dz13. After confirming the cellular uptake of TDN-Dz13 by A431 cells, we evaluated whether the TDN-Dz13 maintained the influence of Dz13 on cell growth. The cells



were treated with serum free conditions overnight to reach a growth-quiescent state. Next, growth-quiescent A431 cells were firstly treated with TDN-Dz13 to ensure its uptake by the cells before the induction of c-Jun mRNA. A Cell Counting Kit-8 assay was performed after 12 h incubation in medium-containing serum. The results showed that the cell proliferation of A431 cells was inhibited by TDN-Dz13, while ss-Dz13 and TDNs did not inhibit serum-inducible A431 proliferation (Figure 3A). We further analyzed cell proliferation by measuring the cells that incorporated BrdU in their newly synthesized DNA (Figure 3B). Quantification of new BrdU+ cells showed that only 40% of new cells incorporated BrdU following TDN-Dz13 treatment, while BrdU+ cells treated with Dz13 or TDNs showed similar results as the control group with approximately 70% incorporation, which is much higher than that of the TDN-Dz13 group. These results demonstrated that TDN-Dz13 reduced the proliferation of A431 cells. Dz13 delivered by TDNs entered the cells and exerted its function.

Gene silencing activity of TDN-Dz13 in A431 cells. We further evaluated whether the growth-suppressing effects on A431 cells occurred through the intracellular silencing activity of TDN-Dz13 on c-Jun mRNA. The gene transcription of c-Jun is rapidly induced when cells begin to proliferate.29 Thus, adding serum induces the expression of c-Jun mRNA.8, 12 Before c-Jun mRNA was induced, serum-starved A431 cells were preincubated with TDN-Dz13 for 12 h to enable TDNDz13 to be in the cells. We then stimulated the cells with 10% fetal bovine serum (FBS) for 30 min and exposed the cells to actinomycin D (10 mg/mL) to block new c-Jun mRNA expression before RNA harvest. In this model, there were equal amount of


Page 6 of 23

Page 7 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


newly produced c-Jun mRNA due to the same induction of serum. However, the qPCR results showed that in the TDN-Dz13 treated group, the c-Jun mRNA level was much lower than that in the control group (Figure 4A). This suggested that newly produced c-Jun mRNA was cleaved by TDN-Dz13, confirming the intracellular gene-silencing effect of TDN-Dz13. We further examined downstream c-Jun protein expression by western blotting (Figure 4B-C). The results revealed a decrease level of c-Jun protein expression in the TDN-Dz13 group. A similar level of decrease was also observed in cJun protein expression by immunofluorescence (Figure 4D-E). Both experiments confirmed the serum-induced c-Jun protein expression was reduced by TDN-Dz13. These results indicated that Dz13 delivered by TDNs still retained its ability to target the c-Jun gene for silencing in the cell environment. Gene-silencing strategies with functional oligonucleotides have been rapidly developed in the past decades. Antisense oligonucleotides, small interfering RNAs(siRNAs), and DNAzymes have been studied for years due to their capability of mRNA recognition and cleavage. First, they target the mRNA through hybridization, and then the mRNA cleavage is performed in different mechanisms.30 For antisense oligonucleotides, Ribonuclease H (RNase H) is needed to bind and cleave mRNA after hybridization. For siRNA, after entering cells, the double-stranded siRNA unwinds and the stand complementary to target mRNA is incorporated into the RNA-induced silencing complex, which is a nuclease-containing multi-protein complex and cleaves the mRNA. However, DNAzymes are able to cleave mRNA without endogenous nucleases because of the intrinsic catalytic activity. Moreover, although the sequence



of DNAzyme is appended to the apex of the tetrahedral nanostructures in our study, DNAzymes do not need to cooperate with other nucleases, and the effect of the TDNs on DNAzyme function is less. Efficient delivery of DNAzymes into cells remains challenging. DNAzymes have poor cell membrane permeability due to their negative charges.31-32 Recent studies have delivered several DNAzymes into cells using AuNPs, cationic polymers or liposomes.8, 33-34

However, these agents are also inherently cytotoxic.35-38 On the other hand, DNA

nanostructures do not exhibit obvious cytotoxicity and immunogenicity to live cells, and are promising agents for drug delivery.39-40 Despite the development of nanomaterials like gold nanoparticles, quantum dots and carbon nanotubes,41-47 DNA nanostructures still attract lots of attention in a variety of biomedical researches, such as bioimaging, cellular immunity, disease diagnosis, and drug delivery.48-49 And the TDNs used in our study are capable to enter cells via endocytosis and remains substantially intact within the cytoplasm.19,

50

Moreover, because the TDNs are

synthesized with designed DNA oligonucleotides, they can easily be programmed to carry the functional oligonucleotides. It should also be noted that, TDNs have many binding sites, and more functional group can be easily applied for the development of celluar and subcellular targeting delivery. For example, nuclear localization signal (NLS) peptide can be decorated in the future studies, to transport the DNA nanostructure to nuclei and subsequently release the DNAzyme mainly around the nucleus, enhancing downregulation of target mRNA in nucleus and cytoplasm.19 We also wonder whether TDN-Dz13 has the same


Page 8 of 23

Page 9 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


influence on other cancer cells with the expression of c-Jun, and we still have lots of work to do.

Conclusion In conclusion, we delivered DNAzyme Dz13 into cells using TDNs by directly adding the Dz13 sequence to the 5′- end of one ssDNA to form TDN-Dz13. The extra sequence of Dz13 did not prevent TDNs formation; additionally, the TDNs did not significantly disturb the activity of Dz13. TDN-Dz13 entered cells and showed intracellular gene-silencing effects compared to ss-Dz13. Directly linking a DNAzyme sequence to the DNA tetrahedra nanostructure to regulate target genes is a convenient and promising approach for the applications of DNAzymes.

Experimental Section Cell Culture. We cultured the human epidermoid carcinoma cells (A431 cells) in high-glucose Dulbecco’s modified Eagle’s medium with 10% (v/v) FBS and 1% (v/v) penicillin−streptomycin solution. The culture condition was set at 37°C and with 5%CO2. Synthesis of TDNs and TDN-Dz13. The designed ssDNA (Table 1) were synthesized by Takara (Dalian, China). TDNs were synthesized as follows: S1, S2, S3, and S4 at the same concentrations were added into TM buffer (10 mM Tris-HCl, 50 mM MgCl2·6H2O, pH 8.0). We heated the



mixture as the following process: 95°C for 10 min and then 4°C for 20 min. 26, 51 TDNDz13 was synthetized through the same procedure with S1, S2, S3-Dz13, and S4.

Characterization of TDN-Dz13. To confirm the successfully synthesis of TDN-Dz13, polyacrylamide gel electrophoresis (PAGE) was conducted as previous studies.15, 21, 52-53 To measure the average size of the particles, atomic force microscopy (AFM; SPM-9700 instrument, Shimadzu, Kyoto, Japan) and dynamic light scattering (Zetasizer Nano ZS90, Malvern Instruments, Ltd., Malvern, UK) were conducted. A 10 μL portion of the properly diluted TDN-Dz13 solution was dripped onto cleaved mica, followed by air-drying for 15 min, and then the sample was measured by AFM.

Cellular Uptake of TDN-Dz13. After A431 cell attachment, cells were treated with TDN-Dz13 modified with cyanine 5 (Cy5-TDN-Dz13) or free Dz13 loaded with Cy5 (Cy5-Dz13) and incubated for 12 h in medium without serum. Then cells were washed and fixed, and the nuclei and cytoskeleton were stained and rewashed with DAPI and phalloidin, respectively. Images were captured by confocal laser microscopy (TCS SP8; Leica, Wetzlar, Germany). Cellular uptake was also analyzed using flow cytometry. Cy5-TDN-Dz13 or Cy5-Dz13 were added after cells attachment. Then the cells were collected at 12 h and tested by the flow cytometer (FC500 Beckman, IL, USA).

Cell Viability Assay.


Page 10 of 23

Page 11 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The A431 cells were rendered to be growth-quiescent through incubation with serumfree medium after cell attachment into a 96-well plate (3000 cells per well). After cells arrest, the cells were divided into four groups: the control group, TDN-Dz13 (400 nM) group, Dz13 (400 nM) group, and TDNs (400 nM) group, and treated for 12 h. A Cell Counting Kit-8 assay (CCK-8) (Dojindo, Kumamoto, Japan) was performed after 12 h incubation with medium containing serum. Finally, the cell viability of four groups was tested at 450 nm (Thermo Fisher Scientific, Waltham, MA, USA)

BrdU Incorporation Analysis. Cells seeded on cover glasses were induced to a growth-quiescent state in serum-free medium for 12 h. Four groups of the cells: the control group, TDN-Dz13 (400 nM) group, Dz13 (400 nM) group, and TDNs (400 nM) group, are treated for 12 h. The medium was changed to medium containing 10 µM BrdU (Sigma–Aldrich, St. Louis, MO, USA) and incubated for 8 h with medium containing serum. After 8 h, the cells went through fixation and permeabilization and were treated in 2 M HCl (30 min). Samples were then rewashed, blocked, and incubated with 1:250 mouse anti-BrdU antibody (OM241956, Ominimabs, Alhambra, CA, USA) for 12 h at 4°C. On the next day, the samples were rewashed and incubated with secondary antibody with fluorescence (1:500; Thermo Fisher Scientific) for 1 h at 37℃. Finally, the samples were rewashed and stained with DAPI for 10 min and observed under an Olympus fluorescence microscope (Tokyo, Japan). BrdU-positive cells (BrdU+) were counted in eight random microscope fields. The percentage of the BrdU+ cells in the field were analyzed.



Quantitative Real-time PCR to Measure c-Jun mRNA. Serum-starved A431 cells were divided into four groups: the control group, TDNDz13 group, Dz13 group, and TDNs group. The last three groups were incubated with TDN-Dz13 (400 nM), Dz13 (400 nM), and TDNs (400 nM) for 12 h, respectively and then all groups were stimulated with 10% FBS for 30 min. Actinomycin D (Act D, 10 mg/mL) were added to block new c-Jun mRNA expression. After 30 min, total RNA was harvested with RNeasy Plus Mini Kit (Biotech, China). cDNA synthesis was performed with a cDNA synthesis kit (Prime Script™ RT reagent Kit, Takara, Japan). The primers for c-Jun and GAPDH (synthesized by Takara) are listed in Table 2. Target cDNA was amplified for real-time PCR in an ABI7900 (Thermo Fisher Scientific) followed with the recommend procedure.

Western blotting Growth-arrested A431 were divided into four groups. The first group was control group and the other three groups were treated with TDN-Dz13 (400 nM), Dz13 (400 nM), and TDNs (400 nM) for 12 h, respectively. Then all groups were exposed to serum-containing medium for 2 h. The whole cell lysis assay (KeyGen, Nanjing, China) were used to harvest the protein samples. After determining the protein concentration, we boiled the proteins in sodium dodecyl sulfate (SDS) buffer and used 12% SDSPAGE to separate the target proteins. They were then transferred to a polyvinylidene fluoride nylon membrane (Millipore, Bedford, MA, USA). After being blocked, incubation overnight with 1:1000 anti-c-Jun antibody (ab32137, Abcam, Cambridge,


Page 12 of 23

Page 13 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


UK) at 4°C were performed. On the next day, the secondary antibody (Beyotime, Shanghai, China) was used to incubate the membrane for 1 h at room temperature. Finally, the Bio-Rad detection system was used to detect immunoreactivity. GAPDH was chosen as the internal control.

Immunofluorescence Growth-arrested A431 were divided into four groups: the control group, TDN-Dz13 group, Dz13 group, and TDNs group. The last three groups were treated with TDNDz13 (400 nM), Dz13 (400 nM), and TDNs (400 nM) for 12 h, respectively and then all groups were exposed to serum-containing medium for 2 h. After fixation and permeabilization of the standard process, the samples were blocked and incubated with 1:250 anti-c-Jun antibody (ab32137, Abcam) overnight at 4°C. On the next day, secondary antibodies with fluoresce labeled (Thermo Fisher Scientific) were employed to incubate the samples for 1 h at 37°C. Finally, the cytoskeleton and nuclei were stained, and images were captured under a confocal laser scanning microscopy (Leica TCS SP8).

Statistics Data are presented with mean ± SD. One-way ANOVA was employed for statistical analysis by SPSS 18.0 （ IBM, Armonk, NY, USA ） and p value less than 0.05 indicated statistically significant results.



Acknowledgements This work was supported by the National Natural Science Foundation of China (81671031, 81470721).

Notes The authors declare no conflict of interests.

References (1) Santoro, S. W.; Joyce, G. F. A General Purpose Rna-Cleaving DNA Enzyme. Proc Natl Acad Sci U S A 1997, 94 (9), 4262-4266. (2) Isaka, Y. Dnazymes as Potential Therapeutic Molecules. Current Opinion in Molecular Therapeutics 2007, 9 (2), 132-136. (3) Vleugel, M. M.; Greijer, A. E.; Bos, R.; van der Wall, E.; van Diest, P. J. C-Jun Activation Is Associated with Proliferation and Angiogenesis in Invasive Breast Cancer. Hum Pathol 2006, 37 (6), 668-674. (4) Young, M. R.; Li, J. J.; Rincon, M.; Flavell, R. A.; Sathyanarayana, B. K.; Hunziker, R.; Colburn, N. Transgenic Mice Demonstrate Ap-1 (Activator Protein-1) Transactivation Is Required for Tumor Promotion. P Natl Acad Sci USA 1999, 96 (17), 9827-9832. (5) Wagner, E. F. Ap-1--Introductory Remarks. Oncogene 2001, 20 (19), 2334-2335. (6) Shaulian, E. Ap-1--the Jun Proteins: Oncogenes or Tumor Suppressors in Disguise? Cell Signal 2010, 22 (6), 894-899. (7) Jochum, W.; Passegue, E.; Wagner, E. F. Ap-1 in Mouse Development and Tumorigenesis. Oncogene 2001, 20 (19), 2401-2412. (8) Cai, H.; Santiago, F. S.; Prado-Lourenco, L.; Wang, B.; Patrikakis, M.; Davenport, M. P.; Maghzal, G. J.; Stocker, R.; Parish, C. R.; Chong, B. H.; Lieschke, G. J.; Wong, T. W.; Chesterman, C. N.; Francis, D. J.; Moloney, F. J.; Barnetson, R. S.; Halliday, G. M.; Khachigian, L. M. Dnazyme Targeting C-Jun Suppresses Skin Cancer Growth. Sci Transl Med 2012, 4 (139), 139ra182. (9) Schmidts, T.; Marquardt, K.; Schlupp, P.; Dobler, D.; Heinz, F.; Mader, U.; Garn, H.; Renz, H.; Zeitvogel, J.; Werfel, T.; Runkel, F. Development of Drug Delivery Systems for the Dermal Application of Therapeutic Dnazymes. Int J Pharm 2012, 431 (1-2), 61-69. (10) Zhang, G.; Luo, X.; Sumithran, E.; Pua, V. S. C.; Barnetson, R. S. C.; Halliday, G. M.; Khachigian, L. M. Squamous Cell Carcinoma Growth in Mice and in Culture Is Regulated by C-Jun and Its Control of Matrix Metalloproteinase-2 and -9 Expression. Oncogene 2006, 25 (55), 7260-7266. (11) Chen, N.; Nomura, M.; She, Q. B.; Ma, W. Y.; Bode, A. M.; Wang, L.; Flavell, R. A.; Dong, Z. Suppression of Skin Tumorigenesis in C-Jun Nh(2)-Terminal Kinase-2-Deficient Mice. Cancer Res 2001, 61 (10), 3908-3912. (12) Khachigian, L. M.; Fahmy, R. G.; Zhang, G.; Bobryshev, Y. V.; Kaniaros, A. C-Jun Regulates Vascular Smooth Muscle Cell Growth and Neointima Formation after Arterial Injury. Inhibition by a Novel DNA Enzyme Targeting C-Jun. J Biol Chem 2002, 277 (25), 22985-22991.


Page 14 of 23

Page 15 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(13) Zhang, G.; Dass, C. R.; Sumithran, E.; Di Girolamo, N.; Sun, L. Q.; Khachigian, L. M. Effect of Deoxyribozymes Targeting C-Jun on Solid Tumor Growth and Angiogenesis in Rodents. J Natl Cancer Inst 2004, 96 (9), 683-696. (14) Dass, C. R.; Choong, P. F.; Khachigian, L. M. Dnazyme Technology and Cancer Therapy: Cleave and Let Die. Mol Cancer Ther 2008, 7 (2), 243-251. (15) Shao, X.; Lin, S.; Peng, Q.; Shi, S.; Wei, X.; Zhang, T.; Lin, Y. Tetrahedral DNA Nanostructure: A Potential Promoter for Cartilage Tissue Regeneration Via Regulating Chondrocyte Phenotype and Proliferation. Small 2017, 13 (12), 1602770. (16) Chao, J.; Wang, J.; Wang, F.; Ouyang, X.; Kopperger, E.; Liu, H.; Li, Q.; Shi, J.; Wang, L.; Hu, J.; Wang, L.; Huang, W.; Simmel, F. C.; Fan, C. Solving Mazes with Single-Molecule DNA Navigators. Nat Mater 2018, DOI: 10.1038/s41563-018-0205-3. (17) Han, Y. P.; Li, X. M.; Chen, H. B.; Hu, X. J.; Luo, Y.; Wang, T.; Wang, Z. J.; Li, Q.; Fan, C. H.; Shi, J. Y.; Wang, L. H.; Zhao, Y.; Wu, C. F.; Chen, N. Real-Time Imaging of Endocytosis and Intracellular Trafficking of Semiconducting Polymer Dots. Acs Applied Materials & Interfaces 2017, 9 (25), 21200-21208. (18) Hu, Y.; Chen, Z.; Zhang, H.; Li, M.; Hou, Z.; Luo, X.; Xue, X. Development of DNA Tetrahedron-Based Drug Delivery System. Drug Deliv 2017, 24 (1), 1295-1301. (19) Liang, L.; Li, J.; Li, Q.; Huang, Q.; Shi, J.; Yan, H.; Fan, C. Single-Particle Tracking and Modulation of Cell Entry Pathways of a Tetrahedral DNA Nanostructure in Live Cells. Angew Chem Int Ed Engl 2014, 53 (30), 7745-7750. (20) Xie, X.; Shao, X.; Ma, W.; Zhao, D.; Shi, S.; Li, Q.; Lin, Y. Overcoming Drug-Resistant Lung Cancer by Paclitaxel Loaded Tetrahedral DNA Nanostructures. Nanoscale 2018, 10 (12), 5457-5465. (21) Li, Q.; Zhao, D.; Shao, X.; Lin, S.; Xie, X.; Liu, M.; Ma, W.; Shi, S.; Lin, Y. Aptamer-Modified Tetrahedral DNA Nanostructure for Tumor-Targeted Drug Delivery. ACS Appl Mater Interfaces 2017, 9 (42), 3669536701. (22) Kim, K. R.; Kim, D. R.; Lee, T.; Yhee, J. Y.; Kim, B. S.; Kwon, I. C.; Ahn, D. R. Drug Delivery by a SelfAssembled DNA Tetrahedron for Overcoming Drug Resistance in Breast Cancer Cells. Chem Commun (Camb) 2013, 49 (20), 2010-2012. (23) Tian, T. R.; Zhang, T.; Zhou, T. F.; Lin, S. Y.; Shi, S. R.; Lin, Y. F. Synthesis of an Ethyleneimine/Tetrahedral DNA Nanostructure Complex and Its Potential Application as a MultiFunctional Delivery Vehicle. Nanoscale 2017, 9 (46), 18402-18412. (24) Liu, M.; Ma, W.; Li, Q.; Zhao, D.; Shao, X.; Huang, Q.; Hao, L.; Lin, Y. Aptamer-Targeted DNA Nanostructures with Doxorubicin to Treat Protein Tyrosine Kinase 7-Positive Tumours. Cell Prolif 2018, 52(1):e12511. (25) Zhang, Y.; Ma, W.; Zhu, Y.; Shi, S.; Li, Q.; Mao, C.; Zhao, D.; Zhan, Y.; Shi, J.; Li, W.; Wang, L.; Fan, C.; Lin, Y. Inhibiting Methicillin-Resistant Staphylococcus Aureus by Tetrahedral DNA NanostructureEnabled Antisense Peptide Nucleic Acid Delivery. Nano Lett 2018, 18, 5652−5659. (26) Shi, S.; Peng, Q.; Shao, X.; Xie, J.; Lin, S.; Zhang, T.; Li, Q.; Li, X.; Lin, Y. Self-Assembled Tetrahedral DNA Nanostructures Promote Adipose-Derived Stem Cell Migration Via Lncrna Xloc 010623 and Rhoa/Rock2 Signal Pathway. ACS Appl Mater Interfaces 2016, 8 (30), 19353-19363. (27) Ouyang, X. Y.; Li, J.; Liu, H. J.; Zhao, B.; Yan, J.; He, D. N.; Fan, C. H.; Chao, J. Self-Assembly of DNABased Drug Delivery Nanocarriers with Rolling Circle Amplification. Methods 2014, 67 (2), 198-204. (28) Peng, Q.; Shao, X. R.; Xie, J.; Shi, S. R.; Wei, X. Q.; Zhang, T.; Cai, X. X.; Lin, Y. F. Understanding the Biomedical Effects of the Self-Assembled Tetrahedral DNA Nanostructure on Living Cells. Acs Appl Mater Inter 2016, 8 (20), 12733-12739.



(29) Ryseck, R. P.; Hirai, S. I.; Yaniv, M.; Bravo, R. Transcriptional Activation of C-Jun During the G0/G1 Transition in Mouse Fibroblasts. Nature 1988, 334 (6182), 535-537. (30) Zhou, W.; Ding, J.; Liu, J. Theranostic Dnazymes. Theranostics 2017, 7 (4), 1010-1025. (31) Dass, C. R.; Saravolac, E. G.; Li, Y.; Sun, L. Q. Cellular Uptake, Distribution, and Stability of 10-23 Deoxyribozymes. Antisense Nucleic Acid Drug Dev 2002, 12 (5), 289-299. (32) Patil, S. D.; Rhodes, D. G.; Burgess, D. J. DNA-Based Therapeutics and DNA Delivery Systems: A Comprehensive Review. AAPS J 2005, 7 (1), E61-77. (33) Wu, P.; Hwang, K.; Lan, T.; Lu, Y. A Dnazyme-Gold Nanoparticle Probe for Uranyl Ion in Living Cells. J Am Chem Soc 2013, 135 (14), 5254-5257. (34) Torabi, S. F.; Wu, P.; McGhee, C. E.; Chen, L.; Hwang, K.; Zheng, N.; Cheng, J.; Lu, Y. In Vitro Selection of a Sodium-Specific Dnazyme and Its Application in Intracellular Sensing. Proc Natl Acad Sci U S A 2015, 112 (19), 5903-5908. (35) Lv, H.; Zhang, S.; Wang, B.; Cui, S.; Yan, J. Toxicity of Cationic Lipids and Cationic Polymers in Gene Delivery. J Control Release 2006, 114 (1), 100-109. (36) Oh, Y. K.; Park, T. G. Sirna Delivery Systems for Cancer Treatment. Adv Drug Deliv Rev 2009, 61 (10), 850-862. (37) Tan, M. L.; Choong, P. F.; Dass, C. R. Dnazyme Delivery Systems: Getting Past First Base. Expert Opin Drug Deliv 2009, 6 (2), 127-138. (38) Fokina, A. A.; Chelobanov, B. P.; Fujii, M.; Stetsenko, D. A. Delivery of Therapeutic Rna-Cleaving Oligodeoxyribonucleotides (Deoxyribozymes): From Cell Culture Studies to Clinical Trials. Expert Opin Drug Deliv 2017, 14 (9), 1077-1089. (39) Walsh, A. S.; Yin, H.; Erben, C. M.; Wood, M. J.; Turberfield, A. J. DNA Cage Delivery to Mammalian Cells. ACS Nano 2011, 5 (7), 5427-5432. (40) Hu, Q.; Li, H.; Wang, L.; Gu, H.; Fan, C. DNA Nanotechnology-Enabled Drug Delivery Systems. Chem Rev 2018, DOI: 10.1021/acs.chemrev.7b00663. (41) Sun, H. F.; Chao, J.; Zuo, X. L.; Su, S.; Liu, X. F.; Yuwen, L. H.; Fan, C. H.; Wang, L. H. Gold NanoparticleDecorated Mos2 Nanosheets for Simultaneous Detection of Ascorbic Acid, Dopamine and Uric Acid. Rsc Adv 2014, 4 (52), 27625-27629. (42) He, Y.; Zhong, Y.; Su, Y.; Lu, Y.; Jiang, Z.; Peng, F.; Xu, T.; Su, S.; Huang, Q.; Fan, C.; Lee, S. T. WaterDispersed near-Infrared-Emitting Quantum Dots of Ultrasmall Sizes for in Vitro and in Vivo Imaging. Angew Chem Int Ed Engl 2011, 50 (25), 5695-5698. (43) Fan, C. H.; Zhuang, Y.; Li, G. X.; Zhu, J. Q.; Zhu, D. X. Direct Electrochemistry and Enhanced Catalytic Activity for Hemoglobin in a Sodium Montmorillonite Film. Electroanal 2000, 12 (14), 1156-1158. (44) Zuo, X.; Cheng P.; Huang, Q.; Song S.; Wang L.; Li D.; Fan C. Design of a Carbon Nanotube/Magnetic Nanoparticle-Based Peroxidase-Like Nanocomplex and Its Application for Highly Efficient Catalytic Oxidation of Phenols. Nano Research 2009, 2 (8 ), 617-623. (45) Li J.; Song S.; Liu X.; Wang L.; Pan D.; Huang Q.; Zhao Y.; Fan C. Enzyme-Based Multi-Component Optical Nanoprobes for Sequence-Specific Detection of DNA Hybridization. Advanced Materials 2008, 20 (3), 497. (46) Zhang, Q.; Lin, S.; Zhang, T.; Tian, T.; Ma, Q.; Xie, X.; Xue, C.; Lin, Y.; Zhu, B.; Cai, X. Curved Microstructures Promote Osteogenesis of Mesenchymal Stem Cells Via the Rhoa/Rock Pathway. Cell Prolif 2017, 50 (4), e12356.


Page 16 of 23

Page 17 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(47) Zhao, D.; Li, Q.; Liu, M.; Ma, W.; Zhou, T.; Xue, C.; Cai, X. Substrate Stiffness Regulated Migration and Invasion Ability of Adenoid Cystic Carcinoma Cells Via Rhoa/Rock Pathway. Cell Prolif 2018, 51 (3), e12442. (48) Lin, M.; Wang, J.; Zhou, G.; Wang, J.; Wu, N.; Lu, J.; Gao, J.; Chen, X.; Shi, J.; Zuo, X.; Fan, C. Programmable Engineering of a Biosensing Interface with Tetrahedral DNA Nanostructures for Ultrasensitive DNA Detection. Angew Chem Int Ed Engl 2015, 54 (7), 2151-2155. (49) Wen, Y.; Pei, H.; Shen, Y.; Xi, J.; Lin, M.; Lu, N.; Shen, X.; Li, J.; Fan, C. DNA Nanostructure-Based Interfacial Engineering for Pcr-Free Ultrasensitive Electrochemical Analysis of Microrna. Sci Rep 2012, 2, 867. (50) Keum, J. W.; Bermudez, H. Enhanced Resistance of DNA Nanostructures to Enzymatic Digestion. Chem Commun (Camb) 2009, (45), 7036-7038. (51) Shao, X. R.; Lin, S. Y.; Peng, Q.; Shi, S. R.; Li, X. L.; Zhang, T.; Lin, Y. F. Effect of Tetrahedral DNA Nanostructures on Osteogenic Differentiation of Mesenchymal Stem Cells Via Activation of the Wnt/Beta-Catenin Signaling Pathway. Nanomedicine 2017, 13 (5), 1809-1819. (52) Ma, W.; Xie, X.; Shao, X.; Zhang, Y.; Mao, C.; Zhan, Y.; Zhao, D.; Liu, M.; Li, Q.; Lin, Y. Tetrahedral DNA Nanostructures Facilitate Neural Stem Cell Migration Via Activating Rhoa/Rock2 Signalling Pathway. Cell Prolif 2018, 51 (6), e12503. (53) Shi, S.; Lin, S.; Shao, X.; Li, Q.; Tao, Z.; Lin, Y. Modulation of Chondrocyte Motility by Tetrahedral DNA Nanostructures. Cell Prolif 2017, 50 (5), e12368.



Table 1. The sequence of four designed specific ssDNA. ssDNA

Sequences (from 5'to 3')

S1

ATTTATCACCCGCCATAGTAGACGTATCACCAG GCAGTTGAGACGAACATTCCTAAGTCTGAA

S2

ACATGCGAGGGTCCAATACCGACGATTACA GCTTGCTACACGATTCAGACTTAGGAATGTTCG

S3

ACTACTATGGCGGGTGATAAAACGTGTAGCA AGCTGTAATCGACGGGAAGAGCATGCCCATCC

S3-Dz13

C*GGGAGGAAGGCTAGCTACAACGAGAGGCGTTGTTTTTT ACTACTATGGCGGGTGATAAAACGTGTAGCA AGCTGTAATCGACGGGAAGAGCATGCCCATCC

S4

ACGGTATTGGACCCTCGCATGACTCAACTGC

　

CTGGTGATACGAGGATGGGCATGCTCTTCCCG

Dz13

C*GGGAGGAAGGCTAGCTACAACGAGAGGCGTT*G

Cy5-S1

Cy5-ATTTATCACCCGCCATAGTAGACGTATCACCAG GCAGTTGAGACGAACATTCCTAAGTCTGAA

Cy5-Dz13

Cy5-C*GGGAGGAAGGCTAGCTACAACGAGAGGCGTT*G

* represents a phosphorothioate Table 2. Sequences of forward and reverse primers of selected genes designed for qPCR mRNA

　

Primer pairs

GAPDH

Forward

TCAAGGCTGAGAACGGGAAG

Reverse

ATGGTGGTGAAGACGCCAGT

c-Jun

Forward

TGACTGCAAAGATGGAAACG

　

Reverse

CAGGGTCATGCTCTGTTTCA


Page 18 of 23

Page 19 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure legends

Figure 1. Preparation and characterization of TDN-Dz13. (A) Representation of DNAzyme Dz13 cleavage sites (arrows) in c-Jun mRNA. (B)Schematic of synthesis of TDN-Dz13. (C) Analysis by 8% polyacrylamide gel electrophoresis (PAGE). Lane 1, S1+S2+S3-Dz13+S4, lane 2, S1+S2+S3+S4, lane 3, S1+S2+S3, lane 4, S1+S2, lane 5, S1. (D) Hydrodynamic size of TDN-Dz13 measured by dynamic light scattering (DLS). (E) AFM images of TDN-Dz13. The detection shows a height of about 2 nm in height and the width is about 15 nm.



Figure 2. Cellular uptake of TDN-Dz13. (A) Confocal images of intracellular uptake of Cy5-TDNDz13 and Cy5-ssDz13 (Cy5: red; Phalloidin: green; DAPI: blue). Scale bars are 25 μm. (B) Characterized the proportion of cells uptake of Cy5-TDN-Dz13 by Flow cytometry.


Page 20 of 23

Page 21 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Analysis of cell proliferation after treatment with TDN-Dz13. (A) Growth-quiescent A431 cells were treated with 400 nM TDN-Dz13 for 12 h and incubated with medium containing serum for another 12 h. The CCK-8 assay was applied to detect changes in the proliferation of A431 cells. Data are presented as mean ±SD (n=3). Statistical analysis: * p < 0.05. (B-C) Analysis of cell proliferation by BrdU incorporation. Growth-quiescent cells were first treated with TDN-Dz13 (400 nM). The medium was then changed to medium containing 10 µM BrdU and incubated for 8 h with medium containing serum. Eight random microscope fields were taken and one was represented (BrdU: red; DAPI: blue). Scale bars are 100 μm. BrdU+ cells were counted in eight random microscope fields and the quantification of BrdU+ cells relative to the total number of cells shows significant statistical differences. Data are presented as mean ±SD (n=8). Statistical analysis: ** p < 0.01.



Figure 4. Gene silencing activity of TDN-Dz13 in A431 cells. (A) qPCR analysis of c-Jun mRNA expression. Growth-quiescent cells were transfected overnight with 400 nM TDN-Dz13 and then serum-induced for 30 min and incubated with actinomycin D for another 30 min before RNA harvest. Data are presented as mean ±SD (n=3). Statistical analysis: ** p < 0.01. (B-C) Growthquiescent cells were transfected overnight with 400 nM TDN-Dz13 and then serum-induced for 2 h before Western blotting analysis of c-Jun expression and its quantification. Data are presented as mean ±SD (n=3). Statistical analysis: ** p < 0.01. (D-E) Detected fluorophore of c-Jun expression by confocal microscope and its quantification. (c-Jun: red; Phalloidin: green; DAPI: blue) Scale bars are 25 μm. Data are presented as mean ±SD (n=3). Statistical analysis: * p < 0.05.


Page 22 of 23

Page 23 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of Contents


Tetrahedral DNA Nanostructure-Delivered DNAzyme for Gene

Recommend Documents